Báo cáo khoa học: RNA reprogramming of a-mannosidase mRNA sequences in vitro by myxomycete group IC1 and IE ribozymes pptx

12 269 0
  • Loading ...
1/12 trang

Thông tin tài liệu

Ngày đăng: 23/03/2014, 11:20

RNA reprogramming of a-mannosidase mRNA sequencesin vitro by myxomycete group IC1 and IE ribozymesTonje Fiskaa1,*, Eirik W. Lundblad1,2,*, Jørn R. Henriksen1,3, Steinar D. Johansen1and Christer Einvik1,31 Department of Molecular Biotechnology, RNA Research group, Institute of Medical Biology, University of Tromsø, Norway2 Department of Microbiology, University Hospital of North Norway, Tromsø, Norway3 Department of Pediatrics, University Hospital of North Norway, Tromsø, NorwayGroup I ribozymes, which normally perform intronsplicing reactions within the nucleus of many unicellu-lar eukaryotes, can be modified to trans-splice 3¢exons into separate RNA molecules in a sequence-specific reaction. Group I intron trans-splicing isinitiated by the binding of an exogenous guanosine(exoG) into the ribozyme guanosine-binding site. Sub-sequently, base pairing between the internal guidesequence (IGS) at the 5¢ end of the ribozyme and atarget RNA sequence creates a pseudo-P1 structurecontaining the 5¢-splice site, which becomes attackedby the bound exoG. The splicing reaction proceedsthrough two consecutive transesterification steps.When targeting mutated messenger RNAs, trans-spli-cing may lead to chimerical reprogrammed transcriptsof biochemical or therapeutic interest. Despite thefact that more than 2000 group I introns are knownby sequence [1], only a few have been applied inRNA reprogramming approaches. The Tetrahymenaribozyme has been used in almost all reported casesof RNA reprogramming (including RNA repair) [2–7], except for a few studies using the Pneumocystisribozyme [8,9] and the Didymium myxomycete ribo-zyme DiGIR2 [10,11].Keywordsa-mannosidase mRNA; group I intron; RNArepair; RNA reprogramming; trans-splicingCorrespondenceS. D. Johansen, Department of MolecularBiotechnology, RNA Research Group,Institute of Medical Biology, University ofTromsø, N-9037 Tromsø, NorwayFax: +47 776 45350Tel: +47 776 45367E-mail: Steinar.Johansen@fagmed.uit.no*These authors contributed equally to thisstudy(Received 17 March 2006, accepted 27 April2006)doi:10.1111/j.1742-4658.2006.05295.xTrans-splicing group I ribozymes have been introduced in order to mediateRNA reprogramming (including RNA repair) of therapeutically relevantRNA transcripts. Efficient RNA reprogramming depends on the appropri-ate efficiency of the reaction, and several attempts, including optimizationof target recognition and ribozyme catalysis, have been performed. In moststudies, the Tetrahymena group IC1 ribozyme has been applied. Here weinvestigate the potential of group IC1 and group IE intron ribozymes,derived from the myxomycetes Didymium and Fuligo, in addition to theTetrahymena ribozyme, for RNA reprogramming of a mutated a-mannosi-dase mRNA sequence. Randomized internal guide sequences were intro-duced for all four ribozymes and used to select accessible sites withinisolated mutant a-mannosidase mRNA from mammalian COS-7 cells. Twoaccessible sites common to all the group I ribozymes were identified and fur-ther investigated in RNA reprogramming by trans-splicing analyses. All themyxomycete ribozymes performed the trans-splicing reaction with highfidelity, resulting in the conversion of mutated a-mannosidase RNA intowild-type sequence. RNA protection analysis revealed that the myxomyceteribozymes perform trans-splicing at approximately similar efficiencies as theTetrahymena ribozyme. Interestingly, the relative efficiency among theribozymes tested correlates with structural features of the P4–P6-foldingdomain, consistent with the fact that efficient folding is essential for group Iintron trans-splicing.AbbreviationsexoG, exogenous guanosine; IGS, internal guide sequence; RPA, RNA protection analysis.FEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBS 2789RNA reprogramming in cell cultures based on theTetrahymena ribozyme remains inefficient in spite ofsignificant efforts to increase the specificity and effi-ciency [6]. Several attempts to improve the reactionhave been performed, including extending the IGS atthe 5¢ end of the ribozyme to enhance target recogni-tion [4,12,13], adding a P10 helix to promote the sec-ond step of trans-splicing [12] and removing competingside reactions to increase the accuracy [10]. We aim tointroduce new natural group I ribozymes in optimiza-tion and application studies of the trans-splicing reac-tion, and recently