Conformational analysis of opacity proteins from Neisseria meningitidis Marien I. de Jonge 1,2 , Martine P. Bos 3 , Hendrik J. Hamstra 1 , Wim Jiskoot 4 , Peter van Ulsen 4 , Jan Tommassen 4 , Loek van Alphen 1 and Peter van der Ley 1 1 Laboratory of Vaccine Research, National Institute of Public Health and the Environment, RIVM Bilthoven, the Netherlands; 2 Department of Medical Microbiology, University of Amsterdam/AMC, Amsterdam, the Netherlands; 3 Department of Molecular Microbiology and 4 Department of Pharmaceutics, Utrecht University, Utrecht, the Netherlands Opacity-associated (Opa) proteins are outer membrane proteins which play a critical role in the adhesion of patho- genic Neisseria spp. to epithelial and endothelial cells and polymorphonuclear neutrophils. The adherence is mainly mediated by the CD66-epitope-containing members of the carcinoembryonic-antigen family of human cell-adhesion molecules (CEACAM). For the analysis of the specific in- teractions of individual Opa proteins with their receptors, pure protein is needed in its native conformation. In this study, we describe the isolation and structural analysis of opacity proteins OpaJ129 and OpaB128 derived from Neisseria meningitidis strain H44/76. When the Opa proteins were produced with the phoE signal sequence in Escherichia coli, they were localized at the cell surface and the recom- binant bacteria were found to specifically interact with CEACAM1. For refolding and purification, the proteins were overproduced without their signal sequences in E. coli, resulting in its cytoplasmic accumulation in the form of inclusion bodies. After solubilization of the inclusion bodies in urea, the proteins could be folded efficiently in vitro, under alkaline conditions by dilution in ethanolamine and the detergent n-dodecyl-N,N-dimethyl-1-ammonio-3-propane- sulfonate (SB12). The structure of the refolded and purified proteins, determined by circular dichroism, indicated a high content of b-sheet conformation, which is consistent with previously proposed topology models for Opa proteins. A clear difference was found between the binding of refolded vs. denatured OpaJ protein to the N-A1 domain of CEA- CAM1. Almost no binding was found with the denatured Opa protein, showing that the Opa–receptor interaction is conformation-dependent. Keywords: Opa protein; Neisseria meningitidis;CEACAM receptor; in vitro folding; conformation. The pathogenic bacteria Neisseria meningitidis and Neisseria gonorrhoeae express a family of genes encoding outer membrane proteins that are structurally related but highly polymorphic. These proteins were originally identified as colony-opacity-associated (Opa) proteins [1]. Opa proteins appear to play a critical role in the ÔintimateÕ adhesion of the bacteria to epithelial and endothelial cells and to polymor- phonuclear neutrophils [2,3]. The majority of Opa proteins bind to carcinoembryonic antigen cell-adhesion molecules (CEACAM, formerly called CD66) [4]. CEACAM proteins are expressed on various epithelial and endothelial cells as well as on some lymphoid and myeloid cells [5]. A minority of the Opa proteins target heparan sulfate proteoglycans (HSPG) [6,7]. Recently, several Opa proteins were found that did not bind to any of these human receptors, suggesting that these Opa proteins haveadditional functions or that they recognize additional receptors [8]. Opa-receptor-mediated adhesion can lead to invasion of the bacteria into thedifferent cell types expressing CEACAM proteins [8,9]. Opa expres- sion was found in mucosal as well as disease isolates, 87.5% of meningococcal strains tested bind to CEACAM1 [10]. Although the binding specificity of the variable Opa proteins to the conserved human receptors has been studied extensively [11], not much is known about the binding sites present in the Opa proteins. A two-dimensional topology model has been proposed, in which the Opa proteins form eight-stranded b-barrels, exposing four loops at the cell surface [12]. The variability of the Opa proteins is mainly concentrated in surface-exposed loops two and three. An intriguing question is how the binding function of the Opa proteins can be conserved despite the hypervariability observed. Pure protein is needed for detailed structure–function relationship studies addressing this question. Due to phase- variable expression of the Opa proteins in Neisseria spp. [13], it is difficult to purify individual Opa proteins without contamination of other Opa proteins from neisserial cells. To overcome this problem, the invasion-associated men- ingococcal OpaJ129 and OpaB128 proteins, both of which bind to CEACAM1, were produced in this study in E. coli. We developed a method to produce pure, folded and functional Opa protein. The Opa proteins were isolated in the form of inclusion bodies and subsequently folded in vitro. Correspondence to M. de Jonge, Laboratory of Vaccine Research, National Institute of Public Health and the Environment, RIVM Bilthoven, the Netherlands. Fax: + 31 030 2744429, Tel.: + 31 030 2743999, E-mail: Marien.de.Jonge@RIVM.nl Abbreviations: CEACAM, carcinoembryonic-antigen cell adhesion molecule; HSPG, heparan sulfate proteoglycans; IPTG, isopropyl thio-b- D -galactoside; OMC, outer membrane complex; Opa proteins, opacity associated proteins; SB12, n-dodecyl-N,N-dimethyl- 1-ammonio-3-propanesulfonate. (Received 12 July 2002, accepted 5 September 2002) Eur. J. Biochem. 