Eur J Biochem 271, 1913–1923 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04101.x Identification and expression analysis of an IL-18 homologue and its alternatively spliced form in rainbow trout (Oncorhynchus mykiss) Jun Zou1, Steve Bird1, Jonathan Truckle1, Niels Bols2, Mike Horne3 and Chris Secombes1 Scottish Fish Immunology Research Centre, School of Biological Sciences, University of Aberdeen, UK; 2Department of Biology, University of Waterloo, Ontario, Canada; 3Novartis Aquahealth, Enterprise House, Springkerse Business Park, Stirling, UK A homologue of interleukin 18 has been identified from rainbow trout, Oncorhynchus mykiss The trout IL-18 gene spans 3.7 kb and consists of six exons and five introns, sharing the same gene organization with its human counterpart The putative translated protein is 199 amino acids in length with no predicted signal peptide Analysis of the multiple sequence alignment reveals a conserved ICE cut site, resulting in a mature peptide of 162 amino acids The trout IL-18 shares 41–45% similarity with known IL-18 molecules and contains an IL-1 family signature motif It is constitutively expressed in a wide range of tissues including brain, gill, gut, heart, kidney, liver, muscle, skin and spleen Transcription is not modulated by lipopolysaccharide, poly(I:C) or trout recombinant IL-1b in primary head kidney leucocyte cultures and RTS-11 cells, a macrophage cell line However, expression is downregulated by lipopolysaccharide and rIL-1b in RTG-2 cells, a fibroblast-like cell line An alternatively spliced form of IL-18 mRNA has also been found and translates into a 182 amino acid protein with a 17 amino acid deletion in the precursor region of the authentic form This alternatively spliced form is also widely expressed although much lower than the authentic form Interestingly, its expression is upregulated by lipopolysaccharide and poly(I:C), but is not affected by rIL-1b in RTG-2 cells The present study suggests that alternative splicing may play an important role in regulating IL-18 activities in rainbow trout In the last few years, major advances have occurred in the discovery of fish cytokine genes This has been attributed mainly to the enormous progress made in genome projects for the Fugu and zebrafish genome, and the large increase of fish EST (expressed sequence tag) entries in the Genebank To date, at least a dozen cytokine homologues have been cloned in fish including TGF-b [1], IL-1b [2,3], TNF-a [4–7], IL-10 [8], IL-12 [9], type I interferons [10–12], and several chemokines such as IL-8 [13,14], cIP-10 [15], CK-1 [16] and CK-2 [17] Interleukin (IL) 18, produced mainly by activated macrophages, is an important cytokine with multiple functions in innate and acquired immunity [18–20] One of the primary biological properties is to induce interferon gamma (IFN-c) synthesis in Th1 and NK cells in synergy with IL-12 [21,22] It promotes T and NK cell maturation, activates neutrophils and enhances Fas ligand-mediated cytotoxicity [23–25] IL-18 structurally belongs to the IL-1 family but has low sequence homology with IL-1a, IL-1b and the IL-1 receptor antagonist (IL-Ra) It resembles IL-1b in many ways such as possessing a similar b-trefoil structure and secretion process but has distinct biological functions [18,26] Like IL-1b, it is synthesized as an inactive precursor of approximately 24 kDa and is stored intracellularly Activation and secretion of IL-18 is mainly effected through specific cleavage of the precursor after D35 by caspase 1, also termed IL-1b converting enzyme (ICE), which is believed to be one of the key processes regulating IL-18 bioactivity [27,28] Some other enzymes, including caspase and neutrophil proteinase 3, also cleave the IL-18 precursor to generate active or inactive mature molecules [29,30] A recently identified IL-18 binding protein (IL)18 BP), a specific natural antagonist, inhibits IL-18 activities by competing with the ligand for binding to the IL-18 receptors [31,32] IL-18 expression is also regulated at the gene level In mouse, there are at least two active promoters, one constitutively drives gene expression and the other up-regulates expression in response to stimuli such as lipopolysaccharide (LPS) [33] A nonmammalian IL-18 homologue has been sequenced in birds, sharing approximately 30% amino acid identity with the other characterized mammalian IL-18s [34,35] Recently, a fish IL-18 homologue was identified by analysing the Fugu genome database [36] In contrast to IL-1b where the ICE cut site is absent in most of the nonmammalian species [2], the ICE cut site is well-conserved in the avian and Fugu IL-18s Although native avian IL-18 has Correspondence to C J Secombes, Scottish Fish Immunology Research Centre, School of Biological Sciences, University of Aberdeen, Zoology Building, Tillydrone Avenue, Aberdeen AB24 2TZ, UK Tel.: + 44 1224 272872, Fax: + 44 1224 272396, E-mail: c.secombes@abdn.ac.uk Abbreviations: IL, interleukin; IL-1Ra, interleukin receptor antagonist; ICE: interleukin 1b converting enzyme; IL)18 