reported RNA reprogramming of amutated glycosylasparaginase mRNA sequence by aDidymium myxomycete group IE ribozyme deficient inhydrolysis [10]. Both the specificity and the efficiencyof trans-splicing were improved by extending the IGSand by the removal of unwanted hydrolysis side reac-tions by ribozyme modifications. Here we report themapping of accessible ribozyme target sites in amutant version of a-mannosidase mRNA isolated frommammalian COS-7 cells. A strategy based on random-ized IGS [3,11], using four distinct group I ribozymes,the Didymium group IE ribozyme (named DiGIR2),two Fuligo group IC1 ribozymes (named Fse.L569 andFse.L1898), and the prototype Tetrahymena group IC1ribozyme (Tth.L1925), were used. Two accessible sites,common to all four ribozymes, were identified andincluded in site-directed RNA reprogramming.Results and DiscussionStructural features of the myxomycete group IC1and group IE ribozymesThe intron secondary-structure diagrams presented inFig. 1A show that all four ribozymes included in thisstudy have an overall similar structural organization ofthe catalytic domain (P3–P7–P8). The different myx-omycete ribozymes were selected as a result of theirpronounced in vitro splicing activities and because oftheir distinct structural features [14,15]. WhereasDiGIR2, derived from the twin-ribozyme intronDir.S956-1 in D. iridis [14,16–18] represents the groupIE ribozymes, the two F. septica ribozymes, Fse.L569and Fse.L1898, represent group IC1 ribozymes [15].Finally, the prototype T. thermophila group IC1 ribo-zyme, Tth.L1925, was included as a reference control.A dramatic variation in both sequential and struc-tural features is noted among the folding domains pre-sented in Fig. 1B (P4–P6). This domain varies in sizefrom only 94 nucleotides in DiGIR2 to 681 nucleotidesin Fse.L569, with the intermediate-sized Tth.L1925and Fse.L1898 folding domains (157 nucleotides and198 nucleotides, respectively) in between. The P4–P6domain has an essential role in initiating theRNA-folding process, leading to the functional 3Darchitecture of a group I ribozyme [19–21], and thehigh-resolution structure of the Tetrahymena ribozymedomain [22,23] identified both intradomain (A–bul-ge ⁄ P4 interaction, and L5b–P6 tetraloop receptorinteraction) and interdomain (P14 pseudoknot base-pairing) tertiary interactions. DiGIR2 has a lesscomplex structure without any obvious intradomaininteractions and only one assigned (but apparentlyweak) L9b–P5 interdomain interaction [14], featurestypical of the IE subclass of nuclear group I ribo-zymes. Fse.L569, on the other hand, harbours a groupIC1 folding domain with branched P5 (P5abc) and theA-bulge in P5a. Large extensions are located in P5band P6, as well as in the highly unusual P5d region.The latter region is more than 300 nucleotides longand contains 17 identical copies of a 16-nucleotide tan-dem repeat motif [15]. The repeat has probably noimportant function in splicing as a mutant ribozymewith only seven copies performs the self-splicing reac-tion at similar rates, and cognate self-splicing intronribozymes in Badhamia and Diderma (Bgr.L569 andDni.L569, respectively) lack the repeat (S. D. Johansenet al., unpublished results).Group IC1 and group IE ribozymes select thesame accessible sites in an a-mannosidase mRNAsequenceDeficiency of lysosomal activity of human a-mannosi-dase, an exoglycosidase enzyme involved in theordered degradation of N-linked oligosaccharides,results in the autosomal-recessive lysosomal storagedisorder, a-mannosidosis [24]. The most frequentmutation in a-mannosidase is the R750W substitution,and affected individuals accumulate partially degradedoligosaccharides in the lysosome [25]. No causal treat-ments are currently available for a-mannosidosis, andthere is thus a need for developing alternative genetherapy approaches. Group I ribozyme-based mRNArepair may represent an interesting new approach ingene therapy by reprogramming RNA molecules carry-ing disorder mutations. To investigate whether RNAreprogramming could be applied on human a-mannos-idase mRNA, total RNA isolated from COS-7 cellsexpressing R750W mutant a-mannosidase was mixedwith ribozyme libraries designed to detect accessibletarget sites within the messenger RNA. GN4 ⁄ 5ribo-zyme-tag libraries (see Experimental procedures) wereconstructed for each of the group I ribozymes(Fig. 1A). During incubation at trans-splicing condi-RNA reprogramming of a-mannosidase mRNA sequences T. Fiskaa et al.2790 FEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBStions, a unique 3¢ exon tag (Fig. 