Novel b-1,3-, 1,6-oligoglucan elicitor from Alternaria alternata 102 for defense responses in tobacco ´ Tomonori Shinya1,2, Rozenn Menard3, Ikuko Kozone1, Hideaki Matsuoka1, Naoto Shibuya4, Serge Kauffmann3, Ken Matsuoka2 and Mikako Saito1 Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, Koganei, Japan RIKEN Plant Science Center, Yokohama, Japan ´ ´ Institut de Biologie Moleculaire des Plantes du Centre National de la Recherche Scientifique, Universite Louis Pasteur, Strasbourg, France Department of Life Sciences, Faculty of Agriculture, Meiji University, Kawasaki, Japan Keywords Alternaria alternata; BY-2 cells; chitinase; elicitor; b-1,3-, 1,6-glucan Correspondence M Saito, Department of Biotechnology and Life Science, Faculty of Technology, Tokyo University of Agriculture and Technology, Koganei, Tokyo 184–8588, Japan Fax: +81 42 387 1503 Tel.: +81 42 388 7400 E-mail: mikako@cc.tuat.ac.jp (Received 13 January 2006, revised 23 March 2006, accepted 28 March 2006) doi:10.1111/j.1742-4658.2006.05249.x A novel elicitor that induces chitinases in tobacco BY-2 cells was isolated from Alternaria alternata 102 Six other fungi, including A alternata IFO 6587, could not induce, or weakly induce chitinase activity The purified elicitor was soluble in 75% methanol and showed the chitinase-inducing activity when applied at concentrations of as low as 25 ngỈmL)1 Structural determination by methylation analysis, reducing-end analysis, MALDITOF ⁄MS, and NMR spectroscopy indicated that the elicitor was a mixture of b-1,3-, 1,6-oligoglucans mostly with a degree of polymerization of between and 17 Periodate oxidation of the elicitor suggested that the 1,6-linked and nonreducing terminal residues are essential for the elicitor activity Further analysis of the elicitor responses in BY-2 cells indicated that the activity of this b-1,3-, 1,6-glucan elicitor was about 1000 times more potent than that of laminarin, which is a known elicitor of defense responses in tobacco Analyzing the expression of defense-related genes indicated that a phenylalanine ammonia-lyase gene and a coumaroyl-CoA O-methyltransferase gene were transiently expressed by this b-1,3-, 1,6-glucan elicitor The elicitor induced a weak oxidative burst but did not induce cell death in the BY-2 cells In the tissue of tobacco plants, this b-1,3-, 1,6-glucan elicitor induced the expression of basic PR-3 genes, the phenylpropanoid pathway genes, and the sesquiterpenoid pathway genes In comparison with laminarin and laminarin sulfate, which are reported to be potent elicitors of defense responses in tobacco, the expression pattern of genes induced by the purified b-1,3-, 1,6-glucan elicitor was more similar to that induced by laminarin than to that induced by laminarin sulfate In plant–microbe interactions, pathogenic microorganisms produce elicitors that trigger the induction of defense responses in plants The major defense responses induced by these elicitors involve the production of antimicrobial enzymes, cell-wall fortification, production of reactive oxygen, and programmed cell death Typical pathogen-derived elicitors derived by a wide range of microbes or pathogen groups involve oligosaccharides [1–3] and peptides [4–6] Many of the elicitors so far characterized serve as general or nonhost elicitors inducing defense responses in a wide range of plant cells Recently, it has emerged that many of these Abbreviations CCoAOMT, coumaroyl-CoA O-methyltransferase; CL, chemiluminescence; DP, degree of polymerization; HMGR, 3-hydroxy-3-methylglutarylCoA reductase; HPAEC-PAD, high-performance anion-exchange chromatography with pulsed amperometric detection; MeJA, methyl jasmonate; MeOH, methanol; OMT, O-methyltransferase; PAL, phenylalanine ammonia-lyase; PR protein, pathogenesis-related protein; SA, salicylic acid; STC, sesquiterpene cyclase; TBC, tobacco BY-2 chitinase FEBS Journal 273 (2006) 2421–2431 ª 2006 The Authors Journal compilation ª 2006 FEBS 2421 Novel b-glucan elicitor from A alternata 102 T Shinya et al elicitors are derived from molecular sequences conserved among various microorganisms, which are known as pathogen-associated molecular patterns (PAMPs) [4,6,7] These PAMPs are thought to be recognized by pattern-recognition receptors in plants and to trigger the expression of defense responses in the plant cells On the other hand, so-called gene-forgene resistance, which is governed by the presence of corresponding resistance (R) and avirulence (avr) genes in the plant and the pathogen, confers much more specific recognition [7–10] Glucans are among the best studied oligosaccharide elicitors Active glucans can derive from fungal pathogen as well as from algal cell walls Laminarin is an algal b-1,3-glucan with b-1,6 glucose branches, triggers defense responses in a noncultivar-specific manner in many plants including tobacco The best known glucan elicitor is a heptaglucoside, which is a penta b-1,6 glucose backbone and two b-1,3 glucose side chains, was isolated from Phytophthora megasperma cell walls It elicits defense responses in soybean but not in tobacco or rice cells [11–13] A b-1,6 b-1,3 glucan (b-1,3 backbone with a b-1,6 side chain) isolate from Pyricularia oryzae induces phytoalexin production in rice but not in soybean [12] Linear glucans are active in tobacco [11], but not in rice [12], or soybean [13] These observations allowed us to form the hypothesis that different plants have developed the ability to react to structurally different, but related, b-glucans During the course of a search for a potent elicitor of defense responses in a model plant cell (tobacco BY-2 cells), we found that the fungal strain Alternaria alternata 102 produces a substance that induces chitinase activity when applied to BY-2 cells, whereas cell wall extracts from six other fungi, including A alternata IFO 6587, remained almost inactive [14] From these findings, we suspected the existence of a specific elicitor produced