BP, interleukin 18 binding protein; IFN, interferon; c-IP10, interferon gamma induced protein 10; CK, chemokine; NK, natural killer; Th1, T-helper type 1; CD4, cluster of differentiation antigen 4; EST, expressed sequence tag; LPS, lipopolysaccharide; poly(I:C), polyinosinic-cytidylic acid (Received 12 January 2004, revised March 2004, accepted 22 March 2004) Keywords: interleukin 18; alternative splicing; expression; rainbow trout Ó FEBS 2004 1914 J Zou et al (Eur J Biochem 271) not yet been purified, the bacteria-derived mature peptide of chicken IL-18 has been shown to induce IFN-c synthesis in cultured primary chicken spleen cells [35] More recently, it has been demonstrated that IL-18 promotes proliferation of CD4+ T cells in chicken, suggesting a Th1-like system is operating in birds [37] In the present study, we have identified an IL-18 homologue from rainbow trout, Oncorhynchus mykiss, and investigated where this molecule is expressed In addition, we have discovered an alternative splicing form of the IL-18 mRNA that may have an important role in regulating IL-18 expression and processing in this species, the first report of such a phenomenon for this cytokine Materials and methods Cloning and sequencing of genomic DNA and cDNA All products amplified by PCR were ligated into the pGEM-Teasy vector (Promega) and transformed into TAM competent cells (ActiveMotif, Belgium) Plasmid DNA was purified using a plasmid miniprep kit (Qiagen) and sequenced by MWG-Biotech (Germany) By searching EST databases, several EST clones (BX306040, BX316393, BX298965, BX316008, BX306507, BX311712, BX306039, BX306506, BX311711, BX319716) with homology to mammalian IL-18 protein sequences were retrieved Specific primers (Table 1) were synthesized to obtain the full length cDNA sequence using the RACE– PCR approach Briefly, total RNA was extracted from the rainbow trout RTS-11 cell line (provided by N Bols) [38] stimulated with 20 lgỈmL)1 poly(I:C) (Sigma) for h and reverse-transcribed into cDNA with primer adapter oligo(dT) 3¢-RACE–PCR was performed using primers F1/ ADAP and F2/ADAP to amplify the full length sequence of the coding region and the 3¢-UTR [39] For 5¢-RACE, cDNA was tagged with oligo(dC)n at the 5¢-end with terminal deoxynucleotidyl transferase (Promega) and used as template for seminested PCR amplification with primers oligo-dG/R2 and oligo-dG/R3 [39] The cycling programs for RACE–PCR were cycles of 94 °C for 20 s, 72 °C for min; 32 cycles of 94 °C for 20 s, 62 °C for 20 s, 72 °C for 45 s; followed by cycle of 72 °C for 10 Twenty micolitres of PCR products were loaded on a 1.5% (w/v) agarose gel and visualized by staining the gel in 0.1 lgỈmL)1 ethidium bromide For genomic cloning, rainbow trout tail fin was collected and incubated with DNA lysis buffer (100 mM Tris/Cl pH 8.5, mM EDTA, 0.2% (w/v) SDS, 200 mM NaCl, 100 lgỈmL)1 Proteinase K (Bioline), 20 lgỈmL)1 RNase A) (Sigma) at 52 °C for h The lysate was extracted twice with an equal volume of phenol/chloroform (24 : 1, v/v) and once with chloroform Genomic DNA was precipitated with two volumes of cold ethanol, washed with 70% (v/v) ethanol, and dissolved in TE buffer (10 mM Tris, mM EDTA, pH 8.0) Using genomic DNA as template, PCR was performed to obtain the full length sequence of the IL-18 gene using primers F1 and RR1 and the PCR products sequenced The PCR cycling programs for genomic PCR were cycle of 94 °C for min; 30 cycles of 94 °C for 20 s, 60 °C for 20 s, 72 °C for min; followed by cycle of 72 °C for 10 The PCR products were checked by electrophoresis as described above Sequencing analysis BLAST was used for the identification of homologous sequences in the GenBank databases Multiple alignment was generated using the CLUSTAL W program (version 1.83) [40] A phylogenetic tree was constructed with the PHYLIP package (version 1.1) [41] and visualized using TREEVIEW (version 1.6.6) [42] Direct comparison of two sequences was performed using the GAP analysis program within the Wisconsin Genetics Computer Group Sequence Analysis Software Package (version 10.0) [43] Signal leader peptide prediction was made using the SIGNALP program (version 2.0) [44] RT-PCR studies of IL-18 expression in rainbow trout To determine tissue distribution of IL-18 expression in healthy fish (Almond Bank Fish Farm, Perthshire, Scotland) killed by severance of the spinal cord following anaesthesia, total RNA was extracted from tissues Table Primer sequences and use Primer name Sequence (5¢)3¢) Use Adaptor oligo(dT) ADAP Oligo(dG) F1 GGCCACGCGTCGACTAGTAC(dT)17 GGCCACGCGTCGACTAGTAC GGGGGGIGGGIIGGGIIG GCAATGCGACCGAGTGTCGGAG F2 R2 R3 EF1 EF2 ER1 Actin-F Actin-R RR1 CGACATTTCCGAGTGACGTTC CCTTCAACACCCTGACTTCAC ATGTCCTCCTTGTCTACTACC AGCAGCTCCGAATGTAAGGTG GCTCCGAATTCGAACATGAC AGGCAAAGGTTGCTCCAGTG ATGGAAGATGAAATCGCC TGCCAGATCTTCTCCATG TGGTACCACTCAACATGTCAGTAAGCG 3¢-RACE 5¢-RACE 5¢-RACE 3¢-RACE Gene organization 3¢-RACE 5¢-RACE 5¢-RACE IL-18A expression IL-18B expression IL-18 expression Gene expression Gene expression Gene organization Ó FEBS 2004 Fig Genomic DNA