1A) was trans-splicedinto various mRNA sequences, based on the accessibil-ity to the ribozymes [11]. The resulting RNA recombi-nants were detected and identified by an RT-PCRapproach, cloned into plasmid and subsequently DNAsequenced. Here, a total number of 19 distinct clones,all representing true trans-splicing events within an 1 kb region of the mRNA, were identified. Thisregion was chosen because it contains sequencesupstream of the R750W substitution (Fig. 1C) and isthus suitable for RNA reprogramming by group Iribozyme trans-splicing. Surprisingly, only three access-ible sites were detected (Fig. 1C). Whereas the Tetra-hymena ribozyme detected all three sites (U1357,U1381, and U1732), the Fuligo and Didymium ribo-zymes detected the same two sites (U1357, U1381).Several interesting findings are noted from this experi-ment, namely that (a) sites U1357 and U1381 appearto be particularly accessible because they were detectedby all four ribozymes, (b) U1357, U1381 and U1732could not be predicted as unambiguous accessibleregions by the mfold computer program (data notshown), stressing the importance of determiningaccessible sites within target RNAs experimentally,(c) no obvious sequence similarities were seen betweenthe selected target sites and the natural 5¢ splice sitesof the ribozymes, indicating that the accessible sitedetection was based on true selection, (d) two of theselected target sites (U1357 and U1732) were identicalin sequence, but the latter was only detected by theTetrahymena ribozyme, and (e) the selected targetsequences GCACCU(1357 ⁄ 1732) and ACGACU1381generate GC-rich P1 pairings, suggesting that increasedstability between ribozyme and target RNA is an addi-tional selective factor [26]. In summary, we found thatgroup IC1 and group IE ribozyme-tag libraries areable to select the same accessible sites within an endog-enously expressed human a-mannosidase mRNA.Increasing the trans-splicing specificity ata-mannosidase RNA sites U1357 and U1381The two accessible a-mannosidase RNA sites (U1357and U1381) were selected for more detailed analysis inRNA reprogramming because they were recognized byall four ribozymes tested. In order to obtain more opti-mal ribozyme targeting, several modifications in the ri-bozyme structures were performed. These include IGSscomplementary to the sequences flanking U1357 andU1381, as well as EGSs,  35 nucleotides in length,complementary to the target RNA sequences 3¢ ofU1357 and U1381 (Fig. 2A). These modifications, alongwith the short P10 base pairing important in the secondstep of trans-splicing, were included to increase the spe-cificity of the reaction according to previously publishedwork on RNA trans-splicing optimizations [4,5,10–12].Furthermore, full-length a-mannosidase mRNAsequences ( 1660 nucleotides), corresponding to theregions 3¢ of U1357 and U1381, were added as trans-splicing 3¢ exons in the ribozyme constructs. It isimportant to note that these 3¢ exons harbour the RNAsequence corresponding to the wild-type arginine resi-due at position 750 (R750), and thus have to be consid-ered as restorative 3¢ exon sequences (Fig. 2B). Finally,to avoid strong intermolecular base pairing between theEGS and the restorative 3¢ exon during the trans-spli-cing reaction [10,11], the corrected (wild-type) a-man-nosidase sequences were degenerated by alternativecodons for the first 16 and 15 triplets following the tar-get sites U1357 and U1381, respectively (Fig. 2A).All eight ribozyme constructs (DiGIR2, Fse.L569,Fse.L1898, and Tth.L1925 targeting both U1357 andU1381) were incubated at trans-splicing conditions (seeExperimental procedures) with in vitro-transcribeda-mannosidase target RNA in a 2 : 1 (ribozyme ⁄ tar-get) molar ratio. In an RT-PCR approach, the trans-ligated exon products were amplified as the expected390 bp and 437 bp products for positions U1357 andU1381, respectively (Fig. 3A). Representative ampli-cons for all eight reactions were DNA sequenced andconfirmed to result from a correct and accurate trans-splicing reaction (Fig. 3B). A minor RT-PCR product,shorter in size than the expected 390 bp, was observedat U1357 for all four ribozyme reactions (Fig. 3A).However, after gel purification and DNA sequencing,this product was found to be a result of oligonucleo-tide mispriming during the RT-PCR reaction. In sum-mary, all four ribozymes were designed to target thetwo most accessible sites in a-mannosidase mRNA.Several modifications that increase the specificity andefficiency of the reaction were included, and all theribozymes were found to perform the trans-splicingreaction in a highly accurate manner.Determination of trans-splicing efficiencies ata-mannosidase RNA sites U1357 and U1381To determine the efficiency of the trans-splicing reac-tions and to compare the different ribozyme con-structs, the same reactions described above wereperformed but analysed by different experimentalapproaches. In the first experiment, unlabelled tran-scripts of each of the eight ribozymes and [35S]CTP-labelled target RNA were mixed (2 : 1 molar ratio),incubated at trans-splicing conditions at various timepoints (0, 5. 