Structural features in the C-terminal region of the Sinorhizobium meliloti RmInt1 group II intron-encoded protein contribute to its maturase and intron DNA-insertion function ´ ´ ´ ´ Marıa D Molina-Sanchez, Francisco Martınez-Abarca and Nicolas Toro ´ ´ ´ ´ ´ Grupo de Ecologıa Genetica, Estacion Experimental del Zaidın, Consejo Superior de Investigaciones Cientıficas, Granada, Spain Keywords catalytic RNAs; maturase; retroelements; reverse transcriptase; splicing Correspondence ´ ´ N Toro, Estacion Experimental del Zaidın, Consejo Superior de Investigaciones ´ Cientıficas, Calle Profesor Albareda 1, 18008 Granada, Spain Fax: +34 9581 29600 Tel: +34 9581 81600 E-mail: nicolas.toro@eez.csic.es (Received 28 September 2009, revised 29 October 2009, accepted November 2009) doi:10.1111/j.1742-4658.2009.07478.x Group II introns are both catalytic RNAs and mobile retroelements that move through a process catalyzed by a RNP complex consisting of an intron-encoded protein and the spliced intron lariat RNA Group II intron-encoded proteins are multifunctional and contain an N-terminal reverse transcriptase domain, followed by a putative RNA-binding domain (domain X) associated with RNA splicing or maturase activity and a C-terminal DNA binding ⁄ DNA endonuclease region The intron-encoded protein encoded by the mobile group II intron RmInt1, which lacks the DNA binding ⁄ DNA endonuclease region, has only a short C-terminal extension (C-tail) after a typical domain X, apparently unrelated to the C-terminal regions of other group II intron-encoded proteins Multiple sequence alignments identified features of the C-terminal portion of the RmInt1 intron-encoded protein that are conserved throughout evolution in the bacterial ORF class D, suggesting a group-specific functionally important protein region The functional importance of these features was demonstrated by analyses of deletions and mutations affecting conserved amino acid residues We found that the C-tail of the RmInt1 intron-encoded protein contributes to the maturase function of this reverse transcriptase protein Furthermore, within the C-terminal region, we identified, in a predicted a-helical region and downstream, conserved residues that are specifically required for the insertion of the intron into DNA targets in the orientation that would make it possible to use the nascent leading strand as a primer These findings suggest that these group II intron intronencoded proteins may have adapted to function in mobility by different mechanisms to make use of either leading or lagging-oriented targets in the absence of an endonuclease domain Introduction Group II introns are large catalytic RNAs found in organelle and bacterial genomes that splice via a lariat intermediate, in a mechanism similar to that of spliceosomal introns [1] The intron RNA folds into a conserved 3D structure consisting of six distinct domains, DI to DVI [2] Unlike organellar introns, most bacterial group II introns have an internally encoded (ORF within DIV) reverse transcriptase (RT) maturase This intron-encoded protein (IEP) is required for folding the intron RNA into a catalytically active structure Abbreviations D, DNA binding; En, DNA endonuclease; IEP, intron-encoded protein; RT, reverse transcriptase 244 FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS ´ M D Molina-Sanchez et al in vivo [3–6] Mobility of these group II introns occurs by means of a target DNA-primed reverse transcription mechanism involving a RNP complex containing both the intron RNA and the IEP [7–9] The group II IEPs have an N-terminal RT domain homologous to retroviral RTs, followed by a putative RNA-binding domain associated with RNA splicing or maturase activity (domain X), and a C-terminal DNA binding (D) ⁄ DNA endonuclease (En) region [10,11] Biochemical analyses of LtrA mutants (the IEP of the Ll.ltrB intron of Lactococcus lactis) have suggested that the N-terminus of the RT domain is required for protein interactions with the high-affinity binding site in subdomain DIVa of the intron, whereas other regions of the RT and domain X interact with conserved catalytic core regions [12] Domain X is located in the position corresponding to the ‘thumb’ and part of the connection domains of retroviral RTs, and appears to have a similar structure to these enzymes [10,13] The RT domain and domain X are required for RNA splicing [12] The En domain, which carries out second-strand cleavage to generate the primer for reverse transcription of the inserted intron RNA, contains sequence motifs characteristic of the H-N-H family of endonucleases, interspersed with two pairs of cysteine residues [11,14,15] Deletion of the conserved En domain abolishes bottom-strand cleavage, although the truncated protein retains RNA splicing activity and can carry out reverse splicing of the intron RNA into double-stranded DNA target sites Further deletions of the upstream variable region abolish stable DNA binding and reverse splicing into doublestranded DNA target sites, although the protein retains its ability to splice RNA and to carry out reverse splicing into single-stranded DNA target sites [16–19], albeit at a lower rate than the wild-type protein (approximately 10% of wild-type) Three main classes (IIA, IIB and IIC) of group II introns have been described based on the conserved intron RNA structures [2,20–25] The L lactis Ll.ltrB intron and the yeast aI1 and aI2 introns, which are the best studied mobile introns and serve as a paradigm for group II intron mobility, all belong to the IIA class The Sinorhizobium meliloti group II intron RmInt1 is a mobile intron that belongs to subclass IIB3 [24], showing a IIB-like RNA structure with some IIA features [21] Phylogenetic analysis of RT and X domains has resulted in classification of the ORFs into several groups [A, B, C, D, E, F, CL1 (chloroplast-like 1), CL2 (chloroplast-like 2) and ML (mitochondrialike)] [21,22,26] The RmInt1 IEP belongs to bacterial ORF class D [21,22] Moreover, unlike lactococcal and yeast introns, the RmInt1 IEP and the members of Group II intron maturase C-terminal region this class lack the C-terminal D ⁄ En region [11,14,21,24,27,28] In vitro assays have shown that RmInt1 RNPs are thus unable to carry out secondstrand cleavage but perform reverse splicing into the target site, in both single- and double-stranded DNA substrates [29] RmInt1 is an efficient mobile element with two retrohoming pathways for mobility; the preferred pathway involves reverse splicing of the intron RNA into single-stranded DNA at a replication fork, using the nascent lagging DNA strand as the primer for reverse transcription [30] Similar to the lactococcal and yeast introns, RmInt1 retrohoming also requires base-pairing interactions between the intron RNA and the DNA target [31,32] A previous study [11] suggested that the IEP of RmInt1 differs from other IEPs in having only a short (20 amino acids) C-terminal extension (hereafter referred to as the C-tail) after a typical domain X, which appears to be unrelated to the C-terminal regions of other group II IEPs It has also been suggested that this C-tail may be a primordial or remnant DNA-binding region, an extension of domain X, or simply a nonfunctional extension In the present study, we investigated the C-terminal region of the RmInt1 IEP up to the maturase domain and the C-tail We found that the C-tail and upstream amino acid residues, located in a predicted a-helical region, form a functionally important region of the IEP maturase domain that is conserved throughout the evolution in the D lineage We show that C-tail of the RmInt1 IEP contributes to the maturase function of this RT protein and have identified, downstream and in the former putative a-helical region, conserved residues that are specifically required for the insertion of the intron RNA into DNA targets in the orientation that would make it possible to use the nascent leading strand as a primer for reverse transcription Results and Discussion Multiple sequence-structure alignments Previously reported multiple sequence alignments suggested that the C-tail of the RmInt1 IEP may extend from amino acid residues 400–419 (Fig 1) [11] Figure shows multiple sequence alignments of the C-terminal region (domain X and downstream residues) of class D proteins (see Materials and methods) The C-terminal region includes the two most highly conserved sequence motifs in domain X of group II IEPs: RGWXNYY (RmInt1 residues 349–355) and R(K ⁄ R)XK (RmInt1 residues 380–383) The predicted secondary structure of the RmInt1 domain X includes FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS 245 ´ M D Molina-Sanchez et al Group II intron maturase C-terminal region Fig Multiple sequence alignments The C-terminal region