269, 5215–5223 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03228.x The structure of refolded Opa protein was studied by circular dichroism (CD) spectroscopy. The spectra are indicative of a high content of b-strands, consistent with the previously proposed structural models. Refolded Opa protein was shown to be functional by specific binding to the N-A1 part of CEACAM1. MATERIALS AND METHODS Construction of the expression systems The genes encoding OpaJ129 and OpaB128 were isolated from H44/76 using Taq polymerase (Amersham, Piscata- way, NJ, USA) and general opa primers (5¢-CTTCT CTTCTCTTCCGCAGC-3¢ and 5¢-TCGGTATCGGGG AATCAGAA-3¢), cloned into plasmid pCR2.1 (Topo TA cloning kit, Invitrogen, Carlsbad, CA, USA) and subse- quently sequenced using M13-forward and M13-reverse primers (Invitrogen). Plasmids pCR2.1 containing opaJ129 and opaB128 were used to amplify the DNA sequences encoding the mature OpaB128 and OpaJ129 proteins with Taq polymerase. The primers used (5¢-AGCGC CCA TGGCAAGTGAAG-3¢ and 5¢-GGCATCGGGATCCG GGAATCAG-3¢) were based on the DNA sequence of opaB128 and opaJ129 of N. meningitidis strains H44/76 (unpublished) and 190/87 (GenBank accession no. AF016285) [12]. The primers contained base substitutions (underlined) to introduce NcoIandBamHI cleavage sites, respectively. The PCR product was cloned in plasmid pCR2.1. The NcoI–BamHI fragment was isolated from the resulting plasmid and ligated into the NcoI–BamHI digested expression vector pET11d (New England Biolabs, Inc., Beverly, MA, USA) downstream of the inducible T7 promoter. In the resulting construct, the codon for the first amino acid residue of the mature Opa protein was situated directly downstream of the ATG start codon. The sequences of the inserts were checked by DNA sequencing, using the DNA sequencing kit and the ABI Prism 310 genetic analyser, according to the instructions of the manufacturer (ABI Prism, Perkin Elmer Applied Biosystems, Warrington, UK). Plasmids pET11d-opaB128 and pET11d-opaJ129 were used to transform the E. coli strain BL21 (DE3) containing a chromosomal copy of the T7 RNA polymerase gene under control of the lac promotor [14]. Plasmid-containing derivatives of this strain were grown at 37 °CinLuria- Bertani (LB) medium (BIO 101, Inc., Carlsbad, CA, USA) supplemented with 100 lgÆmL )1 ampicillin (Sigma, St. Louis, MO, USA). The OpaB128 and OpaJ129 expression at the cell surface of E. coli strain CE1265 was realized using the expression vector pMR05, containing the complete phoE gene [15]. PCR amplifications were performed on pCR2.1 containing either opaB128 or opaJ129 using Taq polymerase and mutagenic primers (5¢-ATAGATCTCGGGGAATCAG AAGCG-3¢ and 5¢-CTTCTCTTCTCTTCTGCAGC-3¢) to generate a PstI site between the signal sequence and the mature portion and a BglII site behind the stopcodon of opaB128 and opaJ129.ThePstI–BglII fragments of opaB128 and opaJ129 were used to replace a PstI–BglII fragment of the phoE gene in pMR05, resulting in an in- frame fusion of opa to the signal peptide of phoE and expression from the phoE promotor. The resulting plasmids were used for transformation of strain CE1265, which expresses the pho regulon constitutively due to a phoR mutation [16]. Expression of OpaB128 and OpaJ129 was determined by assaying the binding of monoclonal anti- bodies MN20E12.70 (M. de Jonge, G. Vidarson, H. H. van Dijken, P. Hoogerhout, L. van Alphen, J. Dankert & P. van der Ley, unpublished results) and 15-1-P5.5 [18] in a colony blotting experiment [19]. The bla-opaB fusion construction, whichresultedinE. coli surface expression of gonococcal OpaB, is described by Belland et al.[3].Thesurface expression was confirmed with immunofluorescence. Cells were washed with NaCl/P i and after blocking overnight in NaCl/P i with 3% BSA, incubated with 15-1-P5.5 [18] (diluted 1 : 100) for 1 h, followed by an incubation with Alexa-conjugated goat anti-(mouse IgG) (Molecular Probes Inc., Eugene, OR, USA) (diluted 1 : 300) for 1 h. After washing three times, cells were again fixated in NaCl/P i with 2% formaldehyde (Merck, Darmstadt, Germany). The construction of the recombinant N-domains of the different CEACAM proteins is described by Bos et al.[20]. Binding of His-tagged CEACAM fragments to bacterial cells The binding of His-tagged CEACAM fragments to bacter- ial cells was measured as described previously [20]. The expression of the N-terminal domains of the CEACAM proteins was regulated by the inducible T7 promoter. The Opa-expressing bacteria (3 · 10 8 ) in 200 lL Hepes buffer (10 m M Hepes, pH 7.4, 145 m M NaCl, 5 m M KCl, 0.5 m M MgCl 2 and 1 m M CaCl 2 ) were incubated with 10 lLof cleared bacterial cell lysate containing the His-tagged N-terminal domains of either CEACAM1 or CEACAM8, for 20 min at 37 °C. Bacteria were collected by centrifuga- tion (5 min at 2000 g) and washed with 1 mL of Hepes buffer. The pellet was resuspended, and processed for SDS/ PAGE and Western blotting, with monoclonal antibody 4B12 (1 : 5000) [21] for the detection of OpaJ129 and anti- His 6 monoclonal Ig (1 : 10 000) (Amersham Pharmacia Biotech GmbH, Freiburg, Germany) for the detection of the N-terminal domains of the CEACAM proteins. Production and purification of inclusion bodies Cultures of the E. coli strain BL21 (DE3) containing either pET11d-opaB128 or pET11d-opaJ129, grown overnight at 37 °C, were diluted 1 : 10 into fresh LB medium supple- mented with 0.5% glucose (Fluka, Buchs, Switzerland) and 100 lgÆmL )1 ampicillin. When the culture reached an optical density of 660 nm (D 660 ) of 0.6, isopropyl thio-b- D -galactoside (IPTG) (Boehringer Mannheim, Germany) was added to a final concentration of 1 m M .After3hof incubation at 37 °C, the cells were harvested by centrifuga- tion at 4500 r.p.m. for 15 min at 4 °C (Centrikon T324, Rotor A6.9, Kontron Instruments, Milan, Italy). The pellet waswashedwith10m M Tris/HCl (pH 8) and centrifuged at 4500 r.p.m. for 15 min at 4 °C in the same rotor. After resuspension in the same buffer, cells were disrupted using a French Press (SLM-Aminco) at 9000 p.s.i. three times. The inclusion bodies were collected by a low-speed centrifuga- tion step at 2800 g for 10 min at 4 °C (Megafuge 1.0 R, Hereaus sepatech, Germany). The pellet was resuspended in 8 M urea, 50 m M glycine (pH 8.0). Ultracentrifugation at 5216 M. I. de Jonge et al.