Substrate and inhibitor specificity of Mycobacterium avium dihydrofolate reductase Ronnie A Bock1,*, Jose L Soulages2 and William W Barrow1 ă Department of Veterinary Pathobiology, Center for Veterinary Health Sciences, Oklahoma State University, Stillwater, OK, USA Department of Biochemistry and Molecular Biology, Noble Research Center, Oklahoma State University, Stillwater, OK, USA Keywords dihydrofolate reductase; mycobacteria; sitedirected mutagenesis; trimethoprim Correspondence W W Barrow, Department of Veterinary Pathobiology, 250 McElroy Hall, Center for Veterinary Health Sciences, Oklahoma State University, Stillwater, OK 74078, USA Fax: +1 405 744 3738 Tel: +1 405 744 1842 E-mail: bill.barrow@okstate.edu Website: http://www.cvhs.okstate.ed *Present address Department of Biology, University of Namibia, Windhoek, Namibia (Received 24 february 2007, revised 22 April 2007, accepted 30 April 2007) doi:10.1111/j.1742-4658.2007.05855.x Dihydrofolate reductase (EC 1.5.1.3) is a key enzyme in the folate biosynthetic pathway Information regarding key residues in the dihydrofolatebinding site of Mycobacterium avium dihydrofolate reductase is lacking On the basis of previous information, Asp31 and Leu32 were selected as residues that are potentially important in interactions with dihydrofolate and antifolates (e.g trimethoprim), respectively Asp31 and Leu32 were modified by site-directed mutagenesis, giving the mutants D31A, D31E, D31Q, D31N and D31L, and L32A, L32F and L32D Mutated proteins were expressed in Escherichia coli BL21(DE3)pLysS and purified using His-Bind resin; functionality was assessed in comparison with the recombinant wild type by a standard enzyme assay, and growth complementation and kinetic parameters were evaluated All Asp31 substitutions affected enzyme function; D31E, D31Q and D31N reduced activity by 80–90%, and D31A and D31L by > 90% All D31 mutants had modified kinetics, ranging from three-fold (D31N) to 283-fold (D31L) increases in Km for dihydrofolate, and 12-fold (D31N) to 223 077-fold (D31L) decreases in kcat ⁄ Km Of the Leu32 substitutions, only L32D caused reduced enzyme activity (67%) and kinetic differences from the wild type (seven-fold increase in Km; 21-fold decrease in kcat ⁄ Km) Only minor variations in the Km for NADPH were observed for all substitutions Whereas the L32F mutant retained similar trimethoprim affinity as the wild type, the L32A mutation resulted in a 12-fold decrease in affinity and the L32D mutation resulted in a seven-fold increase in affinity for trimethoprim These findings support the hypotheses that Asp31 plays a functional role in binding of the substrate and Leu32 plays a functional role in binding of trimethoprim Dihydrofolate reductase (DHFR, EC 1.5.1.3) is found in both prokaryotes and eukaryotes, and is essential in the folate biosynthetic pathway [1] DHFR catalyzes NADPH-dependent reduction of dihydrofolate (FAH2) to tetrahydrofolate (FAH4) (Fig 1) Reduction of FAH2 to FAH4 is a universal requirement for the maintenance of an intracellular reduced folate pool, which is important in one-carbon transfer reactions that are necessary for the biosynthesis of DNA, RNA and protein [2,3] A common bacterial antifolate inhibitor of this enzyme is trimethoprim (TMP) (Fig 2) Previously, we identified the Mycobacterium avium folA gene and confirmed the functionality of its product, DHFR [4] Subsequently, we demonstrated its inherent resistance to TMP [5,6] Further studies revealed a group of 2,4-diamino-5-deazapteridines that Abbreviations DHFR, dihydrofolate reductase; FAH2, dihydrofolate; FAH4, tetrahydrofolate; rDHFR, recombinant dihydrofolate reductase; TMP, trimethoprim 3286 FEBS Journal 274 (2007) 3286–3298 ª 2007 The Authors Journal compilation ª 2007 FEBS R A Bock et al ă Site-directed mutagenesis of M avium DHFR Dihydropteridine Dihydropteroate synthase [2.5.1.15] Dihydropteroate Antifolates: Methotrexate Trimethoprim Deazapteridines Dihydrofolate synthase [6.3.2.12] Dihydrofolate {NADPH + H2Folate NADP+ + H4Folate} Dihydrofolate reductase [1.5.1.3] Tetrahydrofolate Fig FAH4 biosynthesis, including enzymes and EC numbers Examples of common antifolates are given above reaction formulae Thymidylate Nucleic Acids O COOH OH N3 N N H2N N H N H N COOH dihydrofolate NH2 O N3 H2N CH3 O N O Amino Acids CH3 CH3 Trimethoprim Fig Chemical structures of the DHFR substrate FAH2 and the antifolate TMP are effective against M avium because of their activity against M avium DHFR but not human DHFR [6] Continued efforts in the development of better antifolate derivatives in this class will depend upon a better understanding of the M avium DHFR active site In that regard, we have initiated mutagenesis studies to evaluate individual amino acids located in key positions of the DHFR binding site Although a crystal model of M avium DHFR has not been published, one published manuscript is useful for understanding certain molecular aspects of this enzyme Kharkar and Kulkarni developed a homology model of M avium DHFR based on the X-ray crystal structure of M tuberculosis and homology with the M avium DHFR sequence [7] With the use of that model, important amino acids were identified by so-called ‘comparative protein modeling’ or ‘homology modeling’ with the previously published M tuberculosis DHFR crystal structure [8] and analysis of published inhibitor data [7] From Kharkar’s model, it was determined that M avium DHFR has the same general fold that is found in other bacterial DHFRs, namely a central b-sheet flanked by a-helices [7] The authors proposed that structure–function studies using sitedirected mutagenesis would be essential to verify the importance of specific amino acid residues in the binding site, particularly Asp31 and Leu32 [7] The negatively charged Asp31, equivalent to the Asp27 in M tuberculosis DHFR, is a highly conserved amino acid found in most bacterial DHFRs [7] It is located in the substrate-binding site and, on the basis of other bacterial DHFRs, is most likely important in catalysis [7] In Escherichia coli DHFR, the importance of the equivalent position (Asp27) in catalysis has also been suggested [9,10] This was later confirmed by Howell et al using mutagenesis [11] An identical function for this equivalent residue in Lactobacillus casei DHFR (D26) has also been reported [12,13] The negatively charged carboxyl moiety is essential in the hydrogen bonding that takes place between the natural substrate’s 2-amino group and the N3 position in the pteridine ring (Fig 2) This similar interaction takes place with inhibitors whose activity is based FEBS Journal 274 (2007) 3286–3298 ª 2007 The Authors Journal compilation ª 2007 FEBS 3287 Site-directed mutagenesis of M avium DHFR R A Bock et al ă upon a structural resemblance to FAH2 A list of these types of inhibitor would consist of TMP, methotrexate, and 5-deazapteridine derivatives [7], including those described in our previous studies [6,14] Our hypothesis was that modifications of the M avium DHFR at position D31 would