of the RmInt1 IEP (Sr.me.I1) was aligned with other group II IEPs of class D, using CLUSTALW Conserved amino acid residues are highlighted: black, > 50% identity; gray, > 50% similarity; shading was achieved with BOXSHADE (http://mobyle.pasteur.fr/cgi-bin/portal.py?form=boxshade) Residue numbers are according to the RmInt1 sequence The predicted secondary structure of the RmInt1 IEP domain X, based on the JPRED folding prediction, is shown above the alignments, and a consensus sequence (indicated by dots) is shown below Residues identical in all sequences are indicated by asterisks Highly conserved motifs in the X domain of group II IEPs RGWXNYY (RmInt1 residues 349–355) and R(K ⁄ R)XK (RmInt1 residues 380–383) are indicated by a line above the secondary structure prediction The putative boundaries of domain X and the C-tail [11] are indicated by opposing arrows separated by a dashed line and a question mark The bacterial species and the corresponding accession numbers of the IEPs are: S meliloti (Sr.me.I1, NP_437164); Ensifer adhaerens (E.a.I1, AAP83798); Sinorhizobium medicae (Sr.med., YP 001313619); Sinorhizobium terangae (Sr.t.I1, AAU95643); E coli (E.c.I2, CAA54637); Shewanella putrefaciens (Sh.p., YP_001181807); Azoarcus sp EbN1 (Az.sp., YP_159836); Legionella pneumophila (L.p., YP_001251128); E coli B (E.c., ZP_01698243); Prosthecochloris aestuarii (Pr.ae.I3, ZP_00592895); Prosthecochloris vibrioformis (Pr.vi.I1, YP_001129678); Pelodyction phaeoclathratiforme (Pe.ph.I1, ZP_00589124); Chlorobium phaeobacteroides (Ch.ph., YP_911931); Syntrophus aciditrophicus (Sy.a., YP_460783); Methanosarcina acetivorans (M.a.I5, NP_619481); uncultured archaeon Gzfos32G12 (UA.I3,, AAU83697); Bacillus thuringiensis (B.thu., ZP_00738538); Paracoccus denitrificans (Pa.de.I1, ZP_00628808); Photorhabdus luminescens (Ph.l.I2, NP_928428); Magnetococcus sp (Ma.sp.I3, YP_864580); Pseudomonas aeruginosa (P.ae., ABR13526); Pseudomonas stutzeri (P.st I3 YP_001172226); Burkholderia phymatum (Bu.ph., ZP_01505671); Frankia sp (Fr.sp., YP_482811); Saccharopolyspora erythraea (S.ery., YP_001104541); Pelobacter acetylenicus (Pe.a., AAQ08377); deltaproteobacterium MLMS-1 (delta, ZP_01288325); Bradyrhizobium japonicum (B.j.I1, NP_768692); Shigella dysenteriae (S.dy.I1, YP_406035); Alkaliphilus metalliredigens (Al.me.I4, YP_001321146); Bacteroides thetaiotaomicron (B.t.I4, NP_811528); uncultured marine bacterium 18874410 (UMB.I3, AAL78690); uncultured marine bacterium 18874275 (UMB.I1, AAL78688); Psychroflexus torquis (Pch.t., ZP_01254488); and uncultured marine bacterium 18874408 (UMB.I2, AAL78689) The introns are named according to the Zimmerly nomenclature (http://www.fp.ucalgary.ca/group2introns/) Sequence logo for class D IEPs is shown below the alignment The sequence logo (http://weblogo.berkeley.edu/) shows the information content (4 bits = no degeneracy) for each position in domain X, and is based on the multiple sequence alignment shown in Fig 2A Amino acids are colored according to properties: basic, blue (K, R and H); acidic, red (D and E); hydrophobic, green (P, L, I, V, M, F, W, Y and A); polar, purple (N, Q, S and T); and black (G and C) four putative a-helices, as in most group II IEPs [13], and a putative short b-strand in the C-tail The two conserved domain X motifs are found at or near the C-termini of a2 and a3, respectively The a-helices a1, a2 and a3 potentially correspond to a-helices aH, aI and aJ in the thumb of HIV-RT [13] The domain X region of group II intron RTs extends downstream from aJ into the region corresponding to the connection domain of HIV-1 RT [10], which is characterized by three adjoining b-strands involved in protein dimerization [13] This downstream region contains a conserved lysine residue in domain X (K483 in LtrA) [13], whose mutation reduces maturase activity [12] Interestingly, the amino acid residue in the equivalent position of ORF class D is a highly conserved leucine residue (L396 in RmInt1) located at the C-terminus of a-helix a4 Upstream of this conserved leucine residue at the N-terminus of a-helix a4, the domain X contains the conserved amino acid residues HKXRA (RmInt1 residues 388–392) carrying a stretch of basic amino acids Some of the residues of the HKXRA motif are also conserved in some other group II IEPs at similar positions, together with the predicted a-helix [13] However, a-helix a4 has