(Eur. J. Biochem. 269) Ó FEBS 2002 100 000 g for 2.5 h at 4 °C was used to remove residual membrane fragments and the supernatant was stored at 4 °C. The protein concentration was determined with the Pierce protein assay (Pierce, Rockford, IL, USA) using BSA as a standard. Proteins were separated by SDS/PAGE with 0.4 m M thioglycolic acid (Sigma-Aldrich, Steinheim, Germany), included in the separating gel. After blotting on poly(vinylidene difluoride) (Millipore, Bedford, MA, USA) membranes and staining of the blots with Coomassie Brilliant Blue, protein bands were cut from the membranes and used for N-terminal sequencing. Semi-native-polyacrylamide gel electrophoresis To determine the heat-modifiability of wild type OpaB128 and OpaJ129, outer membrane complexes (OMCs) were isolated from N. meningtidis strain H44/76 according to the protocol described by Davies et al. [22]. The expression of wild-type OpaJ129 was determined by Western blotting using monoclonal antibody 15-1-P5.5 [18]. The expression of wild-type OpaB128 was determined by Western blotting using monoclonal antibody MN20E12.70 (M. de Jonge, G. Vidarson, H. H. van Dijken, P. Hoogerhout, L. van Alphen, J. Dankert & P. van der Ley, unpublished results). Semi-native polyacrylamide gel electrophoresis was per- formed by using SDS-free 11% polyacrylamide gels. Loading buffer containing either 0.1% or 2.0% SDS (Fluka, Buchs, Switzerland) was added to the samples which were subsequently incubated at room temperature and 100 °C, respectively. After electrophoresis, protein bands were visualized with Coomassie Brilliant Blue (Fluka, Buchs, Switzerland). Refolding and purification To find the optimal folding conditions, buffers with different NaCl concentrations (100–300 m M ) and final urea concentrations (125 m M )1 M ) were tested at different pH values ranging from pH 7.2–12.0. Furthermore, different protein dilutions (1 : 20 to 1 : 200) and n-dodecyl-N, N-dimethyl-1-ammonio-3-propanesulfonate (SB-12, Fluka, Buchs, Switzerland) concentrations were tested. All refold- ing experiments were performed overnight at 4 °C. In the optimal folding procedure, Opa (10 mgÆmL )1 ) dissolved in 8 M urea and 50 m M glycine (pH 8.0) was diluted 100-fold in refolding buffer containing 328 m M ethanolamine (pH 12), 0.5% SB12 (i.e. approximately 5 · critical micelle concentration). Prior to use, SB12 was purified by passing a solution of the detergent in methanol/ chloroform (1 : 1, v/v) over an Al 2 O 3 column, to remove all acidic impurities present in the commercial preparation [23]. After incubation overnight at 4 °C, the refolding mix was neutralized with HCl to pH 7.5 and 10 m M Tris was added to buffer the solution. Subsequently, to remove ethanol- amine the solution was washed in a concentrator (Schleicher and Schuell, Dassel, Germany) with 10 m M Tris/HCl, 0.5% SB12 (pH 7.5) (buffer A). An SP-Sepharose-HP column (volume 15 mL) (Amer- sham Pharmacia Biotech Europe GmbH, Freiburg, Ger- many) was equilibrated with buffer A, loaded with approximately 10 mg refolded OpaJ129 and washed twice with buffer A with pH 7.5 and pH 8.5. The proteins were eluted with a linear gradient of NaCl from 0–1 M in 120 mL. To check folding and purification, SDS/PAGE was performed under seminative and denaturing conditions. The folded and purified proteins were stored at )20 °C. Circular dichroism spectroscopy Circular dichroism (CD) spectra were recorded at 25 °Cwith a dual-beam DSM 1000 CD spectrophotometer (On-Line Instrument Systems, Bogart, GA, USA). The subtractive double-grating monochromator was equipped with a fixed disk, holographic gratings, and 1.24-mm slits. For far-UV and near-UV measurements, gratings with 2400 lines per mm (blaze wavelength 230 nm) and 600 lines per mm (blaze wavelength 300 nm), respectively, were used. Far-UV spec- tra were recorded from 250 to 200 nm (cell-path length 0.5 mm). For near-UV measurements (320–250 nm), cells with a path length of 1 cm were used. The Opa protein concentration was 0.54 mgÆmL )1 . The results depicted represent the average of at least six repeated scans (step resolution 1 nm, 1 s each step), from which the correspond- ing buffer spectrum was subtracted. The measured CD signals were converted to molar ellipticity [h],basedona mean residual weight of 112 (OpaB128) or 111.5 (OpaJ129). For the comparison between folded and denatured protein, folded protein in buffer A was incubated for 20 min at 100 °C with 1.85% SDS. Immunodotblotting Opa proteins were diluted to 1 lg per 100 lLin10m M Tris/HCl pH 7.5, 0.2% SB-12 (native) or in 2% SDS and incubated at 100 °C (denatured) and spotted on to nitro- cellulose (1 lg per spot). Filters were blocked with NaCl/P i / T/P (NaCl/P i , 0.01% Tween-20, 0.5% Protifar) and subse- quently incubated for 1 h with 1 mL of receptor sample in 10 mL NaCl/P i /T/P. The blots were incubated with 1 : 10.000 diluted anti-His Ig (Amersham), followed by 1 : 10.000 dilution of peroxidase-conjugated goat anti- mouse Ig (BioSource, Camarillo, CA, USA) and ECL