15, 30, 60 and 90 min), subjected toT. Fiskaa et al. RNA reprogramming of a-mannosidase mRNA sequencesFEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBS 2791polyacrylamide gel analysis, and finally visualized byautoradiography. A representative time course trans-splicing analysis at U1381 is presented in Fig. 3C.Here, trans-spliced RNA (RNA1) is found to accumu-late. RNA1 from all eight reactions was gel purifiedand DNA sequenced by an RT-PCR approach, whichconfirmed that all the ribozyme transcripts were ableto trans-splice target RNA in vitro in both sites (datanot shown). We note that free 5¢ exons (RNA3), butnot free 3¢ exons, are readily detected in the gelanalysis (see Fig. 3C), an observation explained by thestrong intermolecular base pairings betweenthe exchanged 3¢ exons and EGS. Interestingly, one ofthe ribozymes (Fse.L1898) was apparently more effi-cient in trans-splicing at both sites compared with theother myxomycete ribozymes tested.In the second experiment we performed an RNAprotection analysis (RPA) on the trans-spliced prod-ucts detected above in order to quantify the reactionsand compare the efficiencies among DiGIR2,Fse.L569, Fse.L1898 and the Tetrahymena ribozyme,Tth.L1925. The RPA probes were designed to hybrid-ize to 351 and 385 nucleotides of target RNA 5¢ exonsequences, and 36 and 52 nucleotides of restorative 3¢Fig. 1. Group I ribozymes and mutanta-mannosidase target RNA. (A) Secondarystructure diagrams of trans-splicingribozymes in accessible site selection. Thepaired segments P2–P9 and P13 areindicated. The randomized internal guidesequence regions (IGS; GN5in Tth.L1925and DiGIR2, and GN4in Fse.L569 andFse.L1898) are boxed at the 5¢ end of theribozymes. The DiGIR2 splicing ribozyme isderived from the twin-ribozyme intronDir.S956-1 [16]. The unique TAG sequenceused in RT-PCR detection is indicated at the3¢ end of the ribozymes. (B) Secondarystructure diagrams of P4–P6 foldingdomains of the group I ribozymesTth.L1925, DiGIR2, Fse.L569 andFse.L1898. The DiGIR2 splicing ribozyme isderived from the twin-ribozyme intronDir.S956-1 [16]. Intradomain tertiaryinteractions (A–bulge ⁄ P4 interactions andL5b–P6 tetraloop receptor interactions) areindicated by arrows. The 16-nucleotidedirect-repeat motif present in 17 identicalcopies at P5d in Fse.L569 is boxed. (C)Schematic presentation of the a-mannosi-dase cDNA expressed in COS-7 cells. Theselected accessible sites are indicated asT1357, T1381, and T1732. The gene mutantcorresponding to the R750W substitutionresulting in a-mannosidosis is shown.RNA reprogramming of a-mannosidase mRNA sequences T. Fiskaa et al.2792 FEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBSexon sequences at sites U1357 and U1381, respectively.The protected regions for the trans-spliced RNAs cor-respond to 387 nucleotides and 437 nucleotides. Gelanalysis of RPA products (Fig. 4A) confirmed theabove experiments of in vitro trans-splicing. The relat-ive efficiencies of the trans-splicing reactions were cal-culated in comparison to the Tetrahymena referenceribozyme, and the corresponding values are shown inFig. 4B. Here, the average amounts of trans-splicedRNAs in four parallel experiments performed byFig. 1. (Continued).T. Fiskaa et al. RNA reprogramming of a-mannosidase mRNA sequencesFEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBS 2793Fig. 2. Design of trans-splicing ribozyme constructs targeting specific sites within mutant a-mannosidase RNA sequences. (A) Design oftrans-splicing ribozyme (Rz) constructs targeting a -mannosidase U1357 and U1381. The ribozyme contains an internal guide sequence (IGS)and an extended guide sequence (EGS), which base pair to the complementary sequence in a-mannosidase mRNA upstream of the R750W(C to T at position 2248) mutation. The ribozyme constructs used contain silent mutations (underlined) introduced by alternative codons inthe restorative 3¢ exon. (B) Schematic presentation of the group I ribozyme-mediated trans-splicing reaction resulting in RNA reprogrammingof a-mannosidase mRNA. The trans-splicing ribozyme construct base pairs to mRNA sequences upstream of the mutation (Mut) and cata-lyses the coupled cleavage of mutated mRNA and the ligation of a restorative 3¢ exon containing wild-type sequences.RNA reprogramming of a-mannosidase mRNA sequences T. Fiskaa et al.2794 FEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBSDiGIR2, Fse.L569, and Fse.L1898 are 81%, 79% and104% for U1357, and 39%, 58% and 96% for U1381,respectively. The fact that Fse.L1898 is noted as themost efficient of the myxomycete ribozymes testedcorrelates well with the gel analysis presented inFig. 