substantially affect substrate binding and enzyme efficiency Leu32 is located in a hydrophobic area of the M avium DHFR FAH2-binding site [7] In this position, Leu32 would presumably interact with the end of antifolate inhibitors distal to the pteridine ring (e.g methotrexate and TMP) [7] The Leu32 residue is equivalent to Phe31 and Gln28 in human and M tuberculosis DHFRs, respectively [7] This rationale is also suggested by equivalent residues in two other bacterial DHFRs, those of E coli and L casei [12] We hypothesized that modification of Leu32 in M avium DHFR would affect binding and the IC50 of TMP but not of the normal substrate The site-directed mutants in this study were designed in order to confirm the functional importance of D31 and L32 as substrate-binding, cofactor-binding and inhibitorbinding sites The objectives of this study were to: (a) utilize sitedirected mutagenesis to modify Asp31 and Leu32 residues in the M avium recombinant DHFR (rDHFR); (b) assay the enzyme activity and kinetic parameters of the mutated products; (c) verify the results using complementation with an E coli DHFR-deficient mutant; and (d) obtain IC50 values for TMP with mutated rDHFRs Results Table M avium folA D31 and L32 mutations and primers used to construct them Mutation Primers (5¢- to 3¢) with mutational codon underlined D31E D31Q D31A D31N D31L V76A L32F L32A L32D CGAGGAGCTCACCCGGTTCAAG CGTGCCCGAGCAACTCACCCGGTTC CGAGGCCCTCACCCGGTTCAAAG GCCCGAGAACCTCACCCGGTTCAAAG CGTGCCCGAGCTCCTCACCCGGTTCAAAG CCCGACTTCGCCGCCGAGGGG GCCCGAGGACTTCACCCGGTTC GCCCGAGGACGCCACCCGGTTC GCCCGAGGACGACACCCGGTTC Fig SDS ⁄ 12.5% polyacrylamide gel showing steps involved in the purification of M avium rDHFR Lane contains Novagen Perfect protein markers (sizes in kDa are indicated on the left of the figure) Lane contains precolumn protein extract Lane contains flow-through Lane contains wash with mM imidazole Lane contains wash with 40 mM imidazole Lanes 6–13 contain purified rDHFR that eluted in successive fractions from 150 to 300 mM imidazole These fractions all showed activity in the standard DHFR assay described in Experimental procedures Similar results were obtained with the mutated rDHFRs Mutagenesis Sequencing data showed that the GeneEditor mutagenesis protocol used to construct the M avium DHFR mutants was highly efficient Efficiencies of 80% and higher were achieved The mutagenic oligonucleotides are listed in Table Protein expression and purification His-Bind resin was used to recover recombinant wildtype and mutant M avium DHFR from the soluble fraction of a cell extract under nondenaturing conditions In this semi-automated process, His-Bind resin columns were loaded and washed manually and by gravity flow until the eluate showed no significant reading at 280 nm The automated elution of the HisBind resin-bound protein through a 5–500 mm imidazole linear gradient is shown in Fig for the wild-type 3288 rDHFR The flow-through fraction (Fig 3, lane 3) shows that most DHFR was bound to the resin The bound protein eluted between 150 and 300 mm imidazole (Fig 3) The elution profiles for the recombinant wild-type and mutant DHFR were consistent and similar The percentage yield of active enzyme was 34% This corresponds to an increase in purification of between 10-fold and 14-fold CD Figure shows the far-UV CD spectra of wild-type DHFR and some of the mutants used in this study Consistent with the a ⁄ b-sheet motif, the spectra of the proteins show a minimum at 215 nm and become positive below 200 nm The fractions of four structural components (a-helix, b-sheet, b-turns and unordered) FEBS Journal 274 (2007) 3286–3298 ª 2007 The Authors Journal compilation ª 2007 FEBS R A Bock et al ă Site-directed mutagenesis of M avium DHFR residues to the peptide CD spectrum [17] Because the spectroscopic properties of the multiple Trp residues of DHFR have also been shown to be sensitive to several mutations, the spectra and estimates of secondary structure of the mutants could be affected by the properties of the Trp residues Despite this consideration, overall, the CD data suggest that the mutants retained the a-helix ⁄ b-sheet motif that characterizes DHFR Asp31 mutations Fig Far-UV CD spectra of DHFR wild type and mutants Spectra were acquired in 20 mM sodium phosphate, 100 mM NaCl (pH 7.4) at 25 °C With exception of the spectrum for the L32D mutant, which was obtained from a single protein sample, the spectra shown represent the average obtained from at least two independent protein preparations Protein names and corresponding symbols are indicated were estimated by the ‘self-consistent’ method (selcon3) according to Sreerama et al [15] These estimates are shown in Table The inferred secondary structure of wild-type M avium DHFR is consistent with the crystal structures of the homologous DHFRs from M tuberculosis [8] and E coli [16], whose structures comprise eight b-strands and four a-helices The structural information obtained by CD spectroscopy is also consistent with the homology model of M avium [7] The deduced secondary structure of the mutants (Table 2) suggests that the mutations did not promote significant structural changes in the secondary structure of the protein Even though the estimated structures of the mutants D31Q and L32D not differ significantly from the structure of the wild-type protein, their CD spectra show some differences from the spectra of the other proteins We not know the reason for these spectral differences Previous studies with DHFR mutants have shown a contribution of the Trp Table Secondary structure of DHFR wild type (WT) and mutants The fractions of different structural components were calculated from the CD spectra using the program SELCON3 a-Helix WT D31A D31E D31L D31N D31Q L32D b-Sheet b-Turn Unordered Sum 0.20 0.20 0.20 0.19 0.15 0.21 0.16 0.38 0.38 0.35 0.28 0.30 0.38 0.36 0.17 0.17 0.15 0.22 0.23 0.20 0.17 0.25 0.25 0.22 0.31 0.31 0.20 0.25 1.00 1.00 0.92 1.00 0.99 0.99 0.93 His-Bind resin eluted fractions were assayed for enzyme activity in an in vitro enzyme assay, and the results show a significant reduction in enzyme activity for all the Asp31 mutants assayed, D31A, D31E, D31Q, D31N and D31L Table shows that although these mutant M avium rDHFRs still displayed functionality, the activity was significantly reduced The D31A and D31L mutants showed a reduction in enzyme activity of over 90%, and the D31E, D31Q and D31N mutants showed reductions of 81.1%, 85.3% and 84.6%, respectively, as compared to the wild-type M avium rDHFR (Table 3) However, the negative control mutant V76A did not show a reduction in activity as compared to the wild-type rDHFR (Table 3) Using the sas statistical software, Dunnett’s test shows (at significance level a ¼ 0.05) that with the exception of the control mutant V76A, the enzyme specific activities of all Asp31 mutants were significantly different from that of the wild-type rDHFR (p807) (Table 3) The control mutant V76A, which has a modification outside the enzyme’s active site, still had a specific activity