detection (Pierce). OpaD protein is a purified Opa preparation from meningococcal membranes [21] (generously donated by M. Achtman, Max-Planck Institute, Berlin, Germany). This preparation was successfully used previously to detect CEACAM binding in a dot-blot assay [10]. The N- and A1 domains of CEACAM1 were amplified from CEACAM cDNA (gift from M. Kuroki, Fukuoka University, Fukuoka, Japan) with primer pair 5¢-ATCATA TGCAGCTCACTACTGAATCCATGCC-3¢ and 5¢-AT CGGGATCCCTAACTCACTGGGT TCTGTATTTC-3¢ and cloned into pET15a (Invitrogen) using NdeIandBamHI sites included in the primers. This results in an N-terminal 6·His-tag addition to the CEACAM N-domain. The two domains with the His-tag were subcloned into pET26b (Invitrogen) using NcoIandBamHI restriction, resulting in plasmid pVB1. This vector adds the pelB signal sequence to the CEACAM domains, which allows secretion of the protein into the periplasm. BL21 cells containing pVB1 were grown in LB containing 50 lgÆmL )1 kanamycin to a D 600 of 0.6. Cells were induced with 0.2 m M IPTG and grown overnight at room temperature. The induced cell pellet was resuspended in 200 m M Tris/HCl pH 8.0, 0.5 m M EDTA, 0.5 M sucrose. Lysozyme was added to 60 lgÆmL )1 and Ó FEBS 2002 Conformation of meningococcal Opa proteins (Eur. J. Biochem. 269) 5217 the suspension was diluted 2 · with 0.5 m M EDTA and incubated for 10 min at room temperature. Cells were collected by centrifugation for 2 min at 8000 g. (Eppendorf centrifuge) and the supernatant was collected as the periplasmic fraction containing the Opa receptor. RESULTS Binding of Opa proteins to CEACAM1 N. meningitidis strain H44/76 can make four different Opa proteins, some of which appear to be associated with the ability to invade human nasopharyngeal cells [24]. Among those, major differences in the hypervariable regions were found between OpaB128 and OpaJ129; the other two Opa proteins have sequences closely resembling either one (M. de Jonge, G. Vidarson, H. H. van Dijken, P. Hoogerhout, L. van Alphen, J. Dankert & P. van der Ley, unpublished results). The majority of Opa proteins bind to CEACAM proteins, reviewed by Billker et al. [11]. The binding of OpaB128 and OpaJ129 to CEACAM1 and CEACAM8 was determined, using E. coli cells expressing this Opa protein at the cell surface. For this purpose we cloned the fragment of opaB128 and opaJ129 encoding the mature domain of the protein downstream of the promoter and the signal sequence-encoding part of the phosphate-limitation inducible phoE gene of E. coli. The resulting plasmids were used to transform E. coli strain CE1265, which expresses the pho regulon constitutively due to a phoR mutation [16]. Surface expression of OpaB 128 and OpaJ129 was con- firmed by immunoblotting outer membrane complexes (OMCs) (Fig. 1) with monoclonal antibodies MN20E12.70 and 15-1-P5.5. We determined binding of soluble his-tagged N-terminal domains of CEACAM1 or CEACAM8 to recombinant OpaB128 or OpaJ129 expressed at the cell surface with an anti-His monoclonal antibody, as previously described by Bos et al. [20]. The E. coli bacteria expressing either OpaB128 or OpaJ129 at the cell-surface were incubated with N-domains of the two different CEACAM proteins (Fig. 2, lanes 5–8). Surface expressed recombinant gonococcal OpaB protein was included in these experiments as a positive control (Fig. 2, lanes 1 and 2). After incubation, the bacterial cells were collected by centrifuga- tion and the proteins were separated by SDS/PAGE. After blotting to nitrocellulose filters, the presence of CEACAM in the bacterial cell pellets was evaluated with an anti-His Ig. Like the bacteria expressing the gonococcal OpaB protein (lane 1 and 2) the bacteria expressing OpaB128 or OpaJ129 bound to CEACAM1 (lane 5 and 7) while no binding was found with CEACAM8 (lanes 6 and 8). Expression system for Opa proteins To obtain large quantities of OpaB128 and OpaJ129 protein, part of the opa sequence encoding the mature Opa protein without the signal sequence was cloned into pET11d under the control of the inducible T7 promoter. The recombinant genes were expressed in the E. coli strain BL21 (DE3) upon addition of IPTG. The Opa proteins accumulated in the cytoplasm as inclusion bodies, which could be separated from the other cell components by centrifugation. After dissolving these inclusion bodies in 8 M urea followed by an ultracentrifugation step to remove residual membrane fragments, the Opa protein in the supernatant was approximately 90% pure as determined by SDS/PAGE (Fig. 3A). N-terminal amino acid sequen- cing of the purified proteins revealed the sequence ASEDG, Fig. 1. Western blots showing the heat-modifiability of OpaB128 and OpaJ129 expressed in N. meningitidis and E. coli. OMCs of H44/76 expres- sing either OpaB128 or OpaJ129 and OMCs of E. coli strain CE1265 containing the phoE-opa fusion plasmid pMR05-opaB128 or pMR05-opaJ129 were separated by seminative-PAGE and analysed by Western blotting, using either the OpaB128 or OpaJ129 specific monoclonal antibody (MN20E12.70 or 15-1-P5.5, respectively). Samples were treated in sample buffer containing 0.1% SDS at room temperature (RT) or 2.0% SDS at 100 °C, prior to electrophoresis. Fig. 2. Binding of His-tagged N-domains of CEACAM1 and 8 by OpaJ129- and OpaB128-expressing E. coli cells. The binding of the N-terminal fragments of CEACAM1 and CEACAM8 by MS11- OpaB-expressing E. coli (lanes 1 and 2), by E. coli not expressing an Opa protein (lanes 3 and 4), binding of OpaJ129- and OpaB128- expressing E. coli to CEACAM1 (lane 5 and 7, respectively) and to CEACAM 8 (lane 6 and 8, respectively) was studied. The bacteria were incubated with cleared lysates of E. coli containing the N-domains of the CEACAM proteins and were processed for immunoblotting. Bound N-domain was detected with anti-His Ig. Opa protein expres- sion of the variants was evaluated with mAb 4B12. 