by A alternata 102 and active in tobacco BY-2 cells In this paper, we describe the isolation and characterization of this elicitor, which is a novel b-1,3-, 1,6-glucan acting as a potent elicitor of defense responses in tobacco BY-2 cells We also discuss responses triggered by this elicitor in comparison with responses triggered by other elicitors Results Purification of the elicitor-active component isolated from A alternata 102 Our previous work has indicated that the filtrate obtained from autoclaved A alternata 102 culture was able to induce marked chitinase activity in tobacco 2422 A alternata102 culture medium Autoclaving Filtration Lyophilization MeOH extraction 75% MeOH extraction Treatment with trichloroacetic acid Dialysis ODS chromatography 0% MeOH 25% MeOH 50% MeOH 100% MeOH ODS HPLC Gel filtration HPLC Fig Purification scheme of elicitor-active fraction form A alternata 102 culture medium BY-2 cells without inducing cytotoxic effect [14] We hypothesized that the active component was different from peptide-like substances, which are known to be produced by A alternata 102 and displaying cytotoxicity against tobacco BY-2 cells [15] Preliminary experiments indicated that the elicitor-active fraction could not be extracted with organic solvents, such as methanol, ethanol, n-butanol, ethyl acetate, and n-hexane The elicitor activity was stable after heat treatment at 50 °C and also after freezed at )30 °C for days The elicitor activity was also not affected by treatment with proteases such as trypsin and proteinase K The molecular weight of the elicitor-active component was estimated to be larger than 4000 by gel filtration chromatography These results suggested that the elicitor-active component could be a polysaccharide The purification scheme is shown in Fig The elicitor-active compound was extracted with 75% methanol from methanol-washed lyophilized powder of the autoclaved extract of the fungal culture The extracted elicitor was recovered by precipitation with trichloroacetic acid, then the supernatant was separated by reversed phase chromatography (Fig 2A), and gel filtration chromatography (Fig 2B) After the separation by reversed phase column chromatography, the elicitor-active fraction was shown to be composed mainly of carbohydrates (Fig 2B) We obtained 2.6 mg of purified FEBS Journal 273 (2006) 2421–2431 ª 2006 The Authors Journal compilation ª 2006 FEBS Novel b-glucan elicitor from A alternata 102 ) T Shinya et al 15 30 Retention time (min) 45 50 25 0.5 0.5 10 Retention time (min) 50 100 150 200 (ng/ml) TBC-1 TBC-2 TBC-3 100 20 75 50 25 Relative intensity (RI, 1.0 Relative sugar content ( ) 1.0 25 ) 0.5 ) B Elicitor activity ( 1.0 ) 75 12.5 M e t n ol ( % , 0.5 0.5 100 R e l at i v e i n ten s i ty ( 00 n m, 1.0 1.0 Relative sugar content ( Elicitor activity ( ) ) A Fig Purification of elicitor-active fraction by HPLC on an ODS column (A) and by gel filtration HPLC (B) Relative elicitor activity was determined by the induction of TBC-1 Relative sugar content was measured by the phenol–sulfuric acid procedure elicitor from 10.2 L of A alternata 102 culture The recovery of the elicitor activity was 28% from the starting material, the methanol-insoluble fraction The specific activity of the purified elicitor was increased 1200 times compared to the starting material Figure shows the dose dependent response analyzing the chitinase induction by the purified elicitor Chitinase activity was induced when applying an elicitor dose as low as 25 ngỈmL)1 Structural analysis of the A alternata elicitor The purified elicitor contained about 97% carbohydrate and consisted almost solely of glucose (data not Fig Dose dependency of TBC-1 induction by the purified elicitor Chitinase activity was measured h after treatment with the respective samples The induction of TBC-1 with distilled water was used as a control Protein extracts (100 lg per lane) from elicitor- and water-treated BY-2 cells were separated by native PAGE, and the chitinase activities were measured by the activity staining method using Calcofluor White shown) Methylation analysis of the elicitor indicated the presence of terminal, 3-linked, 6-linked, and 3,6linked glucosyl residues (Table 1) The molar ratios of terminal, 3-linked, 6-linked, and 3,6-linked glucosyl residues were : : : These results indicated that the elicitor is a branched 1,3-, 1,6-linked glucan The elicitor was thus called AaGlucan To investigate whether the AaGlucan has a reducing-end, in other words, to examine the possibility of a cyclic glucan, the AaGlucan was reduced with sodium borohydride and then hydrolyzed (Fig 4) Sorbitol was recovered from the hydrolysis of the AaGlucan As a control, we applied the same procedure to a cyclic b-1,2-glucan from Agrobacterium radiobacter IFO 12664 [16], and no sorbitol was produced, thus excluding the possibility of a cyclic structure for the AaGlucan These results also indicated that the AaGlucan has a reducing-end glucose We used 1H- and 13C-NMR spectrometry to identify the anomeric configuration of the glucose residue In the anomeric region of the 1H-NMR spectrum, a signal was found at 4.4 p.p.m with a coupling constant J1,2 ¼ 8.5 13C-NMR analysis of the elicitor showed a C1 resonance at 103 p.p.m These results indicate that Table Methylation analysis of AaGlucan, the purified glucan elicitor Laminarin was also methylated and used to identify partially methylated alditol acetates Retention time (min) Major mass fragments (m ⁄z) Position of O-methyl groups Glucosyl residue Composition 9.85 10.49 10.69 11.31 205,161,117 233,161,117 233,161,189,117 189,117 2,3,4,6 2,4,6 2,3,4 2,4 Terminal-Glc 3-linked-Glc 6-linked-Glc 3,6-linked-Glc 0.97 1.94 1.16 1.00 FEBS Journal 273 (2006) 2421–2431 ª 2006 The Authors Journal compilation ª 2006 FEBS 2423 Novel b-glucan elicitor from A alternata 102 methylation analysis and the reducing-sugar assay, suggested that the AaGlucan is a mixture of