that amounted to 99% of that of the wild-type rDHFR and was therefore statistically not different (Table 3) Leu32 mutations In contrast to the Asp31 substitutions, only one of the Leu32 substitutions caused a significant change in the enzyme’s specific activity as compared to the wild-type rDHFR (Table 3) Neither the L32F nor the L32A substitution affected the enzyme’s interaction with FAH2 In comparison to the wild-type rDHFR, the L32F mutant had a slightly higher relative specific activity (103%), showing that, statistically (Dunnett’s test P ¼ 0.759 at a ¼ 0.05), this mutant was not different from the wild-type rDHFR (Table 3) The L32A mutant of the M avium DHFR still had 96% of the specific activity of the wild-type rDHFR, and was therefore statistically not different from the wild-type rDHFR (Dunnett’s test P ¼ 0.742 at a ¼ 0.05) The FEBS Journal 274 (2007) 3286–3298 ª 2007 The Authors Journal compilation ª 2007 FEBS 3289 Site-directed mutagenesis of M avium DHFR R A Bock et al ă Table Comparison of enzyme activity of wild-type rDHFR (p807) with those of the D31, V76 and L32 mutated DHFRs Assays were performed in triplicate, and results were evaluated statistically using the Dunnett post-test P-values are given for significance level a ¼ 0.05 DHFR Specific activity (lmolỈmin)1Ỉmg)1) Percentage relative specific activity Percentage decrease in specific activity over wild type P p807 D31A D31E D31Q D31N D31L V76A L32F L32A L32D 15.4 1.05 2.91 2.26 2.37 0.060 15.2 16 14.7 5.09 100 6.82 18.9 14.7 15.4 0.39 98.7 103 96 33 – 93 81 85 85 99.6 1.3 – 67 – 0.0001 0.0001 0.0001 0.0001 0.0001 0.914 0.759 0.742 < 0.0001 L32D substitution was the only one in this series that had a negative impact on the mutant enzyme’s activity The L32D mutant had a 67% reduction in its specific activity as compared to the wild-type rDHFR, and was therefore statistically different from the wild-type rDHFR (Dunnett’s test P < 0.0001 at a ¼ 0.05) Kinetic characteristics of Asp31 mutations The kinetic parameters Km and Vmax for FAH2 and NADPH of the wild-type M avium rDHFR (p807) and the Asp31 mutants were determined with the nonlinear Michaelis–Menten curve-fitting program (Table 4) The D31A and D31L mutants show the greatest changes in kinetic characteristics as compared to the wild-type rDHFR (p807) The Km (FAH2) was 37 lm for the D31A mutant and 198 lm for the D31L < < < < < mutant, as compared to 0.70 lm for p807 This corresponds to a 51-fold increase for the D31A mutant and a 283-fold increase for the D31L mutant The Km (FAH2) values for the D31E, D31Q and D31N mutants were 1.92, 2.32 and 2.08 lm, respectively; a moderate increase of 2–2.5-fold over p807 The D31E mutant showed a slight increase in Km (NADPH) over the wild type In contrast to the Km (FAH2), which showed a 283-fold increase, the Km (NADPH) of 1.44 lm for the D31L mutant was not too different from that of the wild type The D31A, D31Q and D31L mutants had the lowest kcat ⁄ Km (FAH2) values: 2.3 · 104, 65 · 104 and 0.013 · 104 m)1Ỉs)1, respectively The values for the D31E and D31N mutants were very similar, at 187 · 104 and 240 · 104 m)1Ỉs)1, respectively (Table 4) The Km (NADPH) for the D31A mutant of 0.68 lm was similar to the values for Table Kinetic parameters at pH 7.0 and 30 °C of recombinant wild-type p807 vs the D31, V76 and L32 mutants of M avium DHFR for FAH2 and NADPH, determined with the nonlinear Michaelis–Menten curve-fitting program ENZFITTER Each mutant was assayed in triplicate with at least 10 different substrate concentrations The results are expressed as the mean ± SEM The molecular mass of DHFR used in the calculation of the kcat values was 20 000 Da NADPH FAH2 DHFR p807 D31A D31E D31Q D31N D31L V76A L32F L32A L32D 0.7 37 1.92 2.32 2.08 198 0.78 0.68 0.96 5.12 kcat (s)1) Km (lM) 3290 ± ± ± ± ± ± ± ± ± ± 0.034 1.68 0.092 0.085 0.100 5.53 0.033 0.047 0.046 0.252 kcat ⁄ Km (· 104 M)1Ỉs)1) Km (lM) 20.5 0.86 3.58 1.5 5.03 0.025 18.7 21 16.2 7.2 2900 2.3 187 65 240 0.013 2400 3090 1690 141 1.55 0.68 2.01 0.65 0.77 1.44 1.56 1.32 1.39 0.84 kcat (s)1) ± ± ± ± ± ± ± ± ± ± 0.0465 0.0269 0.0953 0.0288 0.0321 0.067 0.065 0.056 0.0551 0.040 kcat ⁄ Km (· 104 M)1Ỉs)1) 26.8 0.59 2.05 2.18 8.50 0.02 23.7 23.2 17.8 10 1730 38 102 335 1100 1.39 1520 1760 1280 1190 FEBS Journal 274 (2007) 3286–3298 ª 2007 The Authors Journal compilation ª 2007 FEBS R A Bock et al ¨ Kinetic characteristics of Leu32 mutants The kinetic parameters Km and Vmax for FAH2 and NADPH were also determined at pH 7.0 and 30 °C, and are listed in Table for the wild type and the Leu32 mutants of M avium DHFR The L32F and L32A mutants were not very different from the wild type in Km (FAH2) values The Km (FAH2) of the wild type was 0.7 lm, whereas that of the L32F mutant was 0.68 lm The L32A mutant had a slightly higher Km (FAH2) of 0.96 lm With a Km (FAH2) of 5.12 lm, the L32D mutant had a seven-fold increase in Km (FAH2) over the wild type The L32F and L32A mutants were also not much different from the wild type in their Vmax (FAH2) values (not shown) The wild type had a Vmax (FAH2) of 61.1 lmolỈmin)1Ỉmg)1, whereas the L32F and L32A mutants had a Vmax (FAH2) of 63.3 and 55.2 lmolỈ min)1Ỉmg)1, respectively The kcat ⁄ Km (FAH2) of the L32F mutant was slightly higher than that of the wild type The kcat ⁄ Km (FAH2) of the L32F mutant was 3090 · 104 m)1Ỉs)1, whereas that of the wild type was 2900 · 104 m)1Ỉs)1 (Table 4) The L32A mutant had a lower kcat ⁄ Km (FAH2) as compared to the wild type At 1690 · 104 m)1Ỉs)1, this mutant’s kcat ⁄ Km (FAH2) value was almost 1.5-fold lower than that of the wild type (Table 4) On the other hand, the L32D mutant had a kcat ⁄ Km (FAH2) value of 141 · 104 m)1Ỉs)1, which was almost 21-fold lower than that of the wild type (Table 4) The wild-type M avium DHFR and the L32F and L32A mutants were also similar with respect to NADPH binding The wild type had a Km (NADPH) of 1.55 lm, whereas the Km values of the L32F and L32A mutants were 1.32 and 1.39 lm, respectively (Table 4) The Km (NADPH) of the L32D mutant was 0.84 lm, and therefore almost two-fold lower than that of the wild type The wild type and the L32F and L32A mutants had Vmax (NADPH) values of 80, 69.6 and 53.5 lmolỈmin)1Ỉmg)1, respectively (Table 4), whereas Vmax (NADPH) of the L32D mutant was 30.1 lmolỈmin)1Ỉmg)1 Growth complementation The DHFR-deficient E coli strain MG1655folA::kan3 (MH831) [40] was transformed with plasmid pET15b containing the wild-type M avium DHFR (MH831 + p807), the DHFR Asp31 mutant forms (p807D31, p807D31A, p807D31E, p807D31Q, p807D31N, and p807D31L), or the mutation control V76A (p807V76A) and the Leu32 mutant forms (p807L32F, p807L32A, and p807L32D) In addition, the DHFRdeficient strain was also transformed with pET15b that did not contain the M avium DHFR gene insert (folA–pET15b) as a vector control MH831 is unable to grow in the absence of thymidine [40] All of the substitutions within the plasmid-borne M avium DHFR enabled growth of MH831 that was comparable to that of the parent strain MG1655, in the