5218 M. I. de Jonge et al.(Eur. J. Biochem. 269) Ó FEBS 2002 exactly corresponding to the predicted N-terminus of the mature Opa. This indicated that the N-terminal methionine encoded by the ATG initiation codon was efficiently removed in vivo by the methionine endopeptidase [25]. Folding experiments with Opa proteins Correct folding of recombinant Opa protein was evaluated using the property that native Opa proteins migrate faster in semi-native PAGE than heat-denatured forms [1]. To check whether this heat-modifiability character also applies to OpaB128 and OpaJ129, OMCs were isolated from N. meningitidis strain H44/76 expressing them, as deter- mined by Western blotting using monoclonal antibodies MN20E12.70 (M. de Jonge, G. Vidarson, H. H. van Dijken, P. Hoogerhout, L. van Alphen, J. Dankert & P. van der Ley, unpublished results) or 15-1-P5.5 [18], respectively. Semi- native PAGE, followed by Western blotting, confirmed that both OpaB128 and OpaJ129 migrated with an apparent molecularmassof 23 kDa, whereas completely unfolded OpaB128 or OpaJ129 migrates as a protein of  27 kDa (Fig. 1). The heat-modifiability of wild type OpaB128 and OpaJ129 was taken as marker for correct folding of the proteins purified from the inclusion bodies. The correct folding of OpaB128 and OpaJ129 expressed at the surface of E. coli strain CE1265 was confirmed in the same assay (Fig. 1). We diluted the urea-solubilized protein solution (10 mgÆmL )1 ) 100-fold in various buffers with different pHs, all containing 0.5% SB12 (w/v) and incubated the samples overnight at 4 °C. When the pH of the refolding buffer was below 10, no or hardly any refolding was observed. However, in 328 m M ethanolamine buffer with pH 10.5 (i.e. just above the calculated pI of OpaJ129 and OpaB128, 10.3 and 10.4, respectively) almost 50% of OpaJ129 and > 50% of OpaB proved to be refolded according to semi-native PAGE analysis (data not shown). To increase the folding efficiency, several buffering substances and final protein concentrations were tested at different pH values, and different NaCl and urea concentrations. Although inclusion of 200 m M NaCl in the refolding buffer improved refolding considerably this condition was not applied further, because salt interferes with the subsequent protein purification by ion-exchange chromatography. The variation in protein and urea con- centrations had almost no effect (data not shown). How- ever, at pHs further above the calculated pI of OpaB128 and OpaJ129 the folding appeared very efficient (Fig. 3A). Summarizing, efficient refolding was achieved by a 100-fold dilution of 10 mgÆmL )1 Opa protein solubilized in 8 M urea in folding buffer containing 328 m M ethanolamine and 0.5% (w/v) SB12. The optimal pH for efficient refolding was 11 for OpaB128 and 12 for OpaJ129. More than 95% of the protein proved to adopt a folded state under these conditions, as shown by semi-native PAGE (Fig. 3). Purification of folded Opa proteins To remove unfolded protein and other contaminants, the in vitro folded OpaJ129 proteins were purified by ion- exchange chromatography. We observed that during the purification by anion-exchange chromatography (Q-Seph- arose HP at pH 12) a substantial proportion of the refolded OpaJ129 protein eluted in the denatured state. Probably, the protein was unstable in the alkaline conditions applied during purification. Therefore, the pH was reduced from 12 to 7.5 after refolding. This procedure did not affect the folding state of either OpaB128 or OpaJ129 as determined by seminative PAGE (data not shown). The neutralized protein solution was applied to a cation-exchange column (SP-Sepharose HP at pH 7.5). Protein was eluted from the column with a linear salt gradient, resulting in the elution of either folded OpaB128 or folded OpaJ129 as a single peak. Apparently, due to a difference in affinity, the folded protein Fig. 3. Semi-native PAGE analysis of in vitr o folding of OpaB128 (A) and OpaJ129 (B). (A) Semi-native-PAGE analysis of in vitro folding of unpurified OpaB128 (Coomassie stained). Lane 1 isolated inclusion bodies. Lane 2 in vitro folded protein. Lane 3 denatured protein. Lane 4 and 5, in vitro folded and denatured OpaB after additional purification. Lane 6, molecular mass marker. Samples 2 and 4 were incubated at room temperature in loading buffer containing 0.1% SDS, samples 1, 3 and 5 were incubated at 100 °C in loading buffer containing 2.0% SDS prior to electrophoresis. (B) Semi-native PAGE analysis of in vitro folding of unpurified OpaJ129 (Coomassie stained). Lane 1, isolated inclusion bodies. Lane 2, in vitro folded protein. Lane 3, denatured protein. Samples 1 and 3 were incubated as samples 1, 3 and 5 (Fig. 3A) and sample 2 was treated as sample 2 and 4 (Fig. 3A). (C) Coomassie stained polyacrylamide gel showing in vitro folded OpaJ129, after additional purification. Purified protein samples 1 and 2 were treated as samples 2 and 3 (Fig. 3A), respectively. Ó FEBS 2002 Conformation of meningococcal Opa proteins (Eur. J. Biochem. 