branched, noncyclic, b-1,3-, 1,6-glucan oligosaccharides with DP between and 17 B Glucose Detector Response Effects of laminarinase treatment and periodate oxidation on the elicitor activity of the AaGlucan 10 15 20 Time (min) 25 10 15 20 Time (min) 25 W a te TBC-1 1000 Co ntr o l 2799 [GDP=17+Na]+ 2474 [GDP=15+Na]+ B 2636 [GDP=16+Na]+ 1987 [GDP=12+Na]+ 1825 [GDP=11+Na]+ 1500 [GDP=9+Na]+ 20 2149 [GDP=13+Na]+ 2312 [GDP=14+Na]+ 40 1338 [GDP=8+Na]+ % In ten sity 80 1663 [GDP=10+Na]+ 100 60 A r Fig Analysis of reducing-end sugar Hydrolysate of the reduced purified-glucan elicitor (AaGlucan) was analyzed by HPAEC-PAD (A) As a control, the cyclic b-1,2-glucan from Agrobacterium radiobacter was analyzed under the same conditions (B) Glucose and sorbitol were identified by comparing the retention times with those of authentic samples 2000 3000 Mass (m/z) 4000 TBC-1 Fig MALDI-TOF mass spectra of the purified glucan elicitor The m ⁄z-values are shown as the nominal masses of the pseudomolecular ions [M + Na]+ all glucose residues in the elicitor have a b configuration The molecular mass of the b-1,3, 1,6-glucan elicitor was determined by MALDI-TOF ⁄MS We detected a series of molecular ions with masses corresponding to the masses of reducing oligosaccharides consisting of hexose units within the experimental error (Fig 5) These results in combination with the results of the 2424 Gl uca n Aa Gl uca n( pe La rio mi da na te rin ox ida La tio mi n) na rin (pe rio da te ox ida tio n) Aa Gl uca n+ La mi na rin ase Sorbitol Aa Sorbitol To investigate which structure of the AaGlucan was responsible for eliciting the defense responses in the BY-2 cells, the AaGlucan was treated with laminarinase, which hydrolyzes the b-1,3-linkages, or with periodate Laminarinase dramatically decreased the elicitor activity, providing further evidence that the elicitor activity is carried by a polysaccharidic molecule with b-1,3-linkages (Fig 6A) Periodate oxidation of Aa Detector Response Glucose Gl uc an A T Shinya et al Fig Effects of laminarinase treatment and periodate oxidation on the induction of chitinase by AaGlucan (A) Effect of laminarinase treatment on the elicitor activity of AaGlucan (100 ngỈmL)1 final concentration) Lane 1: Negative control without the enzyme or AaGlucan Lane 2: AaGlucan without laminarinase treatment Lane 3: Laminarinase-treated AaGlucan (B) Effect of periodate oxidation on the elicitor activities of AaGlucan (100 ngỈmL)1 final concentration) and laminarin (100 lgỈmL)1 final concentration) Water without glucan was treated under the same conditions and used as a control The induction of TBC-1 was measured h after the addition of the elicitor Protein extracts (100 lg per lane) from the elicitor- and water-treated BY-2 cells were separated by native PAGE, and the chitinase activities were measured by the activity staining method FEBS Journal 273 (2006) 2421–2431 ª 2006 The Authors Journal compilation ª 2006 FEBS T Shinya et al Novel b-glucan elicitor from A alternata 102 A PI-stained cells (%) the AaGlucan and of laminarin dramatically decreased their elicitor activities (Fig 6B) Periodate oxidizes the 1,6-linked and the nonreducing terminal residues but not the 1,3-linked glucose residues Thus, the results of both the laminarinase and periodate treatments indicate that the b-1,3-linked and the periodate-sensitive residues are essential for the chitinase inducing activity of AaGlucan 100 80 60 40 20 er at W W a te r Aa Gl uc an La ( 50 mi ng na /m rin La l) mi (50 na µg rip N/m e Ac l ety ntaos ) lch e( Gl 50 it yco µg l c h oo c t a /m os e Fil itin l) tr a (50 ( 50 te µg µg of /m /m A.a l) l) lter na ta cu lt u re (1 m g/m l) TBC-1 Fig Comparison of elicitor activities of several poly and oligosaccharides in BY-2 cells The induction of TBC-1 was measured h after the elicitor treatment Protein extracts (100 lg per lane) from the elicitor-treated BY-2 cells were separated by native PAGE, and chitinase activities were measured by the activity staining method B ∆ROS amount ( ROS(Elicitor)-ROS(Control)) H2O2 (nM) The chitinase inducing activity of the AaGlucan was first compared with that of other polysaccharidic elicitor fractions (Fig 7) Laminaripentaose, N-acetylchitooctaose and glycolchitin remained inactive Laminarin and the AaGlucan triggered a similar level of chitinase activity However, laminarin was applied at a concentration that was 1000 times that of the AaGlucan, indicating that the AaGlucan has a much higher activity to induce TBC-1 activity in BY-2 cells We then investigated whether the AaGlucan would induce cell death measured using propidium iodide assay Less than 3% of the BY-2 cells were stained with propidium iodide 48 h after treatment with AaGlucan, a value that is comparable to the 3% for a control experiment without the elicitor (Fig 8A) As negative and positive controls, we used laminarin and benzyladenine, respectively It is reported previously that laminarin does not induce cell death of tobacco BY-2 cells [11], whereas benzyladenine is cytotoxic to A aG lu ca n La m in ar in Be nz yl ad en in e Cellular responses induced by the AaGlucan elicitor 40 30 20 10 -10 Incubation time (h) 10 Fig Evaluation of oxidative burst and cell death induced by AaGlucan (A) Cell viability was measured using PI (propidium iodide) 48 h after treatment with AaGlucan (200 ngỈmL)1), laminarin (200 lgỈmL)1), or benzyladenine (150 lM) Values are the means ± standard deviation from to independent experiments (B) AaGlucan-induced oxidative burst was determined by luminol assay Untreated cells were used as a control d, 50 lgỈmL)1 AaGlucan; m, 100 lgỈmL)1 AaGlucan; n, 200 lgỈmL)1 AaGlucan ROS accumulation in the medium was measured by the same method as described in Experimental procedures and expressed as the corresponding amount of H2O2 Means ± standard deviation from three independent measurements are shown the same cells [17] As expected, laminarin application did not induce cell