presence of thymidine (data not shown) However, in the absence of thymidine, the DHFR-deficient MH831 did not grow, and none of the p807 Asp31 DHFR mutants was able to restore growth by complementation (Fig 5) Only the wild-type M avium DHFR (p807) and the control DHFR mutant p807V76A restored growth of MH831 to levels comparable to that of the E coli MG1655 parent strain (Fig 5) The DHFR-deficient strain that was transformed with pET15b vector control also did not show growth complementation in the absence of thymidine (data not shown) The L32 mutations of the M avium DHFR were able to complement the DHFR-deficient E coli strain and restore growth to levels comparable to that of its parent strain, E coli MG1655, even in the absence of 2.5 MG1655 MH831 + p807 MH831 + p807V76A 2.0 MH831 + p807L32F MH831 + p807L32A MH831 + p807L32D 1.5 D 600 the D31Q and D31N mutants The data indicate that the control mutation V76A did not affect the Km for FAH2 or NADPH (Table 4) The V76A mutant had a Km (FAH2) of 0.78 lm, as compared to 0.7 lm of the wild type, and a Km (NADPH) of 1.56 lm, as compared to 1.55 lm of the wild type Site-directed mutagenesis of M avium DHFR 1.0 0.5 0.0 Time (h) Fig Example of growth curve of DHFR-deficient E coli strain MH831, transformed with wild-type M avium DHFR p807 (MH831 + p807), various recombinant mutated M avium DHFRs, the Leu32 mutants, the control mutant V76A, and the MH831 parent strain MG1655 All strains grew in the presence of thymidine (data not shown) Only the strains plotted in the figure grew in the absence of thymidine FEBS Journal 274 (2007) 3286–3298 ª 2007 The Authors Journal compilation ª 2007 FEBS 3291 Site-directed mutagenesis of M avium DHFR R A Bock et al ă Table IC50 of TMP for recombinant wild-type and Leu32 mutants of M avium DHFR as determined by the four-parameter curve procedure (Bio-TEK enzyme software) Assays were done in triplicate Results are shown as the mean ± SEM IC50 (nM) DHFR TMP Wild type L32F L32A L32D 3900 3600 45 000 570 ± ± ± ± 425 143 3406 68 thymidine (Fig 5) However, in the absence of thymidine, a five-fold reduction in growth was observed with the L32D mutant, and a reduction of growth with the L32A mutant was also observed to a lesser degree (Fig 5) IC50 assay The IC50 values of the wild-type rDHFR and the L32F mutant of M avium DHFR for TMP were very similar, at 3900 nm and 3600 nm, respectively (Table 5) The IC50 value of 45 000 nm for the L32A mutant for TMP, however, was about 12-fold higher than that of the wild-type rDHFR (Table 5) On the other hand, the L32D mutant’s IC50 value for TMP was 570 nm, which was about seven-fold lower than that of the wild-type rDHFR (Table 5) Discussion Site-directed mutagenesis has previously been used to investigate the role of the highly conserved active site carboxylic acid residue in catalysis and binding of FAH2 in E coli, L casei and a few other species [1,11,18–22] Various studies have also investigated hydrophobic interactions within the binding cavity This is the first study that has assessed the important functional role of the highly conserved D31 and conserved L32 residues in M avium, or equivalent residues in any other mycobacterial DHFR In this study, all mutations of Asp31 (D31) affected the M avium DHFR, causing significant reductions in the enzyme’s interaction with FAH2 The V76A substitution, theorized to be outside of the binding cavity, did not cause a change in the enzyme’s specific activity or kinetics as compared to the wild-type rDHFR This control validated the mutation procedure The D31A substitution removed the side chain and charge at that position, thus resulting in a reduction of specific activity by almost 95% This is consistent with 3292 this residue’s role in other DHFRs described thus far, and a reflection of its strictly conserved status for all DHFRs [1,8,11,23–30] This severe decrease in enzyme functionality is also reflected in the kinetics The kcat ⁄ Km (FAH2) decrease over the wild-type rDHFR for the D31A mutant was over 1200-fold The D31E substitution with the carboxylic acid group of the wild type caused a reduction in specific activity of 80%, suggesting that the larger side chain (i.e methylene group) has a negative effect on interactions within the binding cavity Like the M avium D31E mutant in this study, David et al [31] found that a D27E mutated E coli DHFR was 17-fold less efficient than the wild type The D31N and D31L mutants both have a side chain size of similar size to the wild-type rDHFR’s aspartic acid However, although the D31N side chain is not charged, it is nonetheless polar The D31L side chain is not charged and is nonpolar The D31N mutant showed  85% reduction in specific activity over the wild type, therefore behaving similarly to the D31E mutant Howell et al [11] reported a D26N substitution of E coli DHFR that severely affects enzyme function That mutated enzyme had < 1% of the specific activity of the wild type, and severely altered kinetics [11] Basran et al [32] reported that a D26N substitution of L casei resulted in a smaller reduction of the enzyme’s functionality as compared to an equivalent substitution in E coli DHFR [32] The L casei D26N DHFR had a decrease in kcat (FAH2) of nine-fold, compared to 300-fold in E coli, and a decrease in kcat ⁄ Km (FAH2) of 13-fold, compared to 11 000-fold in E coli [11,32] The equivalent substitution in M avium DHFR (D31N) has effects that resemble those for L casei DHFR more than those for E coli DHFR The M avium D31N DHFR had a four-fold decrease in kcat (FAH2) and a 12-fold decrease in kcat ⁄ Km (FAH2) These studies indicate that the asparagine substitution in this position affects the enzyme’s activity in M avium, E coli and L casei The D31L mutant of M avium DHFR had < 1% of the wild-type rDHFR’s activity The very low specific activity of the D31L mutant was also reflected in the mutant’s kinetic behavior David et al [31] found a D27L mutant of E coli DHFR to be similarly dysfunctional This substitution is similar in side chain size to the wild-type rDHFR’s aspartic acid, but has no charge and is nonpolar It is the most severe change of all the D31 substitutions, suggesting that the increased hydrophobicity had more severe negative effects than the loss of the charge alone The D31Q substitution in M avium DHFR, which is also one methylene group larger than the FEBS Journal 274 (2007) 3286–3298 ª 2007 The Authors Journal compilation ê 2007 FEBS R A Bock et al ă residue in the recombinant wild-type enzyme and has the same size as the D31E substitution, did not have the charge associated with the carboxylic acid group This mutant also showed a reduction in specific activity of > 80%, or about the same as the reductions seen for the D31E and D31N mutants The kcat ⁄ Km (FAH2) for the D31Q mutant was decreased by 45-fold in comparison to the wild-type rDHFR, as compared to 16fold and 12-fold reductions for the D31E and D31N mutants, respectively (Table 4) No previous studies with this type of substitution have been performed The