269) 5219 was purified from the residual unfolded protein as well as from other contaminants. Analysis of the Opa protein conformation by circular dichroism To test whether the in vitro folded OpaB128 and OpaJ129 had adopted the expected b-sheet conformation, CD spectra were recorded for folded Opa protein and Opa protein that was denatured by boiling in 1.85% SDS. The far-UV spectra revealed a clear difference between the secondary structures of the folded and denatured proteins (Fig. 4A). The charac- teristic feature of the spectrum, recorded for folded OpaB128 was a minimum at 217 nm. Characteristic features of the spectrum, recorded for folded OpaJ129, were a maximum at approximately 232 nm and a minimum at 215 nm. The minimum negative peaks in this range are indicative for the content of b-sheet. The characteristic features of folded OpaB128 and OpaJ129 disappeared upon denaturation, with the minimum shifting to approximately 209 nm and the maximum disappearing. This spectrum suggested the pres- ence of a considerable proportion of a-helix. Apparently, boiling in SDS induces a non-native structure. Near-UV CD permits assessment of the differences between the tertiary structure of folded and denatured OpaJ129. Figure 4B shows that a less pronounced peak at approximately 293 nm characterized the near-UV CD spectrum of folded OpaB128, while folded OpaJ129 was characterized by two peaks at approximately 265 nm and 293 nm. After denaturation, this characteristic feature of the folded OpaJ129 protein changed into a spectrum with a broad positive ellipticity and a maximum at around 270 nm, while the major difference between refolded and denatured OpaB128 was measured between 250 and 265 nm. The differences in the spectra between refolded and denatured Opa protein are indicative for a major structural change after denaturation. Functional analysis of purified refolded and denatured Opa protein In a receptor overlay experiment, equal amounts of refolded anddenaturedOpaJandOpaDwereappliedtonitrocel- lulose and incubated with bacterial lysates containing the CEACAM1-N-A1 domain. Binding of CEACAM1-N-A1 was determined by monoclonal anti-His Ig reacting with the His-tagged CEACAM1-N-A1 protein. Refolded OpaJ129 bound to CEACAM1-N-A1, consistent with the binding experiments with the OpaJ129-expressing E. coli bacteria (Fig. 5). The binding of refolded Opa appeared to be conformation-dependent, as no binding was found with denatured OpaJ129. DISCUSSION The majority of Opa proteins have been shown to speci- fically target members of the CEACAM receptor family [10,26]. How this binding function can be conserved Fig. 4. Far-UV (A) and near-UV (B) circular dichroism spectra of refolded and heat-denatured OpaB128. (A) Far-UV circular dichroism spectra of refolded OpaB128 (interrupted line) and heat-denatured OpaB128 in 1.85% SDS containing buffer (solid line). (1) Far-UV circular dichroism spectra of refolded OpaJ129 (interrupted line) and heat-denatured OpaJ129 in 1.85% SDS containing buffer (solid line) (2). (B) Near-UV circular dichroism spectra of refolded OpaB128 (interrupted line) and heat-denatured OpaB128 in 1.85% SDS containing buffer (solid line). (1) Near-UV circular dichroism spectra of refolded OpaJ129 (interrupted line) and heat-denatured OpaJ129 in 1.85% SDS containing buffer (solid line) (2). 5220 M. I. de Jonge et al.(Eur. J. Biochem. 269) Ó FEBS 2002 despite the hypervariability of the surface-exposed regions of the Opa proteins is still an enigma. The detailed identification of the receptor-binding Opa regions would aid greatly in the development of new vaccines or antimicrobials specifically targeted at blocking this essen- tial adhesion process. The study of the molecular inter- actions between the CEACAM receptors and Opa proteins would be facilitated greatly by the availability of large quantities of pure Opa proteins. This was achieved in the present study for OpaB128 and OpaJ129, two representative Opa proteins present in invasive variants of N. meningitidis strain H44/76. Previously, the isolation and purification of Opa proteins from meningococcal strains has been described [21,27]. However, translation of the constitutively transcribed opa genes depends on the expression status of the individual opa loci, which are subject to high-frequency phase variation [28]. Due to this phase variation it is difficult to express and purify a single individual Opa protein without significant contam- ination from different Opa proteins expressed from other loci. However, for detailed structure–function analysis pure protein is needed and by cytoplasmic expression of OpaB128 and OpaJ129 in E. coli, we were able to isolate highly pure protein, not contaminated with other Opa proteins. In order to determine their binding to CEACAM1, we assessed the binding of surface-expressed OpaB128 and OpaJ129 in an E. coli background to the N-terminus of CEACAM1. CEACAM8 was taken as a negative control because it does not function as an Opa receptor as has been shown for the gonococcal and meningococcal Opa proteins analyzed to date. Both OpaB128 and OpaJ129 bound specifically to the N-terminal domain of CEACAM1. As the majority of Opa proteins recognize this receptor, OpaB128 and OpaJ129 seem to be typical members of this protein adhesin family [10]. OpaB128 as well as OpaJ129 was expressed cytoplasmi- cally in E. coli in the form of inclusion bodies and subsequently refolded and purified. The characteristic heat modifiability of Opa proteins was used to monitor their refolding. Similar to other b-barrel outer membrane proteins such as OmpA (E. coli)andP5(Haemophilus influenzae), this heat-modifiable characteristic of Opa cor- relates with folding into the native structure [29,30]. Both OmpA and P5 are integrated into the membrane as eight- stranded b-barrels [31,32] and the same structure has been predicted for Opa proteins [12,33]. The CD measurements showed a clear difference between the structure of folded Opa and Opa denatured by boiling in SDS. The far-UV spectrum we recorded for folded Opa resembles that of folded OmpA from E. coli [34] and purified P5 from H. influenzae [32]. The spectra are indicative of a high content of b-strands, consistent with the (proposed) structure of these outer membrane proteins (Fig. 4A). The difference between the near-UV CD spectra of folded and denatured Opa supports the conclusion that denatured protein has undergone a major conformational change. In the proposed topology model for Opa proteins, 31% of the amino acid chain is predicted to form a transmembrane b-barrel. The high content of b-strands reflected in the CD spectra reported here suggests that a significant part of the extracellular loops may also adopt this secondary structure. It is thus conceivable that Opa proteins form a more extended b-barrel structure that protrudes from the outer mem- brane into the extracellular space, similar to what was described recently for the OmpT outer membrane prote- ase from E. coli [35]. The pH and the salt concentration are the most critical factors in the folding efficiency of Opa. It appeared that a pH above the calculated pI is needed for efficient folding, as has also been found for the OmpA protein from E. coli and the PorA protein from N. meningitidis [36,37]. The present study demonstrates how two different Opa proteins, with approximately 70% homology, can be folded in vitro under similar conditions. This method will allow us to establish a collection of different Opa proteins, suitable for studying the interactions with CEACAM receptors. In the receptor binding experiments OpaD was used as a positive control, as was also done in similar experiments by Virji et al. [10]. In earlier experiments using only the N-terminus of CEACAM1 we could not find reproducible binding to Opa. However, when the N-A1 domain of CEACAM1 was used instead, it became clear that refolded OpaJ129 is functional in receptor binding. The binding between Opa and CEACAM1 seemed to be conformation- dependent since almost no binding was found with dena- tured Opa protein. To conclude, with our purification and folding proce- dures, we were able to isolate pure and native OpaB128 and OpaJ129, both adhesins binding to the CEACAM1 recep- tor. Conformational analysis of the purified, refolded proteins provided the first experimental evidence for a secondary structure dominated by b-strands, confirming previously proposed topology models. Purified and refolded Opa proteins will be used for detailed structural and functional analysis. ACKNOWLEDGEMENTS We would like to thank F. van der Lecq at the sequencing centre of the Centre for Biomembranes and Lipid Enzymology at Utrecht University for N-terminal protein sequencing. We are grateful to M. Kuroki at the Fukuoka University, for the generous gift of Fig. 5. Binding of native and denatured OpaD and OpaJ to its receptor was determined by immunodotblotting. Ó FEBS 2002 Conformation of meningococcal Opa proteins (Eur. J. Biochem. 269) 5221 cDNA from CEACAM, to M. Achtman at the Max-Planck Institute in Berlin, for the generous gift of purified OpaD and to B. Kuipers at the RIVM in Bilthoven and W. Zollinger at the Walter Reed Army Institute of Research in Washington for providing us with monoclonal antibodies. We also thank W. van Noppen at the University of Amsterdam/AMC for critically reading the manuscript. REFERENCES 1. Swanson, J. (1978) Studies on gonococcus infection. XII. Colony color and opacity variants of gonococci. Infect. Immun. 19,320– 331. 2. Virji, M., Makepeace, K., Ferguson, D.J., Achtman, M. & Moxon, E.R. (1993) Meningococcal Opa and Opc proteins: their role in colonization and invasion of human epithelial and endothelial cells. Mol. Microbiol. 10, 499–510. 3. Belland, R.J., Chen, T., Swanson, J. & Fischer, S.H. (1992) Human neutrophil response to recombinant neisserial Opa proteins. Mol. Microbiol. 6, 1729–1737. 4. Dehio, C., Gray-Owen, S.D. & Meyer, T.F. (1998) The role of neisserial Opa proteins in interactions with host cells. Trends Microbiol. 6, 489–495. 5. Benchimol, S., Fuks, A., Jothy, S., Beauchemin, N., Shirota, K. & Stanners, C.P. (1989) Carcinoembryonic antigen, a human tumor marker, functions as an intercellular adhesion molecule. Cell 57, 327–334. 6. van Putten, J.P. & Paul, S.M. (1995) Binding of syndecan-like cell surface proteoglycan receptors is required for Neisseria gonorrhoeae entry into human mucosal cells. EMBO J. 14, 2144– 2154. 7. Chen, T., Belland, R.J., Wilson, J. & Swanson, J. (1995) Adherence of pilus– Opa+ gonococci to epithelial cells in vitro involves heparan sulfate. J. Exp. Med. 182, 511–517. 8. Muenzner, P., Dehio, C., Fujiwara, T., Achtman, M., Meyer, T.F. & Gray-Owen, S.D. (2000) Carcinoembryonic antigen family receptor specificity of Neisseria meningitidis Opa variants influences adherence to and invasion of proinflammatory cyto- kine-activated endothelial cells. Infect. Immun. 68, 3601–3607. 9. Makino, S., van Putten, J.P. & Meyer, T.F. (1991) Phase variation of the opacity outer membrane protein controls invasion by Neisseria gonorrhoeae into human epithelial cells. EMBO J. 10, 1307–1315. 10. Virji, M., Watt, S.M., Barker, S., Makepeace, K. & Doyonnas, R. (1996) The N-domain of the human CD66a adhesion molecule is a target for Opa proteins of Neisseria meningitidis and Neisseria gonorrhoeae. Mol. Microbiol. 22, 929–939. 11. Billker, O., Popp, A., Gray-Owen, S.D. & Meyer, T.F. (2000) The structural basis of CEACAM-receptor targeting by neisserial Opa proteins. Trends Microbiol. 