death, whereas a treatment with benzyladenine resulted in staining of 76% of the BY-2 cells These results indicate that the AaGlucan does not induce cell death in the BY-2 cells under the conditions employed The production of reactive oxygen intermediates through an oxidative burst is a hallmark of plant defense responses A transient and dose-dependent induction of an oxidative burst was detected in BY-2 cells treated with the AaGlucan (Fig 8B) As the AaGlucan induces the expression of tobacco BY-2 chitinase (TBC)-1 in the BY-2 cells, we further investigated whether other defense-related genes would FEBS Journal 273 (2006) 2421–2431 ª 2006 The Authors Journal compilation ª 2006 FEBS 2425 Novel b-glucan elicitor from A alternata 102 A Control 12 T Shinya et al AaGlucan 12 (h) α EF1α acidic PR3 basic PR3 PAL CCoAOMT OMT HMGR an STC lu c aG Discussion A PS La m Bu ffe r B EF1α acidic PR3 basic PR3 PAL CCoAOMT OMT HMGR STC Fig Gene expression induced by AaGlucan in BY-2 cells and tobacco leaves (A) BY-2 cells were treated with AaGlucan at 200 ngỈmL)1 Total RNA was extracted 0, 3, and 12 h after the treatments and used for semiquantitative PCR (B) Leaves of tobacco plants were infiltrated with laminarin (Lam) at 200 lgỈmL)1, laminarin sulfate (PS3) at 200 lgỈmL)1, or AaGlucan at 30 lgỈmL)1 Total RNA was extracted 24 h after the treatments and analyzed by semiquantitative PCR be expressed in response to the AaGlucan in both BY2 cell line and intact tobacco plant Expression of defense-related genes was monitored by semiquantitative RT-PCR We analyzed the expression of known defense-related genes, which are typical of three different defense pathways: acidic and basic PR3 encoding chitinase enzymes of the PR protein family, PAL and CCoAOMT from the phenylpropanoid pathway, and STC and HMGR from the sesquiterpenoid pathway (Fig 9) In AaGlucan-treated BY-2 cells (Fig 9A), PAL and CCoAOMT genes were transiently induced, 2426 and the STC gene remained expressed during the course of the experiment compared to the control No induction of the PR3 genes was observed For the analysis of the AaGlucan eliciting activity in tobacco plants, we included treatments with laminarin and sulphated laminarin (Fig 9B) Expression of the basic PR3, PAL, CCoAOMT, OMT, HMGR and STC genes was induced upon treatment with the AaGlucan as well as with laminarin and sulphated laminarin, the latter being the most efficient Of note, as for laminarin, the AaGlucan did not induce the expression of the acidic PR3 as well as of the acidic PR1 and PR2 (data not shown), while sulphated laminarin did, as expected [18] These results indicated that AaGlucan was active in tobacco tissue and that the responses of defenserelated genes toward AaGlucan were more similar to the responses toward laminarin than toward PS3 In previous papers, we reported that the filtrate of autoclaved A alternata 102 culture could induce multiple defense responses, such as increases in chitinase activity and glucanase activity, in tobacco BY-2 cells [14,19,20] The filtrate from A alternata 102 showed the highest activity among the preparations obtained from the fungi that we tested [14] As an index of elicitor activity, we measured the induction of TBC-1, a tobacco class IV chitinase homolog [14] Interestingly, the activity of this isozyme increased remarkably following treatment with the autoclaved extract of A alternata 102, but was not affected by other stimuli such as UV-irradiation, heat ⁄cold treatment, or heavy metal application Therefore, we regarded the induction of TBC-1 as an excellent indicator for use in the purification of the elicitor-active compound By using this criterion, we obtained a single elicitor-active fraction after several purification steps Because there was no other elicitor-active fraction, the purified compound, mainly consisting of carbohydrate, was thought to be responsible for the elicitor activity seen in the autoclaved extract Structural analysis indicated that AaGlucan, the elicitor from A alternata 102, is most likely a mixture of branched b-1,3-, 1,6-glucan oligosaccharides with a DP of 8–17 The oligosaccharide nature of AaGlucan raises an interesting question regarding its generation and function Usually, oligosaccharide elicitors, such as fragments of chitin and b-glucan, have been postulated to be generated from the corresponding polysaccharides in the fungal cell walls by hydrolases secreted by the host plants as well as by the invading fungus itself [21] However, the structure of AaGlucan raises the FEBS Journal 273 (2006) 2421–2431 ª 2006 The Authors Journal compilation ª 2006 FEBS T Shinya et al possibility that the oligosaccharides are synthesized as they are and secreted outside of the cells of the fungus, similarly to some cyclic glucans and nod-factors secreted by rhizobial bacteria [16,22] If so, the function of these b-glucan oligomers for the fungus might be very different from that of the known cell-wall glucans Clarifying the origin of these oligosaccharides and their function for the fungus itself remains an interesting question for future studies The branched oligosaccharide structure of AaGlucan might explain its solubility in 75% methanol or 75% ethanol, in which most polysaccharides are insoluble Cyclic b-1,6, 1,3-glucans with a DP of 12 isolated from several Bradyrhizobium sp are also reported to be soluble in 75% ethanol [22,23] Although AaGlucan is a reducing oligosaccharide and does not have a cyclic structure, the fact that the purification procedure for AaGlucan was somewhat similar to the purification procedure for those cyclic glucans is indicative of a common basis for their solubility The unique solubility of AaGlucan in alcoholic solvents may be an advantage for the future agricultural use of this elicitor to induce defense responses in intact plants, with the aim of protecting against pathogen infection, because the water-repellent characteristics of leaf surfaces