3C. The efficiency of the trans-splicing ribozymesat both U1357 and U1381 target sites (Fig. 4C)appears to correlate to a putative folding problem ofthe P4–P6 domain, either as a result of the lack ofintradomain stabilization or by misfolding of the com-plex sequence features. Fse.L1898 possesses a P4–P6folding domain similar to that of the Tetrahymanaribozyme (Fig. 1B), both in size, organization, and pre-dicted intra- and interdomain interactions. Consistentwith the above argument, we suggest that RNA fold-ing advantages in the P4–P6 domain make Fse.L1898the most efficient of the myxomycete trans-splicingribozymes tested (Fig. 4C).In summary, our analyses confirmed that all threemyxomycete ribozymes tested perform the trans-spli-cing reaction as accurately as the Tetrahymena ribo-zyme. Furthermore, one of the ribozymes (Fse.L1898)was more efficient in trans-splicing than the othermyxomycete ribozymes tested.Experimental proceduresMapping accessible sites within a-mannosidasemRNAMapping of accessible sites in a-mannosidase mRNA byGN4 ⁄ 5ribozyme-tags was performed as previously des-cribed [3,11]. The IGS, preceding the UG wobble pair inFig. 3. Reprogramming a-mannosidase RNA by group I ribozymetrans-splicing. (A) RT-PCR products from in vitro trans-splicingexperiments with mutant target a-mannosidase RNA and thetrans-splicing ribozymes. The RT-PCR products correspond totrans-spliced RNAs of the expected sizes (390 bp and 437 bp) atpositions U1357 and U1381, respectively. The controls (Ctrl) con-tain first-strand synthesis master mix with Tth.L1925 only, or targetRNA only. (B) Representative results of correct trans-spliced a-man-nosidase mRNA sequences at positions U1357 and U1381 obtainedfrom RT-PCR amplifications. (C) Representative time-course analy-sis of in vitro trans-splicing experiments. a-Mannosidase RNA andtrans-splicing ribozymes targeting U1381 were in vitro transcribedwith and without [35S]CTP labelling, respectively. Trans-splicingribozymes and target RNA were incubated at a 2 : 1 molar ratio, at50 °C for 3 h under splicing conditions. Samples were collected at0, 5, 15, 30, 60 and 90 min. Trans-splicing products were analyzedby PAGE and visualized by autoradiography. The major RNA spe-cies detected were trans-spliced RNA (RNA1), a-mannosidase tar-get RNA (RNA2) and free 5¢ exon target RNA (RNA3). M, RNA sizemarker.T. Fiskaa et al. RNA reprogramming of a-mannosidase mRNA sequencesFEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBS 2795Fig. 4. Ribonuclease protection analyses(RPA) of trans-spliced a-mannosidase RNAsequences. (A) Schematic presentation ofthe RPA experimental approach. See thelegends to Fig. 2B for details. (B) Represen-tative results of the major RNA species(numbered 1–4) detected in RPA. RNA1,undigested probe; RNA2, trans-spliceda-mannosidase mRNA; RNA3, a-mannosi-dase target RNA; RNA4, ribozyme RNA. M,RNA size marker. (C) Quantification of theRPA of trans-spliced a-mannosidase mRNAgenerated by the different trans-splicingribozymes. Comparative quantitative datawere collected from six independent RPAexperiments. The trans-splicing efficiency(percentage) was calculated as previouslydescribed [10], except that values werenormalized in respect to the Tth.L1925ribozyme activity (100%). The raw yieldsof trans-spliced target RNA for theTetrahymena ribozyme were found to varyfrom 3 to 15% and from 2 to 8% for thesites U1357 and U1381, respectively, in sixindependent experiments. However, therelative yields among the four ribozymes aresimilar for each of the experiments.RNA reprogramming of a-mannosidase mRNA sequences T. Fiskaa et al.2796 FEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBSthe P1 helix (see Fig. 1), was used in GN4 ⁄ 5mappinglibraries (n ¼ 4orn ¼ 5; G is the invariant guanosine resi-due engaged in the UG wobble pair). The libraries werePCR amplified using the primer combinations designed foreach ribozyme, including OP757 ⁄ OP483 for Tth.L1925,OP758 ⁄ OP479 