no equivalent predicted structure in HIV-1 RT or LtrA protein In addition, an idiosyncratic conserved sequence motif AX3PXLF(V ⁄ A)HW (RmInt1 residues 400–410), lies downstream within the C-tail 246 To summarize, the information content (Fig 1) of each position in domain X suggests that the C-tail of class D RT ⁄ maturase proteins (Fig 2A) is characterized by a well conserved sequence motif (hereafter referred to as a class D motif), LX3AX3PXLF(V ⁄ A) HW (RmInt1 residues 396–410), which suggest a group-specific, functionally important protein region Effect of mutations in the C-terminal region of the RmInt1 IEP on RNA splicing in vivo We constructed a series of mutants to identify the functional features of the C-terminal region of the RmInt1 IEP Three of these mutants had C-terminal truncations of different sizes, whereas other mutants had amino acid substitutions in various positions (Fig 2A) Intron RNA excision was analyzed by primer extension in both total RNA (Fig 2B) and RNP particles preparations (Fig 2C) using a primer P (see Materials and methods) complementary to a sequence located 80–97 nucleotides from the 5¢ end of the intron [29] The previously reported domain X mutant K381A [33], in which the last conserved lysine residue of the conserved R(K ⁄ R)XK motif was replaced by an alanine residue, retained RNA splicing activity (approximately 30% of wild-type), measured in both RNA and RNP particle preparations These data suggest that the mutant K381A remains capable of binding the spliced lariat intron RNA By contrast, the FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS ´ M D Molina-Sanchez et al FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS Group II intron maturase C-terminal region 247 ´ M D Molina-Sanchez et al Group II intron maturase C-terminal region mutant (DC29), in which the IEP was truncated such that the last 29 amino acid residues were missing, showed no detectable RNA splicing activity when assayed on total RNA or RNPs extracts, consistent with the truncation affecting part of domain X Interestingly, mutants with shorter C-terminal truncations (DC14 and DC21) displayed no detectable splicing activity in vivo A similar result was obtained with the previously reported domain X double mutation YY fi AA [33] in the conserved RGWXNYY motif, in which the Y354 and Y355 amino acids were replaced by alanine residues, and the 2.5· mutant [27], in which the IEP was truncated in the RT domain Therefore, the pattern of inhibition for the C-terminal truncations was consistent with proteins that are missfolded, unstable and ⁄ or unable to interact with their substrates Thus, we conclude that the C-tail is structurally and functionally important for these RT proteins Despite the conserved amino acid residues H388, K389, R391 and A392 in the predicted a-helix a4 and the neighboring A400 and P404 in the D motif being substituted by amino acid residues with very different structures and properties (Fig 2A), point mutants retained substantial RNA splicing activity (‡ 70% of wild-type) in both RNA (Fig 2B) and RNP extracts (Fig 2C) These results suggest that the former amino acid residues are not required for the maturase function of this IEP By contrast, the mutants in the conserved residues L396, L406, F407 and W410 within the D motif showed a greater reduction in the splicing activity that decreased to 18–60% of wild-type, which suggests that these amino acid residues contribute to intron RNA splicing Furthermore, the mutation of the conserved amino acid residue H409 (H409G), which is invariant in multiple sequence alignments, abolished RNA splicing Taken together, these findings show that the C-tail contributes to the maturase function of these RT proteins and reveal that H409 is the most critical amino acid residue Effect of mutations in the C-terminal region of the RmInt1 IEP on intron mobility To test the retrohoming ability of the RmInt1 C-terminal mutants, mobility assays were conducted by using an intron donor and target-recipient plasmids assay, as reported previously [30] S meliloti strain RMO17 harboring the intron donor plasmid was transformed with target-recipient plasmids in which the target site was cloned in the same (LAG) or in opposite (LEAD) orientation, depending on whether the nascent lagging or leading DNA strand could be used as a primer for 248 reverse transcription of the