seems to be a potential problem for such applications Several carbohydrate and protein elicitors have been reported to induce defense responses in tobacco plants [18,24] Laminarin, oligogalacturonides, fucan, and chitin are carbohydrates which act as elicitors in tobacco [11,18,25,26], and recently, PS3 was reported to be a potent elicitor in tobacco and Arabidopsis thaliana [18] In the present study, we found that the elicitor activity of AaGlucan compared to these known elicitors was very high in tobacco BY-2 cells, showing elicitor activity even at concentrations as low as 25 ngỈmL)1 The higher activity of AaGlucan was especially evident when the induction of TBC-1 in BY-2 cells was used to measure the elicitor activity: the elicitor activity of AaGlucan was 1000 times as high as that of laminarin (Fig 7) These results suggest that AaGlucan might contain some structural unit specifically recognized by tobacco BY-2 cells AaGlucan also showed elicitor activity in intact tobacco plants, although the elicitor activity was somewhat lower than that in the tobacco BY-2 cells (Fig 9) In addition to the difference between the penetrability of the elicitor into BY-2 cells and into intact plant tissue, this difference in elicitor activity may reflect differences in the specificity of the receptors expressed in these cells As the responses induced by AaGlucan in the intact tobacco plant seems similar to those induced by laminarin, which was reported to reduce pathogen infection [11], it Novel b-glucan elicitor from A alternata 102 might be expected that AaGlucan also has a potential to protect the plant from pathogenic diseases Protein elicitors, such as INF-elicitin, harpin, and cryptogein, are reported to induce the production of PR proteins, oxidative burst, and cell death in tobacco BY-2 cells [24,27,28] On the other hand, AaGlucan induced a defense response without cell death (Fig 8A) Therefore, the defense signaling pathways induced by AaGlucan seems to be somewhat different from the pathways induced by protein elicitors SA and MeJA are well-known plant hormones involved in plant defense signaling When applied to BY-2 cells, however, neither of them induced TBC-1 chitinase (data not shown), suggesting that the signaling pathway of TBC-1 induction by AaGlucan is not dependent on the SA and MeJA pathways Because laminarin has been reported to induce ethylene-dependent PR proteins but not SA-dependent PR proteins in tobacco [18], and because the responses induced by AaGlucan in tobacco tissue were quite similar to those induced by laminarin, it seems possible that AaGlucan induces TBC-1 induction through the ethylene-dependent signaling pathway; however, experimental evidence for this should be obtained in future studies Experimental procedures Fungi and plant materials The fungus Alternaria alternata 102 was kindly provided by K Takatori (National Institute of Health Sciences, Tokyo, Japan) A alternata 102 maintained on a PDA slant (potato dextrose agar; Franklin Lakes, NJ, USA) was inoculated into a 30-mL LSD medium (Linsmaier–Skoog medium supplemented with 2,4-dichlorophenoxyacetic acid) [14] After incubation for a week, the entire culture medium was transferred into 900 mL of fresh LSD medium and incubated for another week before use The cultured tobacco cell line BY-2 derived from Nicotiana tabacum L cv Bright Yellow-2 was maintained in an LSD medium at 28 °C in the dark with rotation at 130 r.p.m BY-2 cells were transferred into fresh medium every week Cells cultured for days into this weekly period were used in the experiments Tobacco plants (Nicotiana tabacum cv Samsun H) used for the experiments were grown in a greenhouse under controlled conditions (16-h light period at 22 °C) Bioassay of elicitor activity The elicitor activity was evaluated from the induction of TBC-1 [14] TBC-1 is the most abundant chitinase isozyme induced in BY-2 cells by the filtrate of autoclaved FEBS Journal 273 (2006) 2421–2431 ª 2006 The Authors Journal compilation ª 2006 FEBS 2427 Novel b-glucan elicitor from A alternata 102 T Shinya et al A alternata 102 culture Twenty ml aliquots of BY-2 cells were used for the analysis of elicitor activity The amount of elicitor used for each experiment was shown in figures or figure legends The chitinase activity was assayed by the activity staining method following native polyacrylamide gel electrophoresis (native PAGE) [14,29] Isolation of elicitor-active fraction The culture of A alternata 102 was autoclaved twice at 121 °C for 15 and then separated by filtration into a filtrate and mycelia The filtrate was lyophilized and then washed four times with methanol The methanol-insoluble residue was dissolved in distilled water The water-insoluble matter was removed by centrifugation (1500 g, min) The obtained supernatant was mixed with volumes of methanol and then centrifuged (1500 g, min) The supernatant was recovered, and the precipitate was further extracted times with 75% methanol All 75% methanol fractions were collected and dried in vacuo This dried matter was dissolved in distilled water, to which trichloroacetic acid had been added to a final concentration of 10% (v ⁄v) The resulting solution was allowed to stand for 12 h at °C After removing the precipitate by centrifugation, the trichloroacetic acid was removed by ether extraction The water layer was neutralized to pH 6.0 with m NaOH and dried in vacuo The solid matter was dissolved in 75% methanol The 75% methanol-soluble fraction was dried in vacuo and dissolved in distilled water The solution was dialyzed (molecular weight cutoff, 12 000 Da) against distilled water The dialyzed solution was put on a C18 silica reversed phase chromatography column that was pre-equilibrated with water The column was eluted with 0%, 25%, 50%, and 100% methanol, in that order The fraction eluted with 25% methanol showed elicitor activity This fraction was purified by HPLC on an Inertsil ODS-3 column (20 · 250 