and the deduced protein sequence of rainbow trout IL-18 Exons and introns are indicated in uppercase and lowercase, respectively Intron splicing signal motifs are boxed and the polyadenylation signal (ATTAAA) is underlined The cytokine instability motif (ATTTA) is in bold IL-18 homologue in rainbow trout (Eur J Biochem 271) 1915 Ó FEBS 2004 1916 J Zou et al (Eur J Biochem 271) including brain, gill, gut, heart, kidney, liver, muscle, skin and spleen, using TRIZOL (Invitrogen) according to the manufacturer’s instructions The RNA was then reverse transcribed into cDNA using Bioscript (Bioline) according to the manufacturer’s instructions PCR was performed to detect IL-18A and IL-18B expression using primers EF1/ ER1 and EF2/ER1 in a single PCR reaction Three fish were used in the study The rainbow trout RTS-11 macrophage cell line and RTG-2 cell line were maintained as described previously [38,45] The cells were passaged two days before stimulation with 10 lgỈmL)1 LPS (E.coli 0127:B8, Sigma), 50 lgỈmL)1 poly(I:C) (Sigma), or 100 ngỈmL)1 recombinant trout IL-1b (rIL-1b) [46] for h, the peak time of gene expression for many of the cytokine genes studied in trout to date [5,46] Total RNA was extracted using TRIZOL (Invitrogen) and reverse transcribed into cDNA using Bioscript (Bioline) as described above The sythesized cDNA was checked and titrated by PCR using b-actin primers to ensure equal amount of templates were used for quantitation of gene expression Two pairs of primers, EF1/ER1 and EF2/ER1 were used in a single PCR reaction, to determine the expression level of IL-18A and IL-18B, respectively Five microlitres of cDNA templates was used for a 50 lL PCR reaction The PCR cycling programs for gene expression study were cycle of 94 °C for min; 35 cycles of 94 °C for 20 s, 60 °C for 20 s, 72 °C for 20 s; followed by cycle of 72 °C for 10 Twenty microlitres of PCR products were loaded on a 2.0% (w/v) agarose gel and visualized by staining the gel in 0.1 lgỈmL)1 ethidium bromide The relative levels of mRNA were quantified by densitometric scanning of the ethidium bromide stained gels, using an Ultra Violet Products Ltd gel imaging system and UVP advanced software, and expressed relative to the b-actin transcript level Modulation of IL-18 expression was also studied in trout head kidney leucocytes The head kidney leucocytes from three fish were isolated using a 51% (w/v) percoll gradient as described by Hardie et al [47] Cells were seeded at a density of 2.0 · 106 cells per culture flask in a final volume of 50 mL medium and cultured at 22 °C in L15 medium (Gibco) containing 2% (v/v) fetal bovine serum (Sigma), penicillin (100 lgỈmL)1) (Gibco), and streptomycin (100 unitsỈmL)1) (Gibco) The cells were either unstimulated, stimulated for h with 20 lgỈmL)1 LPS, 100 ngỈmL)1 rIL1b or a combination of 20 lgỈmL)1 LPS and 100 ngỈmL)1 rIL-1b Total RNA was extracted and RT-PCR performed as described previously to determine IL-18 expression Results are shown from two of the three fish investigated GELWORKS ID Results Cloning and sequence analysis By analysing EST databases, several salmon ESTs were found with 25–29% amino acid identity to known IL-18 molecules by BLAST searching Thus, primers were synthesized to obtain the full length cDNA sequence by RACE–PCR using cDNA generated from poly(I:C) stimulated RTS-11 cells Subsequently, the full length sequence of genomic DNA was obtained by PCR using primer F1/RR1 (Fig 1) The trout IL-18 gene spans approximately 3.7 kb and is much smaller than its human counterpart (> 12.7 kb) but larger than that in the pufferfish species (Fig 2) It has a similar genomic organization to the human IL-18 gene, consisting of six exons and five introns The Fig Comparison of the genomic organization of IL-18 and IL-1b genes in human, rainbow trout and the predicted Fugu/tetraodon organization GenBank accession numbers: human IL-18, E17138, Fugu IL-18, AJ548845; tetraodon IL-18, AJ555460 The size of the coding region in the exons is indicated Open boxes represent untranslated regions, whilst closed boxes represent coding regions Ó FEBS 2004 IL-18 homologue in rainbow trout (Eur J Biochem 271) 1917 Fig Multiple alignment of the known IL-18 molecules Conserved residues shared with the putative trout peptide are indicated with a dash (–) and gaps in the alignment are represented with Ô*Õ Conservation of amino acid identity is indicated in the consensus line with Ô*Õ whereas Ô:Õ and Ô.