inserted intron RNA As expected, all the mutants in the C-terminal region of the RmInt1 IEP that showed no detectable RNA splicing activity in vivo did not demonstrate detectable intron mobility (Fig 3) Similarly, mutations that strongly decreased splicing measured in total RNA to £ 33% of wild-type (F407R, W410D and W410P) demonstrated no detectable mobility such as occurs with point mutation K381A in domain X The mutants P404T, L406R and W410F, which showed higher splicing activity (80%, 40% and 36% of wild-type, respectively), retained substantial intron mobility with DNA targets cloned in both orientations with respect to the replication fork Surprisingly, none of the mutations in the conserved residues H388, K389, R391, A392 and L396 in the predicted a-helix a4 and the neighboring A400 displayed retrohoming on pJB0.6LEAD containing the target cloned in the orientation that would make it possible to use the nascent leading strand as a primer for reverse transcription of the inserted intron RNA However, some of them (R391M, A400R and A400V) retained retrohoming activity into the target DNA site when cloned in the orientation that would make it possible to use the nascent lagging DNA strand as a primer for reverse transcription (pJB0.6LAG), the preferred retrohoming pathway of RmInt1 Therefore, for these mutants that retain a substantial level of splicing activity (‡ 50% of wild-type), intron mobility cannot be directly predicted from the extent of splicing Thus, these conserved residues appear to contribute to intron mobility and are specifically required for the insertion of the intron into DNA targets in the orientation that would make it possible to use the nascent leading strand as a primer for reverse transcription Additional data further support the above conclusion: the W410F mutant showed a similar reduction of retrohoming (47% of wild-type) in a target in the lagging strand orientation but still had retrohoming in the leading strand template (55% of wild-type) Furthermore, similar mutations in more efficient constructs (DORF and IEP expressed in cis; not shown) showed a similar bias for intron mobility (Fig S1) It has been suggested that this minor retrohoming pathway [30] may involve reverse splicing into either double-stranded DNA or transiently singlestranded DNA target sites, and that priming may include random nonspecific opposite-strand nicks, a nascent leading strand or de novo initiation of cDNA synthesis Because most of these mutants were able to cleave single- and double-stranded DNA substrates (Fig 4), the impairment of mobility may reflect the requirement of these residues for specific interactions that are required to initiate the priming reaction after reverse splicing of the intron RNA into these target FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS ´ M D Molina-Sanchez et al Group II intron maturase C-terminal region A B C Fig Effect of RmInt1 IEP C-terminal mutations on intron RNA splicing (A) Detailed sequence of the C-terminal region of the RmInt1 IEP Highly conserved amino acids are shown in bold Changes are indicated below each position; deletions are shown with arrows below the sequence The boxed residues correspond to the class D motif at the C-terminal region The predicted secondary structure is indicated above the sequence; a-helices are represented by cylinders and the b-strand is shown as an arrow Amino acid positions are indicated (B) Splicing measured in total RNA sample or (C) in RNP particle preparations Representative lanes of the primer extension gel electrophoresis are shown for each mutant The molecular sizes of the cDNAs extension products, spliced intron RNA (S) and unspliced precursors (Pr) are indicated cDNA bands corresponding to the resolved extension products were quantified with the QUANTITY ONE software package (Bio-Rad Laboratories) and intron splicing was measured as 100[S ⁄ (S + Pr)] Splicing efficiency was plotted as percentage of wild-type values in pKG2.5 In addition to the C-terminal mutants, other mutants were used as negative controls: 2.5X, which has a frame-shift at the beginning of the IEP sequence; YAHH, which has a mutation affecting the active site for RT activity (RT domain 5); and D5-CGA, which has a mutation in the catalytic triad of the ribozyme catalytic core (RNA domain V) FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS 249 ´ M D