mm; GL Sciences, Tokyo, Japan) The column was eluted with a linear gradient of methanol solution, from 0% methanol at to 75% methanol at 45 min, which was then followed by elution with 100% methanol for 15 The flow rate was mLỈmin)1 throughout Elicitor activity and sugar concentration were measured for each fraction Sugar concentration was measured by the phenol– sulfuric acid procedure using glucose as a standard [30] After the elicitor-active fractions were separated again on the Inertsil ODS-3 column under these conditions, the elicitor-active fractions thus obtained were collected and further fractionated by gel filtration HPLC on a KW-802.5 column (8 · 300 mm; Showa Denko, Tokyo, Japan) with water Each fraction was monitored with a refractometer Structural analysis The composition of the monosaccharide in each fraction was analyzed according to the following steps The fraction 2428 purified by gel filtration HPLC was hydrolyzed in N sulfuric acid for 12 h at 105 °C The resulting hydrolysates were neutralized with Dowex (OH–) (Muromachi Chemicals Inc., Omuta, Japan) and reduced with mgỈmL)1 NaBH4 in 0.5 m NH3 Glacial acetic acid was added to the solution, and the solution was neutralized with Dowex (H+) Alditol acetates were synthesized by the reaction of acetic anhydrate and pyridine for h at 105 °C, and were analyzed by GC-MS using a JEOL (Akishima, Japan) mass spectrometer (SX-102 A) equipped with a Hewlett-Packard 5890 II (Palo Alto, CA, USA) gas chromatograph (DB-1 MS; 0.25 mm · 15 m capillary column; J & W Scientific, Folsom, CA, USA) Glycosyl linkages were analyzed by converting the sugars to partially methylated alditol acetates Each fraction was methylated according to the method of Hakomori [31,32], and the partially methylated sugars were converted to the corresponding alditol acetates The partially methylated alditol acetates were dissolved in chloroform and analyzed by GC-MS Analysis of reducing-end sugar The purified elicitor was reduced with mgỈmL)1 NaBH4 in 0.5 m NH3 for 12 h Glacial acetic acid was added to the solution, and the solution was neutralized with Dowex (H+) Methanol was added to the solution and evaporated After the same procedure was performed an additional times to remove borate, the sample was hydrolyzed in N sulfuric acid for h at 105 °C The resulting hydrolysates were neutralized with Dowex (OH–) and analyzed by HPAEC-PAD HPAEC was carried out with the DX-300 system (Dionex, Sunnyvale, CA, USA) equipped with a pulsed amperometric detector by using a CarboPac PA-1 column (4 · 250 mm) For analysis of reducing-end sugar, the column was eluted with mm NaOH at a flow rate of 0.8 mLỈmin)1 A cyclic b-1,2-glucan was treated and analyzed under the same conditions The cyclic b-1,2-glucan was kindly donated by M Hisamatsu (Mie University, Mie, Japan) NMR spectroscopy and MALDI-TOF/MS H- and 13C-NMR spectroscopy experiments were performed with an Alpha-500 spectrometer (JEOL) The samples of purified elicitor were dissolved in D2O, and acetone was used as an internal standard (dH ¼ 2.225 p.p.m., dC ¼ 31.45 p.p.m) MALDI-TOF ⁄MS was performed with a Voyager-DE PRO (Applied Biosystems, Foster City, CA, USA) instrument operated at an acceleration energy of 20 kV, in reflector mode, and with positive-ion detection The samples of purified elicitor were prepared for analysis according to the method used for analysis of glucans [33] The purified elicitor was dissolved in water at a concentration of FEBS Journal 273 (2006) 2421–2431 ª 2006 The Authors Journal compilation ª 2006 FEBS T Shinya et al Novel b-glucan elicitor from A alternata 102 0.4 lgỈlL)1 A matrix of 2,5-DHBA (2,5-dihydroxybenzonic acid) acid in 60% acetonitrile at a concentration of 20 lgỈlL)1 was used The elicitor and DHBA solutions were mixed : (v ⁄v), and then a ⁄10 volume of 0.1% NaCl was added to the solution A 1.0-lL quantity of the solution of matrix and analyte was applied to the sample plate and dried under ambient conditions Treatment of BY-2 cells and plants with poly and oligosaccharides BY-2 cell suspensions were treated with the following compounds: laminarin, laminaripentaose, N-acetylchitooctaose, glycol chitin, filtrate of autoclaved A alternata culture, and the purified fraction Laminarin was purchased from Sigma (St Louis, USA), and laminaripentaose was purchased from Seikagaku (Tokyo, Japan) N-Acetylchitooctaose was obtained from Yaizu Suisankagaku Industry (Shizuoka, Japan) Glycol chitin was synthesized from glycol chitosan according to the protocol reported previously [29] After the addition of each stressor compound, BY-2 cells were incubated for h at 28 °C in the dark Then the chitinase activity of BY-2 cells was measured Tobacco plants were infiltrated with the following compounds: laminarin and PS3 obtained as described previously [18] at a concentration of 200 lgỈmL)1 and AaGlucan at a concentration of 30 lgỈmL)1 They were dissolved in Mes-NaOH buffer (2 mm, pH 6) Plant treatments were performed by infiltration into the mesophyll of fully developed leaves of the elicitor solutions using a mL syringe Laminarinase treatment and periodate oxidation AaGlucan was treated with laminarinase (b-1,3-glucanohydrolase) purchased from MP Biomedicals (CA, USA) After lg of purified fraction was treated with 0.5 units of laminarinase in 0.1 m phosphate buffer (pH 5.8) for 24 h at 37 °C, the reaction mixture was heated for at 90 °C The elicitor activity was then evaluated from the induction of TBC-1 To further analyze the elicitor structure, AaGlucan solution (2 lg), laminarin solution (200 lg), or water without glucan was mixed with sodium periodate solution (40 lmol) and placed in a cold room at °C for 18 h At the end of this time, excess periodate was destroyed by addition of 150 lL of ethylene glycol BY-2 cells were treated with these reaction mixtures (AaGlucan at 100 ngỈmL)1 and laminarin at 100 lgỈmL)1), and the induction of TBC-1 was measured Detection of cell