Õ indicate high and low levels of amino acid similarity, respectively Arrows indicate the potential ICE cleavage site (fl) and the potential alternative cleavage site ( ) The 12 b-sheets (solid horizontal bars) and two a-helices (open horizontal bars) in human IL-18 [26] are shown above the alignment The signature sequence is in bold and highlighted GenBank accession numbers of the IL-18 genes are as follows: cow, Q9TU73; dog, Q9XSR0; Fugu, AJ548844; horse, Q9XSQ7; human, Q14116; mouse, P70380; pig, O19073; rat, P97636; chicken, AJ277865; tetraodon, AJ555460 intron sizes of the IL-18 genes differ among species but the size of the coding region within the exons was similar (Fig 2) For example, an extremely small exon (exon in trout), consisting of 12 bp, is present in both the fish and human IL-18 genes The trout IL-18 has a very short 3¢-UTR of 234 bp, containing a single mRNA instability Ó FEBS 2004 1918 J Zou et al (Eur J Biochem 271) Table Protein similarity and features of trout IL-18 with IL-18 from other species Similarity was obtained by direct comparison of two IL-18 precursor sequences using the GAP analysis program The mature peptide for some IL-18 molecules was predicted by the multiple alignments showing the conserved ICE cut site Species Similarity (%) Precursor length (amino acids) Mature peptide length (amino acids) N-terminal amino acid of mature peptide Cow Dog Horse Human Mouse Pig Rat Chicken Fugu Tetraodon Trout 42.0 41.4 45.6 42.1 44.3 42.6 41.5 42.9 40.5 42.4 100 193 193 193 193 192 192 194 198 189 189 199 157 157 157 157 157 157 158 160 158 158 168 H Y Y Y N Y H A G S D motif (ATTTA) shortly after a nonconventional polyadenylation signal sequence (ATTAAA) The deduced trout IL-18 precursor consists of 199 amino acids with no typical signal peptide detected using the SIGNALP prediction program Analysis of multiple alignment demonstrated a well conserved ICE cut site signature (LXXD), generating a 167 amino acid putative mature peptide for the trout IL-18 (Fig 3) Compared to trout IL-1b, as another member of the IL-1 family known in trout, it has a shorter N-terminal precursor region (32 amino acids) The putative trout IL-18 mature peptide is cysteine rich, consisting of seven cysteine residues, more than that in any known mature molecule to date, and lacks any putative N-glycosylation sites An IL-1 family-like signature sequence, NH2-FFMEVIPGTSQYR FQSSLRTSSYLS-COOH, located near the C terminus, is very similar to the IL-1 family like signature, F-X10-F-XS-[ALV]-X2-[AP]-X2-[FYLIV]-[LIV]-X-T [2], and the signature sequence of F-[FY]-X11-13-[FL]-X2-S-[SL]-X4[FY]-L-[SA] appears to be unique for IL-18 as shown in the multiple alignment The trout IL-18 precursor shares 41–46% similarity with the IL-18 proteins from mammals, 42.9% with chicken, 40.5% with Fugu, and 42.4% with tetraodon (Table 2) It has lower similarity with the other members of the IL-1 family; 30–38% with IL-1a, 26–36% with IL-1b and  30% with IL-1Ra (data not shown) To further analyse the relationship of trout IL-18 with the other three members of the IL-1 family, IL-1a, IL-1b, and IL-1Ra, a phylogenetic tree was constructed using the neighbor-joining method, which revealed that the trout IL-18 molecule grouped closely with other known IL-18 s (data not shown), and away from IL-1a, IL-1b and IL-1Ra acids, respectively (termed IL-18A and IL-18B) (Fig 4) The 17 amino acid deletion occurred within the putative 32 amino acid precursor region as shown in the multiple alignment, suggesting the protein may be produced as an intracellular form or processed at a cut site which is present at a location different from the conserved ICE cut site (LXXD) (Fig 3) In fact, further analysis of the primary sequence revealed a region (LVVD) 25 amino acid downstream of the predicted ICE cut site (LESD) which was quite similar to the signature motif for ICE cleavage, suggesting IL-18B could also be cleaved and secreted Alternative splicing Using cDNA generated from the RTS-11 cells as template, PCR with primers F1 and ADAP generated two PCR products of approx 950 bp and 1000 bp Sequence comparison of the two PCR products indicated they were identical except for a 51 nucleotide gap near the 5¢ end, translating two proteins of 199 amino acids and 182 amino Fig Alternative splicing of the IL-18 gene in rainbow trout (A) An alternative mRNA splicing site is present in exon of the trout IL-18 gene Arrows indicate the splicing sites and the boxed letters represent the splicing motif sequences (B) The two transcripts, IL-18A and IL-18B, resulting from the normal and the alternative splicing, and the deduced amino acid sequences Ó FEBS 2004 IL-18 homologue in rainbow trout (Eur J Biochem 271) 1919 Fig Tissue distribution of IL-18 expression in healthy fish The IL-18 mRNA levels were expressed as a ratio relative to b-actin mRNA levels after densitomitric scanning of the gels stained with ethidium bromide The data presented are for a representative experiment of three fish examined Expression studies To determine the tissue distribution of IL-18 expression, RT-PCR was performed using two pairs of primers, EF1/ER1 and EF2/ER1, specifically detecting IL-18A and IL-18B expression in a single tube reaction Figure shows that both IL-18A and IL-18B were globally expressed in all the tissues examined, including brain, gill, gut, heart, kidney, liver, muscle, skin, and spleen, although a lower expression level was observed for IL-18B Higher levels of expression were detected in gut, heart and kidney Modulation of IL-18 expression was studied in primary cultured head kidney leucocytes, macrophages (RTS-11) and fibroblast cells (RTG-2) As