Km (NADPH) values of all D31 mutants were slightly reduced in comparison to those of the wildtype rDHFR However, this reduction did not vary greatly among the D31 mutants, for which the values ranged from 0.65 to 0.77 lm, representing about a two-fold reduction as compared to the wild type Dunn et al [20] and Appleman et al [18] found that replacement of the conserved D27 in E coli reduced the affinity of NADPH by seven-fold and three-fold, respectively Although this conserved aspartic acid residue is not directly involved in NADPH binding, they argued that the increased rate of dissociation in the mutants, as well as a shift in the equilibrium that favors nonbinding, could be responsible for changes in NADPH affinity On the basis of the Km (NADPH) for all D31 mutants in this study, the effects of the substitutions on binding of NADPH seem to be minimal in comparison to the effects on binding of FAH2 From these results, it is evident that replacement of Asp31, regardless of the substitution, severely affects M avium DHFR function This is further supported by the fact that none of the D31 mutants was able to restore growth to the DHFR-deficient E coli Only the wild-type M avium rDHFR and the recombinant V76A mutant were able to restore MH831 growth to levels comparable to that of the MG1655 parent strain We can conclude that Asp31 has an important functional role in catalysis in M avium DHFR, and that it is unlikely that any substitution at this site would result in a functional enzyme As in all DHFRs [21,23,33–36], the conserved Leu32 is one of several hydrophobic residues that line the M avium DHFR binding cavity Unlike D31, which is only substituted by glutamic acid in vertebrates, L32 is also replaced by glutamine in some bacteria, whereas vertebrates have either a phenylalanine or a tyrosine in this position [35] In contrast to the D31 substitutions, only one of the L substitutions L32D caused a significant change in the enzyme’s normal reaction with FAH2 These results indicate that L32 is not directly involved in catalysis; this was also indicated by the mutant’s kinetic behavior The kinetics of the L32F and Site-directed mutagenesis of M avium DHFR L32A mutants were similar to those of the wild type for both FAH2 and NADPH, whereas the L32D mutant showed a 21-fold decrease in kcat ⁄ Km (FAH2) Equivalent substitutions in E coli, mouse and human rDHFRs not give similar results [37–39] E coli DHFR has no increased catalytic efficiency resulting from an L28F substitution [38], and no change in kinetics resulting from an L28Y substitution [37] Whereas this study did not find a change in the activity of the L32A mutant as compared to the wild-type M avium rDHFR, Chunduru et al [39] found that an equivalent substitution (F31A) in human DHFR caused a four-fold higher Km (FAH2) and a four-fold reduced kcat ⁄ Km No prior information regarding an L32D substitution was found in literature searches However, the introduction of a charged group with the aspartic acid substitution may have adverse effects on interactions in the binding cavity Baccanari et al [9] found two E coli (RT500) DHFR isozymes, one of which had L28, and the other of which had R28 They argued that interaction between R28 and the conserved D27 probably led to reduced efficiency It is possible that the same could occur with the L32D substitution in the M avium DHFR The L32F substitution did not change the affinity for TMP (Table 5) This is consistent with findings that an equivalent substitution in human rDHFR does not alter the affinity for TMP [35] The L32A substitution removed the hydrophobic residue from this position, which may have caused a change in local hydrophobicity X-ray crystal structures have shown that the equivalent hydrophobic residue in E coli and L casei DHFR is in contact with inhibitors In their proposed model of the M avium DHFR, Kharkar & Kulkarni [7] also point to the role of L32 interacting with inhibitors The current finding supports this conjecture for M avium DHFR The decrease in TMP affinity caused by the M avium L32A substitution was also observed with the equivalent substitution (F31A) in human DHFR [39] The L32D substitution in M avium DHFR resulted in a seven-fold increase in the affinity for TMP (Table 5) An introduction of the charge associated with aspartic acid seems to stabilize TMP but not FAH2 In the X-ray crystal structures of L casei and E coli DHFR, the p-aminobenzoic acid ring of folate is closely aligned with L27 and L28, respectively [10,13] Kharkar et al [7] proposed the same for L32 in M avium DHFR The L32D substitution in M avium did not only remove the hydrophobic residue that stabilized FAH2, but also introduced a charge that may destabilize FAH2 in the binding cavity Structurally, TMP does not have the hydrophobic ring of FAH2; it does have methoxy groups that might interact with aspartic acid to stabilize the inhibitor FEBS Journal 274 (2007) 3286–3298 ª 2007 The Authors Journal compilation ª 2007 FEBS 3293 Site-directed mutagenesis of M avium DHFR R A Bock et al ă The results of this study are consistent with what is currently known about the highly conserved binding cavity aspartic acid residue in E coli, L casei and other DHFRs It is apparent that Asp31 in M avium DHFR plays a functional role in catalysis Modifications in size (D31E), size and charge (D31A and D31Q) and charge (D31N and D31L) result in a significant reduction of normal enzyme activity, primarily by affecting the binding of FAH2 In addition, the results of this study also support the hypothesis that L32 plays a more functional role in the binding of antifolate inhibitors such as TMP, as opposed to FAH2 It has been shown that certain modifications of L32 in M avium DHFR can affect the affinity of the enzyme for TMP, a drug to which the organism is naturally resistant Whereas an L32F substitution has no effect on affinity, an L32A substitution decreases the affinity for TMP, and an L32D substitution increases the affinity for the antifolate Further studies are underway to determine the effect of these and other mutations on the binding of other antifolates Large-scale protein expression and purification of wild-type and mutant DHFR Experimental procedures Bacterial strains The bacterial strains were E coli JM109 (Promega, Madison, WI, USA), E coli BL21(DE3)pLysS (Promega), E coli BMH71-18mutS (Promega), and E coli MG1655 and MH831 (MG1655folA::kan3) MG1655 and MH831 were gifts from M Herrington (Department of Biology, Concordia University, Montreal, Canada) [40] M avium rDHFR As described previously, the M avium folA gene (accession number AF006616) was cloned into the vector pET15b at the NdeI and BamHI restriction sites (plasmid construct p807), and expressed in E coli strain BL21(DE3)pLysS as a fusion protein containing an N-terminal His-tagged leader sequence [4] Functionality has been confirmed using a standard DHFR assay [4] Site-directed mutagenesis The p807 plasmid construct of the M avium folA gene was used as template DNA for oligonucleotide-based