viability and chemiluminescence assay Cell viability was detected using propidium iodide (PI) which stains nonviable cells [15] PI-stained cells were counted under a fluorescence microscope Generation of reactive oxygen species induced by the elicitor in the medium of the suspension-cultured cells was monitored in terms of chemiluminescence due to the ferricyanide-catalyzed oxidation of luminol (5-amino-2,3-dihydro-1,4-phthalazinedione) [34] A 50 lL aliquot of the elicitor solution was added to 950 lL of suspension-cultured cells, which contained about 50 mg fresh weight cells After incubation, the suspension-cultured cells were allowed to stand for precipitation, and then 10 lL samples of the supernatant were collected and used for the assay A standard solution of H2O2 was used to make a calibration curve RT-PCR gene expression analysis in BY-2 cells and tobacco plants Total RNA from tobacco plants was extracted using the RNeasy plant mini kit (Qiagen, Courtaboeuf, France) according to the protocol supplied by the manufacturer First-strand cDNA synthesis was made from lg of RNA using the Superscript III reverse transcriptase (Invitrogen, Cergy Pontoise, France) Total RNA from BY-2 cells was extracted using Trizol (Invitrogen, CA, USA) according to the protocol supplied by the manufacturer First-strand cDNA synthesis was made from lg of RNA using the with M-MLV reverse transcriptase (Promega, WI, USA) The synthesized cDNA was used as template for PCR Using the cDNA from plant, PCR was performed with denaturing, annealing and extension temperatures of 94 °C for min, 55–58 °C for and 72 °C for min, respectively, for Table Primer sequences used in RT-PCR gene expression analysis Gene Accession number Sequence, 5¢-3¢ Forward (F), Reverse (R) Product (bp) Annealing temp (°C) EF1a acidic PR-3 basic PR-3 PAL CCoAOMT OMT HMGR STC AF120093 M29868 X16938 X78269 U62734 AF484252 AF004232 AF272244 (F)TCGCCTTGTGGAAGTTTGAGAC (R)AACATTGTCACCAGGGAGTGCC (F)CAGGAGGGTATTGCTTTGTTAGGC (R)ATCTTCCACTGCGTCATTCCGTCC (F)GCCATAGGAGTGGACCTGCTAAAC (R)AAAAGACCTCTGGTTGCCGC (F)TTACGCCCTCAGAACATCACCC (R)GCTTGGATTCCTTCCTGCTGTC (F)ATTGGTGTTTTTACTGGTTACT (R)ATTGGTGTTTTTACTGGTTACT (F)TTGATGTTGGAGGTGGTCTTGG (R)GTCTGGTTTCACTGGTAAAATGGC (F)GACACTTGCTGCTGTTTTCAACC (R)TTTCTTCACCACCTCTTCCGTG (F)TCAAGGTGGTGGAAAGATTTGG (R)GCTTAGGTATTCAGAAACAGGTGGC 665 356 336 301 410 302 310 447 56 58 56 56 56 50 56 56 FEBS Journal 273 (2006) 2421–2431 ª 2006 The Authors Journal compilation ª 2006 FEBS 2429 Novel b-glucan elicitor from A alternata 102 T Shinya et al 25–29 cycles The annealing temperature and number of cycles was adapted for each gene (see Table for primer sequence and annealing temperature) Control reactions to normalize RT-PCR amplification were run with the EF1a specific primers (Table 2) and five serial dilutions of each first strand cDNA PCRs were performed through 25 cycles and resulted in amplification linearly related to RNA amounts The PCR mixture contained 0.4 lm of each specific primer, 0.5 unit of Taq polymerase (Eurobio, Courtaboeuf, France) PCR products were separated on a 1% agarose gel and visualized after ethidium bromide staining Quantification of the PCR products was made in gel using the Bio-Rad GelDoc apparatus (Bio-Rad, Hercules, CA) together with the Bio-Rad quantity one software Using the cDNA from BY-2 cells, PCR was performed with denaturing, annealing and extension temperatures of 94 °C for 0.5 min, 50–58 °C for 0.5 and 72 °C for 0.5 min, respectively, for 24–34 cycles The annealing temperature and number of cycles was adapted for each gene Twenty-five serial dilutions of each first strand cDNA The PCR mixture contained 0.5 lm of each specific primer, Taq polymerase (Ex-Taq, TAKARA BIO INC., Shiga, Japan) 10 11 Acknowledgements We thank Dr K Takatori and Dr M Aihara (National Institute of Health Sciences, Tokyo, Japan) for their advice and the kind gift of A alternata 102 The authors are thankful to Patrice de Ruffray for technical help (IBMP, Strasbourg, France) We thank Mr Y Desaki of the Meiji University for help with the MS analysis We thank Dr M Hisamatsu (Mie University, Mie, Japan) for the kind gift of the cyclic b-1,2-glucan We are indebted to Yaizu Suisankagaku Industrial Co for the supply of chitosan oligosaccharides This work was partly supported by a Ministry of Education, Culture, Sports, Science, and Technology Grant-in-Aid for Scientific Research, Scientific Research of Priority Areas: Single-Cell Molecular Technology 12 13 14 References Shibuya N & Minami E (2001) Oligosaccharide signalling for defence responses in plant Physiol Mol Plant Pathol 59, 223–233 Ebel J (1998) Oligoglucoside elicitor-mediated activation of plant defense Bioessays 20, 569–576 Cote F & Hahn MG (1994) Oligosaccharins: structures and signal transduction Plant Mol Biol 26, 1379–1411 Parker JE (2003) Plant recognition of microbial patterns Trends Plant Sci 8, 245–247 Brunner F, Rosahl S, Lee J, Rudd JJ, Geiler C, Kauppinen S, Rasmussen G, Scheel D & Nurnberger T (2002) 2430 15 16 17 Pep-13, a plant defense-inducing pathogen-associated pattern from Phytophthora transglutaminases EMBO J 21, 6681–6688 Zipfel C, Robatzek S, Navarro L, Oakeley EJ, Jones JD, Felix G & Boller T (2004) Bacterial disease resistance in Arabidopsis through flagellin perception Nature 428, 764–767 Nurnberger T & Brunner F (2002) Innate immunity in plants and animals: emerging parallels between the recognition of general elicitors and pathogen-associated molecular patterns Current Opinion Plant Biol 5, 318– 324 Hagihara T, Hashi M, Takeuchi Y & Yamaoka N (2004) Cloning of soybean genes induced during hypersensitive cell death caused by syringolide elicitor Planta 218, 606–614 Wu Y, Wood MD, Tao Y & Katagiri F (2003) Direct delivery of bacterial avirulence proteins into resistant Arabidopsis protoplasts leads to hypersensitive cell death Plant J 33, 131–137 Bonas U & Van den Ackervaken G (1997) Recognition of bacterial avirulence proteins occurs inside the plant cell: a general phenomenon in resistance to bacterial diseases? Plant J 12, 1–7 Klarzynski O, Plesse B, Joubert JM, Yvin JC, Kopp M, Kloareg B & Fritig B (2000) Linear b-1,3 glucans are elicitors of defense responses in tobacco Plant Physiol 124, 1027–1037 Yamaguchi T, Yamada A, Hong N, Ogawa T, Ishii T & Shibuya N (2000) Differences in the recognition of glucan elicitor signals between rice and soybean: beta-glucan fragments from the rice blast disease fungus Pyricularia oryzae that elicit phytoalexin biosynthesis in suspension-cultured rice cells Plant Cell 12, 817–826 Cheong JJ, Birberg W, Fugedi P, Pilotti A, Garegg PJ, Hong N, Ogawa T & Hahn MG (1991) Structure-activity relationships of oligo-beta-glucoside elicitors of phytoalexin accumulation in soybean Plant Cell 3, 127– 136 Saito M, Shinya T, Hanai K, Katagi T & Matsuoka H (2004) A novel chitinase isozyme in tobacco BY-2 cells induced by the autoclaved Alternaria alternata culture medium Plant Sci 167, 811–817 Oh KB, Tajima Y, Saito M, Chang IM & Matsuoka H (2002) Cytotoxicity of extracts from Alternaria alternata against cultured tobacco BY-2 cells Biocontrol Sci 7, 127–130 Hisamatsu M (1992) Cyclic (1–2)-b-d-glucans (cyclosophorans) produced by Agrobacterium and Rhizobium species Carbohydr Res 231, 137–146 ´ Mlejnek P, Dolezel P & Prochazka S (2003) Intracellular phosphorylation of benzyladenosine is related to apoptosis induction in tobacco BY-2 cells Plant Cell Environ 26, 1723–1735 FEBS Journal 273 (2006) 2421–2431 ª 2006 The Authors Journal compilation ª 2006 FEBS T Shinya et al 18 Menard R, Alban S, de Ruffray P, Jamois F, Franz G, Fritig B, Yvin JC & Kauffmann S (2004) b-1,3 glucan sulfate, but not b-1,3 glucan, induces the salicylic acid signaling pathway in tobacco and Arabidopsis Plant Cell 16, 3020–3032 19 Shinya T, Gondo S, Iijima H, Hanai K, Matsuoka H & Saito M (2004) Cell-lytic activity of tobacco BY-2 induced by a fungal elicitor from Alternaria alternata attributed to the expression of a class I beta-1,3-glucanase gene Biosci Biotechnol Biochem 68, 1265–1272 20 Shinya T, Hanai K, Saito M & Matsuoka H (2004) Isolation of a novel isozyme of tobacco BY-2 chitinase induced by a fungal elicitor Plant Biotech 21, 155–158 21 Okinaka Y, Mimori K, Takeo K, Kitamura S, Takeuchi Y, Yamaoka N & Yoshikawa M (1995) A structural model for the mechanisms of elicitor release from fungal cell walls by plant b-1,3-endoglucanase Plant Physiol 109, 839–845 22 Bhagwat AA, Gross KC, Tully RE & Keister DL (1996) b-Glucan synthesis in Bradyrhizobium japonicum: characterization of a new locus (ndvC) influencing b-(1– 6) linkages J Bacteriol 178, 4635–4642 23 Bhagwat AA, Mithofer A, Pfeffer PE, Kraus C, Spickers N, Hotchkiss A, Ebel J & Keister DL (1999) Further studies of the role of cyclic beta-glucans in symbiosis An NdvC mutant of Bradyrhizobium japonicum synthesizes cyclodecakis-(1–3)-beta-glucosyl Plant Physiol 119, 1057–1064 24 Sasabe M, Takeuchi K, Kamoun S, Ichinose Y, Govers F, Toyoda K, Shiraishi T & Yamada T (2000) Independent pathways leading to apoptotic cell death, oxidative burst and defense gene expression in response to elicitin in tobacco cell suspension culture Eur J Biochem 267, 5005–5013 25 Lecourieux D, Mazars C, Pauly N, Ranjeva R & Pugin A (2002) Analysis and effects of cytosolic free calcium increases in response to elicitors in Nicotiana plumbaginifolia cells Plant Cell 14, 2627–2641 Novel b-glucan elicitor from A alternata 102 26 Baier R, Schiene K, Kohring B, Flaschel E & Niehaus K (1999) Alfalfa and tobacco cells react differently to chitin oligosaccharides and Sinorhizobium meliloti nodulation factors Planta 210, 157–164 27 Andi S, Taguchi F, Toyoda K, Shiraishi T & Ichinose Y (2001) Effect of methyl jasmonate on harpin-induced hypersensitive cell death, generation of hydrogen peroxide and expression of PAL mRNA in tobacco suspension cultured BY-2 cells Plant Cell Physiol 42, 446–449 28 Kadota Y, Goh T, Tomatsu H, Tamauchi R, Higashi K, Muto S & Kuchitsu K (2004) Cryptogein-induced initial events in tobacco BY-2 cells: pharmacological characterization of molecular relationship among cytosolic Ca2+ transients, anion efflux and production of reactive oxygen species Plant Cell Physiol 45, 160–170 29 Trudel J & Asselin A (1989) Detection of chitinase activity after polyacrylamide gel electrophoresis Anal Biochem 178, 362–366 30 Dubois M, Gilles KA, Hamilton JK, Rebers PA & Smith F (1956) Colorimetric method for determination of sugars and related substances Anal Chem 28, 350– 356 31 Hakomori S (1964) A rapid permethylation of glycolipid, and polysaccharide catalyzed by methylsulfinyl carbanion in dimethyl sulfoxide J Biochem 55, 205–208 32 Kobayashi A, Tai A & Kawazu K (1995) Structural elucidation of an elicitor-active oligosaccharide, LN-3, prepared from algal laminaran J Carbohydr Chem 16, 819–832 33 Kuroyama H, Tsutsui N, Hashimoto Y & Tsumuraya Y (2001) Purification and characterization of a beta-glucuronidase from Aspergillus niger Carbohydr Res 333, 27–39 34 Yamaguchi T, Minami E & Shibuya N (2003) Activation of phospholipases by N-acetylchitooligosaccharide elicitor in suspension-cultured rice cells mediates reactive oxygen generation Physiol Plant 118, 361–370 FEBS Journal 273 (2006) 2421–2431 ª 2006 The Authors Journal compilation ª 2006 FEBS 2431 ... isolated from A alternata 102 Our previous work has indicated that the filtrate obtained from autoclaved A alternata 102 culture was able to induce marked chitinase activity in tobacco 2422 A alternata1 02... responses induced by AaGlucan in the intact tobacco plant seems similar to those induced by laminarin, which was reported to reduce pathogen infection [11], it Novel b-glucan elicitor from A alternata. .. b-glucans During the course of a search for a potent elicitor of defense responses in a model plant cell (tobacco BY-2 cells), we found that the fungal strain Alternaria alternata 102 produces