Molina-Sanchez et al Group II intron maturase C-terminal region Fig Retrohoming in vivo of wild-type RmInt1 and mutant derivatives on DNA target sites cloned in opposite orientations relative to the direction of plasmid replication Plasmid pools from S meliloti RMO17 harboring donor (pKG2.5) and target plasmids (pJB0.6LEAD or pJB0.6LAG) were analyzed by digestion and Southern hybridization with an exon-specific probe Recipient plasmid without the DNA target (pJBD129) was used as a negative control in the assays Schematic diagrams of the mobility assays are shown at the top (not drawn to scale) The SalI restriction sites (S) in the plasmids as well as the orientation of the target with respect to the replication fork (arrows) are indicated The recipient plasmids contain the intron DNA target cloned in the same (LAG) or in opposite (LEAD) orientation depending on whether the nascent lagging or leading DNA strand could be used as a primer for reverse transcription of the inserted intron RNA The Southern blots are shown below and the hybridization signal corresponding to the target recipient plasmid (T) and the homing product (H) are indicated Donor plasmid hybridization signals were removed sites The results obtained in the present study support the hypothesis that these group II intron IEPs may have adapted to function in mobility by different mechanisms to make use of either leading or lagging-oriented targets in the absence of a DNA endonuclease domain Materials and methods Bacterial strains, media and growth conditions S meliloti RMO17 was cultured at 28 °C on TY medium for RNA extraction and RNP particle isolation Escherichia coli DH5a was used for the construction of mutants and 250 cloning E coli was grown in LB medium at 37 °C For plasmid maintenance, the antibiotic kanamycin was added at a concentration of 200 lgỈmL)1 for rhizobia and 50 lgỈmL)1 for E coli; ampicillin was added at a concentration of 200 lgỈmL)1 for both; and the medium was supplemented with tetracycline at a concentration of 10 lgỈmL)1 for mobility assays Sequence alignments and secondary-structure prediction We searched the NCBI database for class D group II IEPs, using blastp with the amino-acid sequence (127 residues) of FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS ´ M D Molina-Sanchez et al Group II intron maturase C-terminal region Fig Effect of mutations in the C-terminal region of the RmInt1 IEP on DNA cleavage The panel on the left shows cleavage in a 5¢-labeled, symmetric, 70 nucleotides single-stranded DNA substrate, whereas the panel on the right shows cleavage in a 5¢-labeled top-strand, 70 bp double-stranded DNA substrate DNA cleavage activity was assayed by incubating a DNA substrate with the RNP-enriched preparations extracted from cells containing the wild-type or the indicated mutant proteins The products were analyzed by electrophoresis in a denaturing 6% polyacrylamide gel and quantified with the Quantity One software package (Bio-Rad Laboratories) In lanes marked ‘-RNPs’, DNA substrates were incubated in the absence of RNPs Sizes were determined based on DNA sequencing ladders (not shown) S, DNA substrate; C, cleavage product Other bands correspond to nonspecific cleavage products The products expected from partial reverse splicing of the intron RNA into the insertion site in the DNA are shown at the top Solid lines indicate DNA and dashed lines correspond to intron RNA the RmInt1 IEP domain X (positions 293–419) as the protein query sequence The first 66 blast hits obtained with this query protein were complete or fragmented group II IEPs of class D For sequence alignments, we chose 35 complete IEPs harbored by different bacterial species, including 18 out of 22 currently (updated 11 March 2008) classified as group II intron bacterial class ORF D in the group II intron database (http://www.fp.ucalgary.ca/group2introns/) clustalw was used to generate sequence alignments, and the secondary structure was predicted with the jpred server (http:// www.compbio.dundee.ac.uk/~www-jpred/) The identification as class D proteins was further confirmed by phylogenetic analyses using class C intron IEPs as outgroup (not shown) The logo sequence [34,35] was obtained based on this alignment (http://weblogo.berkeley.edu/) RmInt1 and mutant derivatives The pKG2.5, pKG2.5X, pKG2.5-YAHH, pKG2.5D5CGA, pKG2.5-DC29, pKG2.5-A354A355 and