sitedirected mutagenesis of Asp31 and Leu32, as well as the control mutation Val76, using the GeneEditor Protocol Kit (Promega) Mutagenic oligonucleotides were designed in accordance with the Promega GeneEditor Kit recommendations (Promega TM 047), and were obtained from 3294 Integrated DNA Technologies (Coralville, IA, USA) (Table 1) The mutagenesis reaction was accomplished with the Promega GeneEditor Kit protocol, using the kit’s selection oligonucleotide Top Strand For each mutation reaction, at least five isolated colonies were selected and grown separately overnight in 10 mL of LB broth with 100 lgỈmL)1 carbenicillin and 50 lL of GeneEditor Antibiotic Selection Mix in a shaking incubator at 37 °C and 225 r.p.m (12–14 h) Cells were harvested by centrifugation at °C and maximum speed 2135 g for 10 (Sorval RTH-250 rotor) Plasmid DNA was extracted using the Wizard Plus SV miniprep DNA purification system (Promega) The plasmid DNA concentration was determined in a Gene Quant proRNA ⁄ DNA calculator (Amersham Biosciences, Piscataway, NJ, USA), using quartz microcapillaries Mutations were confirmed by sequencing the full length of the folA gene insert of the pET15b vector using T7 forward primers Sequencing was performed at either the Recombinant DNA ⁄ Protein Resource Facility of Oklahoma State University (Stillwater, OK, USA) or at the Oklahoma Medical Research Foundation (Oklahoma City, OK, USA) High Efficiency BL21(DE3)pLysS competent cells (Promega) were transformed with p807 with and without altered DHFR according to the manufacturer’s instructions, and plated on LB agar (Difco, Lawrence, KS, USA) containing 100 lgỈmL)1 carbenicillin and 34 lgỈmL)1 chloramphenicol Plates were incubated overnight at 37 °C Transformants were grown overnight in 10 mL of LB broth containing the appropriate antibiotics Cells were then centrifuged at maximum speed (2135 g) [Sorval RTH-250 rotor, RT-7R centrifuge, Sorval (Thermo Fisher Scientific, Waltham, MA, USA)] at °C for 10 min, and resuspended in 10 mL of fresh LB medium with 100 lgỈmL)1 carbenicillin and 34 lgỈmL)1 chloramphenicol Each overnight culture was used to inoculate 500 mL of LB medium containing 100 lgỈmL)1 carbenicillin and 34 lgỈmL)1 chloramphenicol Protein expression was performed as described previously [4] Wild-type M avium DHFR and DHFR proteins containing amino acid substitutions were purified according to Barrow et al [5], using BugBuster protein Extraction Reagent Kit (Novagen, San Diego, CA, USA) The target protein was purified using His-Bind resin (Novagen) under nondenaturing conditions, as described previously [4] All purification steps were evaluated by SDS ⁄ PAGE [41], and protein concentrations were determined with the Bio-Rad assay The column was connected to the Biologic LP Chromatography System (BioRad, Hercules, CA, USA), and the automated procedure was started The column was washed FEBS Journal 274 (2007) 3286–3298 ª 2007 The Authors Journal compilation ª 2007 FEBS R A Bock et al ă with mL of buffer A (5 mm imidazole, 500 mm NaCl, 20 mm Tris ⁄ HCl, pH 7.9) at a flow rate of mLỈmin)1 Elution was continued as a linear gradient of 0–100% buffer B (5–500 mm imidazole) over a volume of 20 mL Elution was continued with an additional 20 mL of 100% buffer B (500 mm imidazole) to ensure that all protein was eluted Imidazole was removed by dialyzing against buffer without imidazole and also with PD 10 columns (Sephadex R G-25M) (Amersham Biosciences) as described previously [5] Upon completion, samples were removed and aliquoted for protein determination, SDS ⁄ PAGE, and enzyme assays Samples for protein determination and SDS ⁄ PAGE were stored at ) 20 °C, and samples for enzyme assay were stored at ) 80 °C CD CD spectroscopy was performed with a Jasco-715 (Jasco Corporation, Tokyo, Japan) spectropolarimeter using a 0.1-cm path length cell over the 195–260 nm range The spectra were acquired every nm with a s averaging time per point and a nm bandpass Data were collected at 25 °C Quadruplicates of the spectra were averaged, corrected for background, and smoothed The proteins were dissolved in 20 mm sodium phosphate and 100 mm NaCl (pH 7.4) The concentration of protein was determined by UV absorption spectroscopy, using an extinction coefficient, at 280 nm, of 39 500 m)1Ỉcm)1 The mean residue ellipticity (degỈcm)2Ỉdmol)1) was calculated from the number of residues of the recombinant DHFR (200) The secondary structure of the proteins, including regular and distorted a-helix, regular and distorted b-sheet, turns, and unordered structures, was estimated with the program selcon3 using a 29-protein dataset of basic spectra [15] Functionality of mutant rDHFR The functionality of the recombinant mutant forms was determined in a standard DHFR enzyme assay [4] in comparison with the wild-type rDHFR, and by their ability or inability to restore growth of a DHFR-deficient E coli strain (growth complementation), also in comparison with the wild-type rDHFR (see below) DHFR enzyme assay The enzyme assay for determining functionality of the DHFR mutant forms was performed as described previously [4,5] Each enzyme sample was measured multiple times A control reaction without FAH2 was used to correct for NADPH oxidation One unit was defined as the amount of enzyme that reduced lmole of FAH2Ỉper minute on the basis of a molar extinction coefficient of 12 300 m)1Ỉcm)1 at 340 nm [9] Site-directed mutagenesis of M avium DHFR Kinetic assay Kinetic parameters of wild-type and mutant DHFRs were determined with the standard assay above, with the following modifications: For FAH2, the NADPH concentration was kept constant at 100 lm, whereas the FAH2 concentration was varied from 0.35 to lm The mL reaction mixture was incubated for at 30 °C, but with NADPH and FAH2 The reaction was initiated by addition of the enzyme, and the activity was measured, but for at 10 s reading intervals The amount of enzyme used was the amount that gave a linear progress curve over the measurement during the standard assay For NADPH, the concentration of FAH2 was kept constant at 100 lm, whereas that of NADPH was varied from 0.7 to 10 lm The reaction components were incubated as described above, and the reaction was also enzyme initiated The kinetic parameters Km and Vmax for FAH2 and NADPH of the wild-type M avium rDHFR (p807) and the Asp31 and Leu32 mutants were determined with the nonlinear Michaelis–Menten curve-fitting program enzfitter (Biosoft, Great Shelford, Cambridge, UK) Protein determination The protein concentration was determined using the Bio-Rad microassay in a 96-well format as described previously [5] IC50 determination The stock solution for TMP was prepared at 10.24 mgỈmL)1 in sterile dimethylsulfoxide (Sigma, St Louis, MO, USA) and stored at ) 20 °C For the drug assay, the stock solution was diluted with sterile dimethylsulfoxide to 1.024 mgỈmL)1 This working solution was used to prepare a series of drug concentrations ranging from 1024 to 0.01024 lgỈmL)1 The assay is similar to the standard enzyme