for DiGIR2, OP759 ⁄ OP761 for Fse.L569,and OP760 ⁄ OP762 for Fse.L1898 (Table 1). A human lyso-somal a-mannosidase cDNA, cloned into the pcDNA3.1(–)vector (Invitrogen, Oslo, Norway) under the control of thecytomegalovirus (CMV) promoter, was transfected intoCOS-7 cells and total RNA isolated after 24 h by the Trizolreagent (Invitrogen). Total RNA (1 lg) was mixed withlow-salt buffer (40 mm Tris ⁄ HCl pH 7.5, 200 mm KCl,2mm spermidine, 5 mm dithiothreitol, 10 mm MgCl2,0.2 mm GTP) and equilibrated at 50 °C for 10 min. TheGN4 ⁄ 5ribozyme-tag libraries (2 l m) were mixed in low-saltbuffer, added to the total COS-7 RNA and incubated fortrans-splicing at 37 °C for 3 h. The trans-splicing reactionwas reverse transcribed with primer OP299 using Super-script II RNaseH Reverse Transcriptase (Invitrogen) andamplified by PCR using different forward primers (OP764,OP765, or OP766) and a nested reverse primer (OP763).RT-PCR products were subsequently sequenced by the ABIPRISM BigDyeTerminator Cycle Sequencing Ready Reac-tion Kit (Perkin-Elmer, Oslo, Norway) running on an ABIPrism 377 system (Perkin-Elmer).Table 1. Oligonucleotide primer sequences used in this study.Name 5¢-to3¢ sequenceOP299 GCCCGATGCCGACAGCAOP479 GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCCTTTATACCAGCCTCCCTTGGGCAOP483 GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCGAGTACTCCAAAACTAATCAATATOP757 GGGAATTAATACGACTCACTATAGGNNNNNAAAAGTTATCAGGCATGCACCTOP758 GGGAATTAATACGACTCACTATAGGNNNNNGATAGTCAGCATGTACGCTGGCOP759 GGGAATTAATACGACTCACTATAGGNNNNTAAAAGCAACTAGAAATAGCGTOP760 GGGAATTAATACGACTCACTATAGGNNNNAGGGGACCTTGCAAGTCCCCTAOP761 GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCGGTATGCGCTTAGCCTTAGACOP762 GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCCTTTGTACCGACCTCCGCCAAOP763 CAGCAGAATGGTTTCACGOP764 CAGAAGCTCATCCGGCTGOP765 AGCATCACGACGCCGTCAOP766 GCTGTTCTCAGCCTCACTOP816 TCCGGCTGGTAAATGCGCOP887 AATTGCGGCCGCAGAACCTCGCAAGGCCCCCAGCCTGCCGCAAGCTGCTAGCGCGTGCACGTCGACGAATTCAATTOP888 AATTGAATTCGTCGACGTGCACGCGCTAGCAGCTTGCGGCAGGCTGGGGGCCTTGCGAGGTTCTGCGGCCGCAATTOP889 GACGCACGTCAATTGGCCGCTGGATGGGGCCCCTGTGAAGTGTTGCTGAGCAACGCGCTGGCGCGOP890 GGGGGGATCCCTAACCATCCACCTCCTTCCOP891 GGGGTCTAGAGCGTGGTCGTAAAAGTTATCAGGCATGCACOP892 GGGGGACGTGCGTCGAGTACTCCAAAACTAATCOP893 GGGGGCTAGCGCGTGGTCGTGATAGTCAGCATGTACGCTGOP894 GTGCGTCCTTTATACCAGCCTCCCTTOP895 GGGGGCTAGCGCGTGGTCGTAAAAGCAACTAGAAATAGCOP896 GGGGGACGTGCGTCGGTATGCGCTTAGCCTTAGOP897 GGGGGCTAGCGCGTGGTCGAGGGGACCTTGCAAGTCCCCOP898 GGGGGACGTGCGTCCTTTGTACCGACCTCCGCCOP931 AATTGCGGCCGCCCGCAAGCTGGCGCGCGTAGTCGTTGGCCACGTCTAGACGGGGCACGTCGACGAAATCAATTOP932 AATTGAATTCGTCGACGTGCCCCGTCTAGACGTGGCCAACGACTACGCGCGCCAGCTTGCGGGCGGCCGCAATTOP933 GACGCACGTCGCAAATGATTATGCCAGGCAATTGGCCGCCGGGTGGGGGCCTTGCGAGGTTCTTCTOP934 GGGGTCTAGACGGGGGGTGCAAAAGTTATCAGGCATGCACOP935 GGGGGACGTGTTGCCGGGCGAGTACTCCAAAACTAATCOP936 GGGGTCTAGACGGGGGGTGCGATAGTCAGCATGTACGCTGOP937 GTGTTGCCGGGCCTTTATACCAGCCTCCCTTOP938 GGGGTCTAGACGGGGGGTGTAAAAGCAACTAGAAATAGCOP939 GGGGGACGTGTTGCCGGGCGGTATGCGCTTAGCCTTAGOP940 GGGGTCTAGACGGGGGGTGAGGGGACCTTGCAAGTCCCCOP941 GGGGGACGTGTTGCCGGGCCTTTGTACCGACCTCCGCCOP948 TTGCTCAGCAACACTTCAOP1079 CCAATTGCCTGGCATAATCAMph-306R GGGTCTGAAGATGTAGGCACCT. Fiskaa et al. RNA reprogramming of a-mannosidase mRNA sequencesFEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBS 2797Plasmid constructionsAll plasmids were constructed using standard methods [27].The trans-splicing ribozyme constructs targeting U1357 andU1381 in a-mannosidase mRNA (numbered according toGenBank U60266 starting at the translation initiationcodon) were made in several steps. First, the pcDNA3.1(–)vector was digested with NheI and XbaI, and gel purifiedby the QIAquick Gel Extraction Kit (Qiagen GmbH,Hilden, Germany) generating pcDNA3.1-D. The EGSregions were constructed by hybridization of two comple-mentary oligonucleotide primers (primer combinationsOP931 ⁄ OP932 and OP887 ⁄ OP888 for U1357 and U1381,respectively). The annealed primers were digested with NotIand EcoRI and inserted into the corresponding sites in thepcDNA3.1-D vector, generating pAS1357 and pAS1381.Wild type a-mannosidase 3¢-exon sequences, followingU1357 and U1381, were PCR amplified with primers carry-ing the restriction enzyme sites BmgBI and BamHI (primercombinations OP933 ⁄ OP890 and OP889 ⁄ OP890 for U1357and U1381, respectively). The forward primers were used togenerate alternative codons for the first 16 and 15 tripletsfollowing the target sites U1357 and U1381, respectively.The corresponding PCR products were digested withBmgBI and BamHI and inserted between the BmgBI sitesgenerated by the insertion of