pKG2.5A381 constructs have been described in previous studies [27,29,33] Most of the RmInt1 IEP maturase mutants (Table S1) were generated by site-directed mutagenesis, using the Altered Sites II in vitro Mutagenesis pAlter-1 System (Promega, Madison, WI, USA), with changes introduced in the pAL2.5 plasmid This plasmid contains RmInt1 flanked by exons )175 ⁄ +466 inserted into pALter1 as a SphI fragment [29] The changes were introduced through the use of DNA oligonucleotides, hybridizing around the position of the intended mutation and abolishing antibiotic resistance The final constructs were generated by inserting the RmInt1-containing fragment resulting from BamHI ⁄ SpeI digestion of pAL2.5 into pKG0 The primers used for mutagenesis are shown in Table S1 The pKG2.5V400 mutant was constructed by a two-step PCR procedure using the Triple MasterÔ PCR System (Eppendorf, Hamburg, Germany) Two pairs of primers were designed to amplify the 5¢ and 3¢ sections of the IEP, respectively: a 5¢ end primer mut UP (5¢-GTCAGCGGTGCTGGAAG TATG-3¢) and a 3¢ end primer A400V ⁄ DN (5¢-ATTTT CCCGCACCAGCTTTCGCAAGA-3¢) were used to generate the upstream 824 bp fragment; a 5¢ end primer A400V ⁄ UP (5¢-GAAAGCTGGTGCGGGAAAATCCGG G-3¢) and a 3¢ end primer mut DN (5¢-GCGCGCGTAAT ACGACTCAC-3¢) were used to generate the downstream 689 bp fragment The mutagenic primers contained a 20 bp region of overlap and introduced a valine (V) residue in place of the moderately conserved alanine (A) in position 400 of the IEP, by changing C>T in intron position 1745 The final 1492 bp fragment was amplified, digested with EcoRI and SpeI and used to replace the corresponding wild-type fragment in pKG2.5 RNA isolation and RNP particle preparation RNA and RNPs were extracted from free-living cultures of S meliloti strain RMO17 containing plasmids encoding the wild-type or mutant RmInt1, as described previously FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS 251 ´ M D Molina-Sanchez et al Group II intron maturase C-terminal region [29,33] For RNA isolation, we collected the cells present in 10 mL of TY medium, supplemented with kanamycin at a D600 of  0.6 The cells were lysed and their DNA was eliminated by incubation with 50 units of RNase-free DNase I RNP-enriched fractions were obtained from 200 mL of TY medium plus kanamycin at a D600 of  0.8 A clarified lysate of the bacterial cells was layered onto a 1.85 m sucrose cushion and subjected to 20 h of centrifugation in a Beckman Ti50 rotor (Beckman Coulter, Fullerton, CA, USA) at 50 000 g The resulting pellet was resuspended in 10 mm Tris–HCl (pH 8.0) and mm dithiothreitol Primer extension assays These assays were carried out on both total RNA and RNP particle preparations Primer extension reactions were carried out essentially as previously described [29] The annealing mixture had a volume of 10 lL and contained either 15 lg of total RNA or 0.125 A260 units (equivalent of lg of single-stranded RNA) of RNP particles and 0.2 pmol (300 000 c.p.m.) of [5¢-32P]-labeled P primer (5¢-TGA AAG CCG ATC CCG GAG-3¢) in 10 mm Pipes (pH 7.5) and 400 mm NaCl This mixture was first heated at 85 °C for min, and was then rapidly cooled to 60 °C and allowed to cool more slowly to 45 °C Extension reactions were initiated by adding 40 lL of 50 mm Tris–HCl (pH 8.0), 60 mm NaCl, 10 mm dithiothreitol, mm MgOAc, mm each of all four dNTPs, 60 lgỈmL)1 of actinomycin D (Sigma, St Louis, MO, USA), 15 units of RNAguardÔ RNase inhibitor (GE Healthcare, Milwaukee, WI, USA) and units of AMV RT (Roche Diagnostics, Basel, Switzerland) Reaction mixtures were incubated at 42 °C for 60 The reaction was stopped by adding 15 lL of m NaAc (pH 5.2) and 150 lL of cold ethanol Samples were resolved by electrophoresis in a denaturing 6% polyacrylamide gel Primer extension products were quantified with Quantity One software package (Bio-Rad Laboratories, Hercules, CA, USA) and excision efficiency was measured as 100[S ⁄ (S + Pr)] In vivo retrohoming assays The mobility of RmInt1 was revealed by a two-plasmid assay and further Southern hybridization [27,30] A donor plasmid (pKG2.5 or IEP mutant derivatives) containing the full-length intron flanked by a 640 bp fragment ()174 ⁄ +466) of ISRm2011-2 was transferred from E coli DH5a to S meliloti RMO17, an RmInt1-less strain The rhizobial host contained a recipient plasmid bearing a 640 bp fragment with the