shown in Fig 6, both IL-18A and IL-18B were constitutively expressed in the RTS-11 cells (A) and the head kidney leucocytes (C) The transcriptional level was not markedly affected by stimulation with LPS, poly(I:C) or rIL-1b, although a higher expression level was seen for both forms after stimulation of the head kidney leucocytes with the LPS and rIL-1b mixture A higher expression level of IL-18A was seen relative to IL-18B in stimulated and unstimulated head kidney leucocytes and RTS-11 cells, being  2.6 times increased according to the densitometric scanning of the ethidium bromide stained gel In contrast, transcription of IL-18A and IL-18B in the RTG-2 cells was differentially regulated by LPS, poly(I:C) and rIL-1b In the unstimulated RTG-2 cells, both IL-18 transcripts were constitutively synthesized with a higher expression of IL-18A being observed (ratio of IL18A/IL-18B  1.4) as in RTS-11 cells Stimulation with LPS or poly(I:C) inhibited IL-18A expression but enhanced IL-18B transcription, such that IL-18B rather than IL-18A was dominantly expressed after stimulation with LPS (IL-18B/IL-18A  3.0) or poly(I:C) (IL-18B/IL-18A  1.7) rIL-1b decreased expression of IL-18A and to a lesser extent IL-18B mRNA levels, such that again the ratio ( 1.9 times) was in favour of IL-18B Discussion In the present study, we have identified an IL-18 homologue from rainbow trout by analysing the salmonid EST database IL-18 is a member of the IL-1 family including IL-1a, IL-1b, and the IL-1 receptor antagonist (IL-1Ra) Although it has low sequence homology with other members of the family, it contains the IL-1 like family signature and shares a three dimensional b-trefoil structure with IL-1b [26] The identified trout IL-18 has higher (approx 41–46%) homology with other known IL-18 molecules than with the three other IL-1 family members Despite having the same number of exons and introns as the trout IL-1b gene, the trout IL-18 gene resembles IL-18 genes from human, Fugu, and tetraodon, rather than the IL-1b genes, in terms of exon/intron organization, the size of coding exons and the precursor molecules (Fig 2) The relationship between the trout IL-18 with the IL-1 family members is supported further by phylogenetic tree analysis, where the trout IL-18 molecule branched with other known IL-18 molecules (data not shown) Like IL-1b, IL-18 is synthesized as a biologically inactive precursor in the cytoplasm and must be cleaved by ICE to generate the active mature peptide The sequence data of the IL-1b homologues derived from nonmammalian species indicates that the ICE cut site is absent in many nonmammalian species [2] However, a recent study does suggest fish IL-1b is cleaved in macrophages although where it is cleaved and the mechanism involved is still undetermined [46] By analysing the multiple alignment of IL-18 molecules, an ICE cleavage motif (LXXD) conserved from lower vertebrates to mammals is evident (Fig 3), strongly suggesting ICE may be involved in processing of IL-18 in lower vertebrates A stretch of sequence LXXD(74–77; human) similar to the ICE cleavage motif was also seen at a short distance downstream of the LXXD(33–36) motif in some of the IL-18s including human, mouse, rat, Fugu, tetraodon and trout It is possible that this LXXD(74–77) motif could be used as an alternative cut site for ICE or other proteases such as caspase Previous studies in humans demonstrated that IL-18 was cleaved not only by ICE at DY(36–37) to release bioactive mature IL-18 but also by caspase at DS(71–72) and DN(76–77) to generate biologically inactive products [29] This is not surprising because cleavage at such sites leads to proteins lacking the first two b-sheets (Fig 3) In addition, neutrophil proteinase can cleave IL-18 in human epithelial cells, leading to secretion of bioactive IL-18 [30] Interestingly, LVVD(54–57) in trout IL-18 is aligned well with the alternative cut site D76 in the human molecule in the multiple alignment (Fig 3) 1920 J Zou et al (Eur J Biochem 271) Ó FEBS 2004 Fig RT-PCR analysis of IL-18 expression in rainbow trout cell lines and cultured primary head kidney leucocytes The RTS-11 (A), RTG-2 cells (B) and head kidney leucocytes (C) were stimulated with LPS, poly(I:C), rIL-1b or a mixture of LPS and rIL-1b as described in the materials and methods In C, two of the three fish investigated are shown and the average ratio of the IL-18 expression relative to b-actin presented An alternatively spliced transcript of IL-18 was detected by RT-PCR in both RTS-11 and RTG-2 cells This is the first report of an alternative spliced form for IL-18 although several alternative IL-18 proteins were reported recently in human keratinocytes and blood plasma [48,49] As shown in Fig 4, an mRNA splicing signal motif (gtaaag) was present in the coding region of exon 2, resulting in partial deletion of exon However, this deletion did not disrupt protein translation and thus the alternative spliced mRNA remained in-frame and potentially translated into a 182 amino acid protein (IL-18B), 17 amino