8, 258–260. 12. Malorny, B., Morelli, G., Kusecek, B., Kolberg, J. & Achtman, M. (1998) Sequence diversity, predicted two-dimensional protein structure, and epitope mapping of neisserial Opa proteins. J. Bacteriol. 180, 1323–1330. 13. Stern, A. & Meyer, T.F. (1987) Common mechanism controlling phase and antigenic variation in pathogenic neisseriae. Mol. Microbiol. 1, 5–12. 14. Studier, F.W. & Moffatt, B.A. (1986) Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. Mol. Biol. 189, 113–130. 15. Agterberg, M., Adriaanse, H. & Tommassen, J. (1987) Use of outer membrane protein PhoE as a carrier for the transport of a foreign antigenic determinant to the cell surface of Escherichia coli K-12. Gene 59, 145–150. 16. Korteland, J., Overbeeke, N., de Graaff, P., Overduin, P. & Lugtenberg, B. (1985) Role of the Arg158 residue of the outer membrane PhoE pore protein of Escherichia coli K12inbacter- iophage TC45 recognition and in channel characteristics. Eur. J. Biochem. 152, 691–697. 17. Reference withdrawn. 18. Wang, J.F., Caugant, D.A., Morelli, G., Koumare, B. & Achtman, M. (1993) Antigenic and epidemiologic properties of the ET-37 complex of Neisseria meningitidis. J. Infect. Dis. 167, 1320–1329. 19. van der Ley, P. & Poolman, J.T. (1992) Construction of a multi- valent meningococcal vaccine strain based on the class 1 outer membrane protein. Infect. Immun. 60, 3156–3161. 20. Bos,M.P.,Kuroki,M.,Krop-Watorek,A.,Hogan,D.&Belland, R.J. (1998) CD66 receptor specificity exhibited by neisserial Opa variants is controlled by protein determinants in CD66 N- domains. Proc. Natl Acad. Sci. USA 95, 9584–9589. 21. Achtman, M., Neibert, M., Crowe, B.A., Strittmatter, W., Kusecek, B., Weyse, E., Walsh, M.J., Slawig, B., Morelli, G. & Moll, A. (1988) Purification and characterization of eight class 5 outer membrane protein variants from a clone of Neisseria meningitidis serogroup A. J. Exp. Med. 168, 507–525. 22. Davies, R.L., Wall, R.A. & Borriello, S.P. (1990) Comparison of methods for the analysis of outer membrane antigens of Neisseria meningitidis by western blotting. J. Immunol. Methods 134,215– 225. 23. Dekker, N., Merck, K., Tommassen, J. & Verheij, H.M. (1995) In vitro folding of Escherichia coli outer-membrane phospholipase A. Eur. J. Biochem. 232, 214–219. 24. deVries,F.P.,VanderEnde,A.,VanPutten,J.P.M.&Dankert, J. (1996) Invasion of primary nasopharyngeal epithelial cells by Neisseria meningitidis is controlled by phase variation of multiple surface antigens. Infect Immun. 64, 2998–3006. 25. Ben-Bassat, A., Bauer, K., Chang, S.Y., Myambo, K., Boosman, A. & Chang, S. (1987) Processing of the initiation methionine from proteins: properties of the Escherichia coli methionine amino- peptidase and its gene structure. J. Bacteriol. 169, 751–757. 26. Bos, M.P., Grunert, F. & Belland, R.J. (1997) Differential recognition of members of the carcinoembryonic antigen family by Opa variants of Neisseria gonorrhoeae. Infect. Immun. 65, 2353–2361. 27. Blake, M.S. & Gotschlich, E.C. (1984) Purification and partial characterization of the opacity-associated proteins of Neisseria gonorrhoeae. J. Exp. Med. 159, 452–462. 28. Stern, A., Brown, M., Nickel, P. & Meyer, T.F. (1986) Opacity genes in Neisseria gonorrhoeae: control of phase and antigenic variation. Cell 47, 61–71. 29. Vogel, H. & Jahnig, F. (1986) Models for the structure of outer-membrane proteins of Escherichia coli derived from raman spectroscopy and prediction methods. J. Mol. Biol. 190, 191–199. 30. Webb, D.C. & Cripps, A.W. (1999) A method for the purification and refolding of a recombinant form of the nontypeable Haemo- philus influenzae P5 outer membrane protein fused to poly- histidine. Protein Expr. Purif. 15, 1–7. 31. Pautsch, A. &Schulz, G.E. (1998) Structure of the outer membrane protein A transmembrane domain. Nat. Struct. Biol. 5, 1013–1017. 32. Webb, D.C. & Cripps, A.W. (1998) Secondary structure and molecular analysis of interstrain variability in the P5 outer- membrane protein of non-typable Haemophilus influenzae isolated from diverse anatomical sites. J. Med. Microbiol. 47, 1059–1067. 33. van der Ley, P. (1988) Three copies of a single protein II- encoding sequence in the genome of Neisseria gonorrhoeae JS3: evidence for gene conversion and gene duplication. Mol. Microbiol. 2, 797–806. 34. Kleinschmidt, J.H., den Blaauwen, T., Driessen, A.J. & Tamm, L.K. (1999) Outer membrane protein A of Escherichia coli inserts and folds into lipid bilayers by a concerted mechanism. Biochemistry 38, 5006–5016. 5222 M. I. de Jonge et al.(Eur. J. Biochem. 269) Ó FEBS 2002 35. Vandeputte-Rutten, L., Kramer, R.A., Kroon, J., Dekker, N., Egmond, M.R. & Gros, P. (2001) Crystal structure of the outer membrane protease OmpT from Escherichia coli suggests a novel catalytic site. EMBO J. 20, 5033–5039. 36. Surrey, T. & Jahnig, F. (1992) Refolding and oriented insertion of a membrane protein into a lipid bilayer. Proc.NatlAcad.Sci.USA 89, 7457–7461. 37. Jansen, C., Wiese, A., Reubsaet, L., Dekker, N., de Cock, H., Seydel, U. & Tommassen, J. (2000) Biochemical and bio- physical characterization of in vitro folded outer membrane porin PorA of Neisseria meningitidis. Biochim. Biophys. Acta 1464, 284–298. Ó FEBS 2002 Conformation of meningococcal Opa proteins (Eur. J. Biochem. 269) 5223 . Conformational analysis of opacity proteins from Neisseria meningitidis Marien I. de Jonge 1,2 , Martine. conformation. In this study, we describe the isolation and structural analysis of opacity proteins OpaJ129 and OpaB128 derived from Neisseria meningitidis strain