EGS regions and the BamHIsites in the multiple cloning sites of the vectors, resulting inpAS1357a and pAS1381a. Ribozymes were amplified andinserted into pAS1357⁄ 1381a between the XbaIorNheI(for U1357 and U1381) site and the BmgBI site. The primercombinations used at U1357 were OP934 ⁄ OP935 forTth.L1925, OP936 ⁄ OP937 for DiGIR2, OP938 ⁄ OP939 forFse.L569, and OP940 ⁄ OP941 for Fse.L1898. The primercombinations used at U1381 were OP891 ⁄ OP892 forTth.L1925, OP893 ⁄ OP894 for DiGIR2, OP895 ⁄ OP896 forFse.L569, and OP897 ⁄ OP898 for Fse.L1898. The PCRproducts were then digested with XbaI and BmgBI andligated into the corresponding vector sites, generating trans-splicing ribozyme constructs targeting U1357 and U1381 ina-mannosidase mRNA. All plasmid constructions were con-firmed by automatic DNA sequence analysis. Oligonucleo-tide primer sequences are listed in Table 1. The in vitrotranscription plasmid, pMannRNAa , was generated byamplifying a 1 kb region within the a-mannosidase cDNAby using OP764 and mph306R, and subsequently the PCRproduct was ligated downstream of the T7 promoter in thepGEM-T easy vector (Promega, Madison, WI, USA).pMannRNAa contains the T1357 and T1381 target posi-tions used in this study.In vitro RNA trans-splicing and time-courseanalysisPrecursor RNAs were transcribed from T7 promoters offlinearized ribozyme plasmids. [35S]CTP[aS] (10 lCiÆlL)1;Amersham Pharmacia Biotech, Piscataway, NJ, USA) wasuniformly incorporated into the RNA transcripts. Tran-scripts were purified by phenol extraction and ethanol pre-cipitation, and dissolved in diethyl pyrocarbonate-treatedwater. Alternatively, the trans-splicing ribozyme constructswere linearized and transcribed as described above, butwithout [35S]CTP labelling. Trans-splicing ribozymes wereincubated at a 2 : 1 or a 5 : 1 molar ratio, with labelleda-mannosidase target RNA, at 50 ° C for 3 h under splicingconditions (40 mm Tris ⁄ HCl pH 7.5, 200 mm KCl, 2 mmspermidine, 5 mm dithiothreitol, 10 mm MgCl2, 0.2 mmGTP). As both molar ratio reactions for all four ribozymesworked equally well, the lowest molar ration (2 : 1) wasselected for use in further analyses. Samples were collectedat 0, 5, 15, 30, 60 and 90 min, and the reaction was termin-ated by the addition of an equal volume of STOP-solution(95% formamide, 50 mm EDTA, 0,02% xylene cyanol,0.05% Bromophenol Blue). Reactions were denatured for2 min at 88 °C and separated on 7 m urea ⁄ 5% polyacryla-mide gels, followed by autoradiography. The PAGE-puri-fied RNAs [28], corresponding to the correct trans-splicedtranscripts, were confirmed by RT-PCR and sequencinganalysis using the primers OP1079 (for U1357) or OP948(for U1381) for first-strand cDNA synthesis. The trans-spli-cing junctions were amplified by primer setsOP816 ⁄ OP1079 and OP816 ⁄ OP948 for U1357 and U1381,respectively.Trans-splicing and RPAThe trans-splicing ribozyme RNAs were treated with TurboDNase (Ambion, Huntingdon, UK), according to themanufacturer’s instructions, phenol ⁄ chloroform extracted,ethanol precipitated and dissolved in diethyl pyrocarbo-nate-treated water. Unlabeled trans-splicing ribozymes andPAGE-purified a-mannosidase RNA were mixed at a 5 : 1molar ratio under splicing conditions (40 mm Tris ⁄ HClpH 7.5, 200 mm KCl, 2 mm spermidine, 5 mm dithiothrei-tol, 10 mm MgCl2, 0.2 mm GTP) and incubated at 50 °Cfor 3 h. RPA was performed on 5 l Loftrans-splicingRNA mix by using the RNase protection kit (RocheApplied Science, Penzberg, Germany), according to themanufacturer’s instructions. The RPA probes were gener-ated from the RT-PCR products of in vitro trans-spliceda-mannosidase RNA at positions U1357 and U1381 (seeabove) cloned into the pGEM-T easy vector (Promega).These plasmids were linearized and transcribed, thenlabelled with [35S]CTP, as described above, to obtain RPAprobes of larger sizes than probe fragments protected bytrans-spliced RNAs in analysis by RPA. RPA samples wereseparated on 7 m urea ⁄ 5% polyacrylamide gels, followedby autoradiography and phosphoimager quantification(Fuji BAS 5000 system; image gauge 4.0 software). Thecytosine contents in the parts of the RPA probes protectedby the differently sized RNAs were calculated and includedRNA reprogramming of a-mannosidase mRNA sequences T. Fiskaa et al.2798 FEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBS[...]... 