assay The mL enzyme reaction mixture contained 10 lL of drug in addition to the normal components, and was incubated at 30 °C for min, after which 0.1 mm FAH2 (Sigma) was added to initiate the reaction Activity was measured as previously described A control reaction using 10 lL of dimethylsulfoxide instead of the drug was set up to determine the effect of dimethylsulfoxide on the reaction The effects of NADPH oxidation were taken into account as described for the standard assay Percentage inhibition was calculated by determining the quotient of the activity obtained with drug and that obtained in the reaction with dimethylsulfoxide only, and subtracting the quotient (obtained from dividing the activity using drug by the activity using dimethylsulfoxide) from one, then multiplying by 100 to obtain a percentage Values from reactions for at least four different drug concentrations were determined for FEBS Journal 274 (2007) 3286–3298 ª 2007 The Authors Journal compilation ª 2007 FEBS 3295 Site-directed mutagenesis of M avium DHFR R A Bock et al ă each enzyme sample, two above the 50% inhibition and two below The concentration of the drug that inhibited the reaction by 50% (IC50) was computed using the fourparameter curve program of the kc junior software (BioTEK, Winooski, VT, USA) The SAS statistical software (sas system for windows V8; SAS Institute, Inc., Cary, NC, USA) was used to evaluate statistical significance Electrotransformation of E coli Electrocompetent E coli cells (MG1655 and MH831) were prepared according to Bio-Rad protocols, and were electroporated with 10 ng of plasmid DNA in 0.2 cm cuvettes with a Gene Pulser apparatus (Bio-Rad) set to 25 lF, 2.5 kV, and 200 W Cells were recovered in 1.0 mL of SOC medium, and were then transferred to a sterile microcentrifuge tube and incubated for h at 37 °C and 225 r.p.m (rotary aeration) For each reaction, 100 lL was plated on LB agar containing 30 lgỈmL)1 kanamycin, 50 lgỈmL)1 thymidine and 100 lgỈmL)1 carbenicillin The plates were incubated overnight at 37 °C (Isotemp incubator; Fisher Scientific, Pittsburg, PA, USA) Growth assay with thymidine An isolated colony was selected and grown overnight in 12.5 mL of LB medium containing 30 lgỈmL)1 kanamycin, 50 lgỈmL)1 thymidine and 100 lgỈmL)1 carbenicillin The overnight culture was used ( 50 lL) to inoculate 30 mL of LB medium (30 lgỈmL)1 kanamycin, 50 lgỈmL)1 thymidine and 100 lgỈmL)1 carbenicillin) to achieve a D600 of 0.008–0.011 This set-up culture was further diluted as follows: 25 mL was taken and combined with an additional 25 mL of fresh LB medium containing 30 lgỈmL)1 kanamycin, 50 lgỈmL)1 thymidine and 100 lgỈmL)1 carbenicillin (1 : dilution) in 125 mL sterile flasks A D600 reading was taken for the time point t ¼ This sample was serially diluted (10)1)10)7) with sterile H2O, and 10 lL of each dilution was plated on LB agar with the same antibiotic conditions as above The cultures were grown at 37 °C and 225 r.p.m Samples were taken after 2, 4, and h For each time interval, a D600 reading was taken, and samples were serially diluted and plated on LB agar as described above The agar plates were incubated at 37 °C (Isotemp incubator’; Fischer Scientific) overnight (about 15 h), and plates were used to determine colony-forming units A growth curve was constructed by plotting D600 against time Complementation of growth defect of MH831 Transformants were grown on LB agar with 30 lgỈmL)1 kanamycin, 100 lgỈmL)1 carbenicillin, and 0.1 mm isopropyl thio-b-d-galactoside, but no thymidine The same 3296 procedure was followed as described above, but without thymidine Acknowledgements The educational support for R A Bock’s doctoral ¨ program was provided by a Namibian Government Scholarship and Training Program (NGSTP) sponsored through the Africa-America Institute (AAI) in New York City This research was funded by funds provided by NIH ⁄ NIAID grant AI-41348 (W W Barrow) and the Sitlington Chair in Infectious Diseases, Oklahoma State University (W W Barrow) We would like to thank Dr Allen Edmundson and Dr Phil Bourne for helpful suggestions regarding DHFR structural information, as well as Esther Barrow for initial assistance with the cloning and expression of the M avium DHFR, the enzyme and IC50 assays, and critical reviewing of the manuscript Special thanks go to Dr Phil Bourne for helpful comments regarding crystallographic models, Dr Michelle Valderas for assistance with electrotransformation of E coli, complementation experiments and editing of the manuscript, and Dr Muriel Herrington for the E coli MH831 and MG1655 strains Some of these results were presented at the 43rd annual Interscience Conference on Antimicrobial Agents and Chemotherapy (Abstract F-349, 2003, Chicago, IL, USA) and the 106th General Meeting of the American Society for Microbiology (Abstract U-056, 2006, Orlando, FL, USA) References Villafranca JE, Howell EE, Voet DH, Strobel MS, Ogden RC, Abelson JN & Kraut J (1983) Directed mutagenesis of dihydrofolate reductase Science 222, 782–788 Hartman PG (1993) Molecular aspects and mechanism of action of dihydrofolate reductase inhibitors J Chemother 5, 369–376 McCourt M & Cody V (1991) Conformational analysis of lipophilic antifolates: crystal structure of 2-amino-4oxo-6-adamantylpteridine and a comparison of its binding to bacterial and avian dihydrofolate reductase J Am Chem Soc 113, 6634–6639 Zywno-vanGinkel S, Dooley TP, Suling WJ & Barrow WW (1997) Identification and cloning of the Mycobacterium avium folA gene, required for dihydrofolate reductase activity FEMS Microbiol Lett 156, 69–78 Barrow EW, Bourne PC & Barrow WW (2004) Functional cloning of Bacillus anthracis DHFR and confirmation of natural resistance to trimethoprim Antimicrob Agents Chemother 48, 4643–4649 FEBS Journal 274 (2007) 3286–3298 ª 2007 The Authors Journal compilation ª 2007 FEBS R A Bock et al ă Suling WJ, Seitz LE, Pathak V, Westbrook L, Barrow EW, Zywno-van-Ginkel S, Reynolds RC, Piper JR & Barrow WW (2000) Antimycobacterial activity of 2,4-diamino-5-deazapteridine derivatives and effects on mycobacterial dihydrofolate reductase (DHFR) Antimicrob Agents Chemother 44, 2784–2793 Kharkar PS & Kulkarni VM (2003) A proposed model of Mycobacterium avium complex dihydrofolate reductase and its utility for drug design Org Biomol Chem 1, 1315–1322 Li R, Sirawaraporn R, Chitnumsub P, Sirawaraporn W, Wooden J, Athappilly F, Turley S & Hol WGJ (2000) Three-dimensional structure of M tuberculosis dihydrofolate reductase reveals opportunities for the design of novel tuberculosis drugs J Mol Biol 295, 307–323 Baccanari DP, Stone D & Kuyper L (1981) Effect of a single amino acid substitution on Escherichia coli dihydrofolate reductase catalysis and ligand binding J Biol Chem 256, 1738–1747 10 Matthews DA, Alden RA, Bolin JT, Freer ST, Hamlin R, Xuong N, Kraut J, Poe M, Williams M & Hoogsteen K (1977) Dihydrofolate reductase: x-ray structure of the binary complex with methotrexate Science 197, 452–455 11 Howell EE, Villafranca JE, Warren MS, Oatley SJ & Kraut J (1986) Functional role of aspartic acid-27 in dihydrofolate reductase revealed by mutagenesis Science 231, 1123–1128 12 Bolin JT, Filman DJ, Matthews DA, Hamlin RC & Kraut J (1982) Crystal structures of Escherichia coli and Lactobacillus casei dihydrofolate reductase refined at 1.7 A resolution I General features and binding of methotrexate J Biol Chem 257, 13650–13662 13 Matthews DA, Alden RA, Bolin JT, Filman DJ, Freer ST, Hamlin R, Hol WG, Kisliuk RL, Pastore EJ, Plante LT et al (1978) Dihydrofolate reductase from Lactobacillus casei X-ray structure of the enzyme methotrexate.NADPH complex J Biol Chem 253, 6946–6954 14 Suling WJ, Reynolds RC, Barrow EW, Wilson LN, Piper JR & Barrow WW (1998) Susceptibilities of Mycobacterium tuberculosis and Mycobacterium avium complex to lipophilic deazapteridine derivatives, inhibitors of dihydrofolate reductase J Antimicrob Chemother 42, 811–815 15 Sreerama N, Venyaminov SY & Woody RW (2000) Estimation of protein secondary structure from circular dichroism spectra: inclusion of denatured proteins with native proteins in the analysis Anal Biochem 287, 243– 251 16 Bystroff C, Oatley SJ & Kraut J (1990) Crystal structures of Escherichia coli dihydrofolate reductase: the NADP+ holoenzyme and the folate NADP+ ternary complex Substrate binding and a model for the transition state Biochemistry 29, 3263–3277 Site-directed mutagenesis of M avium DHFR 17 Ohmae E, Sasaki Y & Gekko K (2001) Effects of five-tryptophan mutations on structure, stability and function of Escherichia coli dihydrofolate reductase J Biochem (Tokyo) 130, 439–447 18 Appleman JR, Howell EE, Kraut J & Blakley RL (1990) Role of aspartate 27 of dihydrofolate reductase from Escherichia coli in interconversion of active and inactive enzyme conformers and binding of NADPH J Biol Chem 265, 5579–5584 19 Birdsall B, Andrews J, Ostler G, Tendler SJ, Feeney J, Roberts GC, Davies RW & Cheung HT (1989) NMR studies of differences in the conformations and dynamics of ligand complexes formed with mutant dihydrofolate reductases Biochemistry 28, 1353–1362 20 Dunn SM, Lanigan TM & Howell EE (1990) Dihydrofolate reductase from Escherichia coli: probing the role of aspartate-27 and phenylalanine-137 in enzyme conformation and the binding of NADPH Biochemistry 29, 8569–8576 21 Howell EE, Booth C, Farnum M, Kraut J & Warren MS (1990) A second-site mutation at phenylalanine-137 that increases catalytic efficiency in the mutant aspartate-27–serine Escherichia coli dihydrofolate reductase Biochemistry 29, 8561–8569 22 Thillet J, Adams JA & Benkovic SJ (1990) The kinetic mechanism of wild-type and mutant mouse dihydrofolate reductases Biochemistry 29, 5195–5202 23 Polshakov VI (2001) Dihydrofolate reductase: structural aspects of mechanisms of enzyme catalysis and inhibition Russian Chem Bull 50, 1733–1751 24 Adams J, Johnson K, Matthews R & Benkovic SJ (1989) Effects of distal point-site mutations on the binding and catalysis of dihydrofolate reductase from Escherichia coli Biochemistry 28, 6611–6618 25 Appleman JR, Howell EE, Kraut J, Kuhl M & Blakley RL (1988) Role of aspartate 27 in the binding of methotrexate to dihydrofolate reductase from Escherichia coli J Biol Chem 263, 9187–9198 26 Chen JT, Mayer RJ, Fierke CA & Benkovic SJ (1985) Site-specific mutagenesis of dihydrofolate reductase from Escherichia coli J Cell Biochem 29, 73–82 27 Fierke CA & Benkovic SJ (1989) Probing the functional role of threonine-113 of Escherichia coli dihydrofolate reductase for its effect on turnover efficiency, catalysis, and binding Biochemistry 28, 478–486 28 Mayer RJ, Chen JT, Taira K, Fierke CA & Benkovic SJ (1986) Importance of a hydrophobic residue in binding and catalysis by dihydrofolate reductase Proc Natl Acad Sci USA 83, 7718–7720 29 Murphy DJ & Benkovic SJ (1989) Hydrophobic interactions via mutants of Escherichia coli dihydrofolate reductase: separation of binding and catalysis Biochemistry 28, 3025–3031 30 Taira K & Benkovic SJ (1988) Evaluation of the importance of hydrophobic interactions in drug FEBS Journal 274 (2007) 3286–3298 ª 2007 The Authors Journal compilation ª 2007 FEBS 3297 Site-directed mutagenesis of M avium DHFR 31 32 33 34 35 R A Bock et al ¨ binding to dihydrofolate reductase J Med Chem 31, 129–137 David CL, Howell EE, Farnum MF, Villafranca JE, Oatley SJ & Kraut J (1992) Structure and function of alternative proton-relay mutants of dihydrofolate reductase Biochemistry 31, 9813–9822 Basran J, Casarotto MG, Barsukov IL & Roberts GC (1995) Role of the active-site carboxylate in dihydrofolate reductase: kinetic and spectroscopic studies of the aspartate 26–>asparagine mutant of the Lactobacillus casei enzyme Biochemistry 34, 2872–2882 Cody V, Luft JR, Ciszak E, Kalman TI & Freisheim JH (1992) Crystal structure determination at 2.3 A of recombinant human dihydrofolate reductase ternary complex with NADPH and methotrexate-gamma-tetrazole Anticancer Drug Des 7, 483–491 Falzone CJ, Wright PE & Benkovic SJ (1991) Evidence for two interconverting protein isomers in the methotrexate complex of dihydrofolate reductase from Escherichia coli Biochemistry 30, 2184–2191 Prendergast NJ, Appleman JR, Delcamp TJ, Blakley RL & Freisheim JH (1989) Effects of conversion of phenylalanine-31 to leucine on the function of human dihydrofolate reductase Biochemistry 28, 4645–4650 3298 36 Tsay JT, Appleman JR, Beard WA, Prendergast NJ, Delcamp TJ, Freisheim JH & Blakley RL (1990) Kinetic investigation of the functional role of phenylalanine-31 of recombinant human dihydrofolate reductase Biochemistry 29, 6428–6436 37 Huang Z, Wagner CR & Benkovic SJ (1994) Nonadditivity of mutational effects at the folate binding site of Escherichia coli dihydrofolate reductase Biochemistry 33, 11576–11585 38 Wagner CR, Thillet J & Benkovic SJ (1992) Complementary perturbation of the kinetic mechanism and catalytic effectiveness of dihydrofolate reductase by side-chain interchange Biochemistry 31, 7834–7840 39 Chunduru SK, Cody V, Luft JR, Pangborn W, Appleman JR & Blakley RL (1994) Methotrexate-resistant variants of human dihydrofolate reductase Effects of Phe31 substitutions J Biol Chem 269, 9547–9555 40 Herrington MB & Chirwa NT (1999) Growth properties of a folA null mutant of Escherichia coli K12 Can J Microbiol 45, 191–200 41 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 227, 680–685 FEBS Journal 274 (2007) 3286–3298 ª 2007 The Authors Journal compilation ª 2007 FEBS ... (1983) Directed mutagenesis of dihydrofolate reductase Science 222, 782–788 Hartman PG (1993) Molecular aspects and mechanism of action of dihydrofolate reductase inhibitors J Chemother 5, 369–376... Barrow WW (1998) Susceptibilities of Mycobacterium tuberculosis and Mycobacterium avium complex to lipophilic deazapteridine derivatives, inhibitors of dihydrofolate reductase J Antimicrob Chemother... Role of aspartate 27 of dihydrofolate reductase from Escherichia coli in interconversion of active and inactive enzyme conformers and binding of NADPH J Biol Chem 265, 5579–5584 19 Birdsall B, Andrews