acids shorter than the above form The 17 amino acid deletion occurs in the precursor region, which may affect the IL-18B cleavage Furthermore, no signal leader peptide was predicted for the Ó FEBS 2004 IL-18 homologue in rainbow trout (Eur J Biochem 271) 1921 IL-18B molecule, excluding the possibility that it could be released through a conventional secretion pathway The two potential protease cut sites, LESD and LVVD, were retained in the IL-18B molecule, with the latter possibly a more likely cut site based on the precursor length which would be similar to that in known IL-18 However, it is also possible that IL-18B could be synthesized as an intracellular form A high level of constitutive expression of IL-18 was observed in all tissues of healthy fish, including brain, gill, gut, heart, kidney, liver, muscle, skin and spleen This is in agreement with studies in mammals showing that IL-18 was constitutively expressed in a wide range of cell types including immune and nonimmune cells and stored as an inactive precursor in the cytoplasm [50] Active IL-18 is secreted only after stimulation with appropriate stimuli and activity is regulated at multiple levels ICE processing of the inactive IL-18 precursor is believed to be crucial in mediating IL-18 secretion at the post-translational level In addition, circulating IL-18 can be antagonized by the IL)18 BP, which competes with the ligand for receptor binding In the trout macrophages and head kidney cells, both the authentic and the alternatively spliced IL-18 were constitutively expressed and not affected by stimulation with LPS, poly(I:C) or rIL-1b, suggesting that IL-18 biological activities might be regulated in a similar way to mammals in such cells Surprisingly, in contrast to the head kidney cells and the RTS-11 cells, differential expression was seen for IL-18A and IL-18B in the RTG-2 cells after stimulation, as seen with LPS and poly(I:C), which significantly enhanced IL-18B expression whilst inhibiting IL-18A expression In mouse, IL-18 expression is controlled by two promoters, one responsible for constitutive expression and one for inducible expression [33] It is possible that synthesis of the two IL-18 transcripts are initiated by two different promoters or regulated by different elements in a single promoter Thus, the present study suggests that IL-18 production is mainly controlled at the post-transcriptional level in trout macrophages whilst in the RTG-2 cells, a fibroblast cell line, transcriptional modulation is also important Why IL-18A and IL-18B are differentially regulated in such a different way in the RTG-2 cells and how this affects IL-18 biological functions will be of interest to pursue further Perhaps, balancing the expression ratio of the two IL-18 forms could be an important mechanism in controlling IL-18 expression or processing Interferon gamma (IFN-c), a Th1-type cytokine, has been speculated to be present in lower vertebrates including fish [51] However, to date, fish IFN-c has not yet been isolated, although some of the associated factors such as the receptors, the regulatory molecules and interferon-induced proteins have been sequenced in fish in recent years [15,52] It is known that IFN-c can be induced by two main cytokines, IL-12 and IL-18 In chicken, the recombinant IL-18 protein has been shown to induce IFN-c production and promote proliferation of CD4+ T cells [37] The homologues for the two subunits of the IL-12 molecule have recently been identified in the Japanese pufferfish [9] All of these studies, together with the finding of the trout IL-18 in the present study, suggest the existence of the IFN-c homologue in fish and perhaps a similar Th1-like network Acknowledgements This work was funded by the Scottish Higher Education Funding Council, a research contract from Novartis Aquahealth and a BBSRC industrial case studentship to JT References Hardie, L.J., Laing, K.J., Daniels, G.D., Grabowski, P.S., Cunningham, C & Secombes, C.J (1998) Isolation of the first piscine transforming growth factor beta gene: analysis reveals tissue specific expression and a potential regulatory sequence in rainbow trout (Oncorhynchus mykiss) Cytokine 10, 555–563 Bird, S., Zou, J., Wang, T., Munday, B., Cunningham, C & Secombes, C.J (2002) Evolution of interleukin-1b Cytokine Growth Factor Rev 13, 483–502 Zou, J., Grabowski, P.S., Cunningham, C & Secombes, C.J (1999) Molecular cloning of interleukin 1b from rainbow trout Oncorhynchus mykiss reveals no evidence of an ice cut site Cytokine 11, 552–560 Bobe, J & Goetz, F.W (2001) Molecular cloning and expression of a TNF receptor and two TNF ligands in the fish ovary Comp Biochem Physiol B Biochem Mol Biol 129, 475–481 Laing, K.J., Wang, T., Zou, J., Holland, J., Hong, S., Bols, N., Hirono, I., Aoki, T & Secombes, C.J (2001) Cloning and expression analysis of rainbow trout Oncorhynchus mykiss tumour necrosis factor-a Eur J Biochem 268, 1315–1322 Zou, J., Wang, T., Hirono, I., Aoki, T., Inagawa, H., Honda, T., Soma, G.I., Ototake, M., Nakanishi, T., Ellis, A.E & Secombes, C.J (2002) Differential expression of two tumor necrosis factor genes in rainbow trout, Oncorhynchus mykiss Dev Comp Immunol 26, 161–172 Zou, J., Secombes, C.J., Long, S., Miller, N., Clem, L.W & Chinchar, V.G (2003) Molecular identification and expression analysis of tumor necrosis factor in channel catfish (Ictalurus punctatus) Dev Comp Immunol 27, 845–858 Zou, J., Clark, M.S & Secombes, C.J (2003) Characterisation, expression and promoter analysis of an interleukin 10 homologue in the puffer fish, Fugu rubripes Immunogenetics 55, 325–335 Yoshiura, Y., Kiryu, I., Fujiwara, A., Suetake, H., Suzuki, Y., Nakanishi, T & Ototake, M (2003) Identification and characterization of Fugu orthologues of mammalian interleukin-12 subunits Immunogenetics 55, 296–306 10 Altmann, S.M., Mellon, M.T., Distel, D.L & Kim, C.H (2003) Molecular and functional analysis of an interferon gene from the zebrafish, Danio rerio J Virol 77, 1992–2002 11 Long, S., Wilson, M., Bengten, E., Bryan, L., Clem, L.W., Miller, N.W & Chinchar, V.G (2004) Identification of a cDNA encoding channel catfish interferon Dev Comp Immunol 28, 97–111 12 Robertsen, B., Bergan, V., Rokenes, T., Larsen, R & Albuquerque, A (2003) Atlantic salmon interferon genes: cloning, sequence analysis, expression, and biological activity J Interferon Cytokine Res 23, 601–612 13 Laing, K.J., Zou, J.J., Wang, T., Bols, N., Hirono, I., Aoki, T & Secombes, C.J (2002) Identification and analysis of an interleukin 8-like molecule in rainbow trout Oncorhynchus mykiss Dev Comp Immunol 26, 433–444 14 Najakshin, A.M., Mechetina, L.V., Alabyev, B.Y & Taranin, A.V (1999) Identification of an IL-8 homolog in lamprey (Lampetra fluviatilis): early evolutionary divergence of chemokines Eur J Immunol 29, 375–382 15 Laing, K.J., Bols, N & Secombes, C.J (2002) A CXC chemokine sequence isolated from the rainbow trout Oncorhynchus mykiss resembles the closely related interferon-gamma-inducible 1922 J Zou et al (Eur J Biochem 271) 16 17 18 19 20 21 22 23 24 25 26 27 28 29 chemokines CXCL9, CXCL10 and CXCL11 Eur Cytokine Netw 13, 462–473 Dixon, B., Shum, B., Adams, E.J., Magor, K.E., Hedrick, R.P., Muir, D.G & Parham, P (1998) CK-1, a putative chemokine of rainbow trout (Oncorhynchus mykiss) Immunol Rev 166, 341–348 Liu, L., Fujiki, K., Dixon, B & Sundick, R.S (2002) Cloning of a novel rainbow trout (Oncorhynchus mykiss) CC chemokine with a fractalkine-like stalk and a TNF decoy receptor using cDNA fragments containing AU-rich elements Cytokine 17, 71–81 Dinarello, C.A & Fantuzzi, G (2003) Interleukin-18 and host defense against infection J Infect Dis 187 (Suppl 2), S370–S384 Gracie, J.A., Robertson, S.E & McInnes, I.B (2003) Interleukin18 J Leukoc Biol 73, 213–224 Sugawara, I (2000) Interleukin-18 (IL-18) and infectious diseases, with special emphasis on diseases induced by intracellular pathogens Microbes Infect 2, 1257–1263 Micallef, M.J., Ohtsuki, T., Kohno, K., Tanabe, F., Ushio, S., Namba, M., Tanimoto, T., Torigoe, K., Fujii, M., Ikeda, M., Fukuda, S & Kurimoto, M (1996) Interferon-gamma-inducing factor enhances T helper cytokine production by stimulated human T cells: synergism with interleukin-12 for interferon-c production Eur J Immunol 26, 1647–1651 Okamura, H., Nagata, K., Komatsu, T., Tanimoto, T., Nukata, Y., Tanabe, F., Akita, K., Torigoe, K., Okura, T & Fukuda, S & (1995) A novel costimulatory factor for gamma interferon induction found in the livers of mice causes endotoxic shock Infect Immun 63, 3966–3972 Dao, T., Mehal, W.Z & Crispe, I.N (1998) IL-18 augments perforin-dependent cytotoxicity of liver NK-T cells J Immunol 161, 2217–2222 Leung, B.P., Culshaw, S., Gracie, J.A., Hunter, D., Canetti, C.A., Campbell, C., Cunha, F., Liew, F.Y & McInnes, I.B (2001) A role for IL-18 in neutrophil activation J Immunol 167, 2879–2886 Xu, D., Trajkovic, V., Hunter, D., Leung, B.P., Schulz, K., Gracie, J.A., McInnes, I.B & Liew, F.Y (2000) IL-18 induces the differentiation of Th1 or Th2 cells depending upon cytokine milieu and genetic background Eur J Immunol 30, 3147–3156 Kato, Z., Jee, J., Shikano, H., Mishima, M., Ohki, I., Ohnishi, H., Li, A., Hashimoto, K., Matsukuma, E., Omoya, K., Yamamoto, Y., Yoneda, T., Hara, T., Kondo, N & Shirakawa, M (2003) The structure and binding mode of interleukin-18 Nat Struct Biol 10, 966–971 Ghayur, T., Banerjee, S., Hugunin, M., Butler, D., Herzog, L., Carter, A., Quintal, L., Sekut, L., Talanian, R., Paskind, M., Wong, W., Kamen, R., Tracey, D & Allen, H (1997) Caspase-1 processes IFN-c-inducing factor and regulates LPS-induced IFN-c production Nature 386, 619–623 Gu, Y., Kuida, K., Tsutsui, H., Ku, G., Hsiao, K., Fleming, M.A., Hayashi, N., Higashino, K., Okamura, H., Nakanishi, K., Kurimoto, M., Tanimoto, T., Flavell, R.A., Sato, V., Harding, M.W., Livingston, D.J & Su, M.S (1997) Activation of interferon-gamma inducing factor mediated by interleukin-1b converting enzyme Science 275, 206–209 Akita, K., Ohtsuki, T., Nukada, Y., Tanimoto, T., Namba, M., Okura, T., Takakura-Yamamoto, R., Torigoe, K., Gu, Y., Su, M.S., Fujii, M., Satoh-Itoh, M., Yamamoto, K., Kohno, K., Ikeda, M & Kurimoto, M (1997) Involvement of caspase-1 and caspase-3 in the production and processing of mature human interleukin 18 in monocytic THP1 cells J Biol Chem 272, 26595–26603 Ó FEBS 2004 30 Sugawara, S., Uehara, A., Nochi, T., Yamaguchi, T., Ueda, H., Sugiyama, A., Hanzawa, K., Kumagai, K., Okamura, H & Takada, H (2001) Neutrophil proteinase 3-mediated induction of bioactive IL-18 secretion by human oral epithelial cells J Immunol 167, 6568–6575 31 Aizawa, Y., Akita, K., Taniai, M., Torigoe, K., Mori, T., Nishida, Y., Ushio, S., Nukada, Y., Tanimoto, T., Ikegami, H., Ikeda, M & Kurimoto, M (1999) Cloning and expression of interleukin-18 binding protein FEBS Lett 445, 338–342 32 Novick, D., Kim, S.H., Fantuzzi, G., Reznikov, L.L., Dinarello, C.A & Rubinstein, M (1999) Interleukin-18 binding protein: a novel modulator of the Th1 cytokine response Immunity 10, 127–136 33 Tone, M., Thompson, S.A., Tone, Y., Fairchild, P.J & Waldmann, H (1997) Regulation of IL-18 (IFN-c-inducing factor) gene expression J Immunol 159, 6156–6163 34 Kaiser, P (2002) Turkey and chicken interleukin-18 (IL18) share high sequence identity, but have different polyadenylation sites in their 3¢ UTR Dev Comp Immunol 26, 681–687 35 Schneider, K., Puehler, F., Baeuerle, D., Elvers, S., Staeheli, P., Kaspers, B & Weining, K.C (2000) cDNA cloning of biologically active chicken interleukin-18 J Interferon Cytokine Res 20, 879–883 36 Bird, S., Zou, J & Secombes, C.J (2003) Takifugu rubripes mRNA for IL-18 precursor Genbank accession no AJ 548844 37 Gobel, T.W., Schneider, K., Schaerer, B., Mejri, I., Puehler, F., Weigend, S., Staeheli, P & Kaspers, B (2003) IL-18 stimulates the proliferation and IFN-gamma release of CD4+ T cells in the chicken: conservation of a Th1-like system in a nonmammalian species J Immunol 171, 1809–1815 38 Ganassin, R.C (1998) Development of a monocyte/macrophagelike cell line, RTS11, from rainbow trout spleen Fish Shellfish Immunol 8, 457–476 39 Bird, S., Wang, T., Zou, J., Cunningham, C & Secombes, C.J (2002) The first cytokine sequence within cartilaginous fish: IL-1 beta in the small spotted catshark (Scyliorhinus canicula) J Immunol 168, 3329–3340 40 Thompson, J.D., Higgins, D.G & Gibson, T.J (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice Nucleic Acids Res 22, 4673–4680 41 Saitou, N & Nei, M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees Mol Biol Evol 4, 406–425 42 Page, R.D (1996) TreeView: an application to display phylogenetic trees on personal computers Comput Appl Biosci 12, 357–358 43 Needleman, S.B & Wunsch, C.D (1970) A general method applicable to the search for similarities in the amino acid sequence of two proteins J Mol Biol 48, 443–453 44 Nielsen, H., Engelbrecht, J., Brunak, S & von Heijne, G (1997) Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites Protein Eng 10, 1–6 45 Wolf, K & Quimby, M.C (1962) Established eurythermic line of fish cells in vitro Science 135, 1065–1066 46 Hong, S., Zou, J., Crampe, M., Peddie, S., Scapigliati, G., Bols, N., Cunningham, C & Secombes, C.J (2001) The production and bioactivity of rainbow trout (Oncorhynchus mykiss) recombinant IL-1b Vet Immunol Immunopathol 81, 1–14 47 Hardie, L.J., Chappell, L.H & Secombes, C.J (1994) Human tumor necrosis factor a influences rainbow trout Oncorhynchus mykiss leucocyte responses Vet Immunol Immunopathol 40, 73–84 Ó FEBS 2004 IL-18 homologue in rainbow trout (Eur J Biochem 271) 1923 48 Koizumi, H., Sato-Matsumura, K.C., Nakamura, H., Shida, K., Kikkawa, S., Matsumoto, M., Toyoshima, K & Seya, T (2001) Distribution of IL-18 and IL-18 receptor in human skin: various forms of IL-18 are produced in keratinocytes Arch Dermatol Res 293, 325–333 49 Shida, K., Shiratori, I., Matsumoto, M., Fukumori, Y., Matsuhisa, A., Kikkawa, S., Tsuji, S., Okamura, H., Toyoshima, K & Seya, T (2001) An alternative form of IL-18 in human blood plasma: complex formation with IgM defined by monoclonal antibodies J Immunol 166, 6671–6679 50 Nakanishi, K., Yoshimoto, T., Tsutsui, H & Okamura, H (2001) Interleukin-18 regulates both Th1 and Th2 responses Annu Rev Immunol 19, 423–474 51 Graham, S & Secombes, C.J (1990) Cellular requirements for lymphokine secretion by rainbow trout Salmo gairdneri leucocytes Dev Comp Immunol 14, 59–68 52 Hansen, J.D & La Patra, S (2002) Induction of the rainbow trout MHC class I pathway during acute IHNV infection Immunogenetics 54, 654–661  ... translating two proteins of 199 amino acids and 182 amino Fig Alternative splicing of the IL-18 gene in rainbow trout (A) An alternative mRNA splicing site is present in exon of the trout IL-18. .. exons and five introns The Fig Comparison of the genomic organization of IL-18 and IL-1b genes in human, rainbow trout and the predicted Fugu/tetraodon organization GenBank accession numbers: human... protein translation and thus the alternative spliced mRNA remained in- frame and potentially translated into a 182 amino acid protein (IL-18B), 17 amino acids shorter than the above form The 17 amino