44, 7796–7804 RNA reprogramming of a-mannosidase mRNA sequences 9 Baum DA & Testa SM (2005) In vivo excision of a single targeted nucleotide from an mRNA by a transexcision-splicing ribozyme RNA 11, 897–905 10 Lundblad EW, Haugen P & Johansen S (2004) Transsplicing of a mutated glycosylasparaginase mRNA sequence by a group I ribozyme deficient in hydrolysis Eur J Biochem 271, 4932–4938 11 Einvik C, Fiskaa... Sullenger BA (1998) Ribozyme-mediated repair of sickle betaglobin mRNAs in erythrocyte precursors Science 280, 1593–1596 4 Byun J, Lan N, Long M & Sullenger BA (2003) Efficient and specific repair of sickle beta-globin RNA by trans-splicing ribozymes RNA 9, 1254–1263 5 Watanabe T & Sullenger BA (2000) Induction of wildtype p53 activity in human cancer cells by ribozymes that repair mutant p53 transcripts... basis of the enhanced stability of a mutant ribozyme domain and a detailed view of RNA solvent interactions Structure 9, 221–234 FEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBS 2799 RNA reprogramming of a-mannosidase mRNA sequences 24 Sun H & Wolfe JH (2001) Recent progress in lysosomal a-mannosidase and its deficiency Exp Mol Med 33, 1–7 25 Berg T, Riise HM, Hansen... the intensities of differently sized bands comparable The amount of reprogrammed product (RNA2 in Fig 4) was calculated as a fraction (in percentage) of trans-spliced product (RNA2 ) + target a-mannosidase RNA (RNA3 ) + trans-splicing ribozyme (RNA4 ) The amount of reprogrammed product generated by the Tth.L1925 ribozyme was set to 100% to obtain comparable results from the experiments performed in parallel... HEG-containing group I intron in ribosomal DNA Nucleic Acids Res 33, 2042–2051 19 Woodson SA (2002) Folding mechanisms of group I ribozymes: role of stability and contact order Biochem Soc Trans 30, 1166–1169 20 Woodson SA (2005) Structure and assembly of group I introns Curr Opin Chem Biol 9, 1211–1223 21 Takamoto K, Das R, He Q, Doniach S, Brenowitz M, Herschlag D & Chance MR (2004) Principles of RNA. .. repair of a mutant chloride channel using a trans-splicing ribozyme J Clin Invest 110, 1783– 1789 7 Ryu KJ, Kim JH & Lee SW (2003) Ribozyme-mediated selective induction of new gene activity in hepatitis C virus internal ribosome entry site-expressing cells by targeted trans-splicing Mol Ther 7, 386–395 8 Alexander RC, Baum DA & Testa SM (2005) 5¢-transcript replacement in vitro catalyzed by a group I intron-derived... 30, e141 ˚ 14 Haugen P, Andreassen M, Birgisdottir AB & Johansen S (2004) Hydrolytic cleavage by a group I intron ribozyme is dependent on RNA structures not important for splicing Eur J Biochem 271, 1015–1024 15 Lundblad EW, Einvik C, Rønning S, Haugli K & Johansen S (2004) Twelve group I introns in the same prerRNA transcript of the myxomycete Fuligo septica: RNA processing and evolution Mol Biol... Einvik C, Johansen S & Vogt VM (1995) Two group I ribozymes with different functions in a nuclear rDNA intron EMBO J 14, 4558–4568 ˚ 17 Nielsen H, Fiskaa T, Birgisdottir AB, Haugen P, Einvik C & Johansen S (2003) The ability to form full-length intron RNA circles is a general property of nuclear group I introns RNA 9, 1464–1475 18 Birgisdottir AB & Johansen S (2005) Site-specific reverse splicing of. .. compaction: insights from the equilibrium folding pathway of the P4–P6 RNA domain in monovalent cations J Mol Biol 343, 1195–1206 22 Cate JH, Gooding AR, Podell E, Zhou K, Golden BL, Szewczak AA, Kundrot CE, Cech TR & Doudna JA (1996) RNA tertiary structure mediation by adenosine platforms Science 273, 1696–1699 23 Juneau K, Podell E, Harrington DJ & Cech TR (2001) Structural basis of the enhanced stability of. .. Johansen S (2004) Optimization and application of the group I ribozyme trans-splicing reaction Methods Mol Biol 252, 359–372 12 Kohler U, Ayre BG, Goodman HM & Haseloff J (1999) Trans-splicing ribozymes for targeted gene delivery J Mol Biol 285, 1935–1950 13 Ayre BG, Kohler U, Turgeon R & Haseloff J (2002) Optimization of trans-splicing ribozyme efficiency and specificity by in vivo genetic selection Nucleic . RNA reprogramming of a-mannosidase mRNA sequences in vitro by myxomycete group IC1 and IE ribozymes Tonje Fiskaa1,*, Eirik. (RNA1 ), a-mannosidase tar-get RNA (RNA2 ) and free 5¢ exon target RNA (RNA3 ). M, RNA sizemarker.T. Fiskaa et al. RNA reprogramming of a-mannosidase mRNA sequences FEBS
- Xem thêm -

Xem thêm: Báo cáo khoa học: RNA reprogramming of a-mannosidase mRNA sequences in vitro by myxomycete group IC1 and IE ribozymes pptx, Báo cáo khoa học: RNA reprogramming of a-mannosidase mRNA sequences in vitro by myxomycete group IC1 and IE ribozymes pptx, Báo cáo khoa học: RNA reprogramming of a-mannosidase mRNA sequences in vitro by myxomycete group IC1 and IE ribozymes pptx

Tài liệu mới đăng

Gợi ý tài liệu liên quan cho bạn