intron insertion site in the same (pJB0.6LAG) or opposite (pJB0.6LEAD) orientation to the replication fork The recipient plasmid pJBD129, which lacks the RmInt1 target, was used as a negative control in 252 these assays Plasmids isolated from transconjugants were analyzed by SalI digestion, agarose gel electrophoresis and Southern blotting with an ISRm2011-2 probe Generally, we could obtain three hybridization bands: the linearized donor plasmid (7859 bp), a fragment of the recipient plasmid containing the intron DNA target (2017 bp) and an extra band when the recipient plasmid has been invaded (3901 bp) Single- and double-stranded DNA cleavage assays DNA cleavage assays were performed essentially as previously described [29] RNP-enriched fractions were incubated with a 70-mer [5¢-32P]-labeled DNA oligonucleotide or a 70 bp labeled PCR product ([5¢-32P]-labeled top strand) to check top-strand cleavage Single-stranded DNA substrate (ssDNA70) was obtained by labeling 100 pmol of HPLC-purified primer WT (5¢-AATTGATCCCGCCCG CCTCGTTTTCATCGATGAGACCTGGACGAAGACGA ACATGGCGCCGCTGCGGGGC-3Â) using 50 lCi of [c-32P]ATP (3000 Ciặmmol)1; GE Healthcare) and 100 units of T4 polynucleotide kinase (New England Biolabs Inc., Ipswich, MA, USA) The double-stranded DNA substrates (dsDNA70) used in top-strand cleavage and reverse splicing assays were obtained in the same way The oligonucleotide WT was used as a template for amplification of a 70 bp PCR product with [5¢-32P]-labeled S70ds ⁄ UP (5¢-AATTGATCCCGCCCGCCTC-3¢) and S70ds ⁄ DN (5¢-GCCCCG CAGCGGCGCCATGTT-3¢) primers For PCR, we added 2.5 · 10)3 pmol of primer template, 50 pmol of each oligomer, 20 pmol of dNTP equimolar mix and 0.2 units of Vent polymerase (New England Biolabs) The amplification conditions were: 94 °C for min, followed by 25 cycles of 94 °C for 30 s and 60 °C for 30 s, with a final extension at 72 °C for Both substrates were gel-purified, eluted overnight in TE and 0.5 mm ammonium acetate and precipitated in ethanol For the assays, the 32P-labeled DNA substrates (300 000 c.p.m.) were incubated for 35 at 37 °C with 0.2 A260 units of RNP-enriched fractions in 10 lL of reaction medium containing 10 mm KCl, 25 mm MgCl2, 50 mm Tris-HCl (pH 7.5) and mm dithiothreitol The reactions were stopped by extraction with phenol–chlorofom–isoamyl alcohol (25 : 24 : 1) in the presence of 0.25 m sodium acetate and 0.2% linear acrylamide as a carrier The products generated were precipitated in ethanol and analyzed by electrophoresis in a denaturing 6% (w ⁄ v) polyacrylamide gel, which was dried and quantified with Quantity One software package (Bio-Rad Laboratories) Acknowledgements ´ We would like to thank Ascension Martos Tejera ´ and Vicenta Millan Casamayor for their technical FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS ´ M D Molina-Sanchez et al assistance This work was supported by research grant BIO2008-00740 from the Ministerio de Ciencia y Tecnologı´ a and grant CVI-01522 from Junta de Andalucı´ a M.D.M.-S was supported by a predoctoral fellowship from Junta de Andalucı´ a References Michel F & Ferat JL (1995) Structure and activities of group II introns Annu Rev Biochem 64, 435–461 Michel F, Umesono K & Ozeki H (1989) Comparative and functional anatomy of group II catalytic introns – a review Gene 82, 5–30 Carignani G, Groudinsky O, Frezza D, Schiavon E, Bergantino E & Slonimski PP (1983) An mRNA maturase is encoded by the first intron of the mitochondrial gene for the subunit I of cytochrome oxidase in S cerevisiae Cell 35, 733–742 Moran JV, Mecklenburg KL, Sass P, Belcher SM, Mahnke D, Lewin A & Perlman PS (1994) Splicing defective mutants of the COXI gene of yeast mitochondrial DNA: initial definition of the maturase domain of the group II intron aI2 Nucleic Acids Res 22, 2057–2064 Saldanha R, Chen B, Wank H, Matsuura M, Edwards J & Lambowitz AM (1999) RNA and protein catalysis in group II intron splicing and mobility reactions using purified components Biochemistry 38, 9069–9083 Matsuura M, Noah JW & Lambowitz AM (2001) Mechanism of maturase-promoted group II intron splicing EMBO J 20, 7259–7270 Lambowitz AM, Caprara MG, Zimmerly S & Perlman PS (1999) Group I and group II ribozymes as RNPs: clues to the past and guides to the future In The RNA World, 2nd edn (Gesteland RF, Cech RF & Atkins JF eds), pp 451–485 Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Belfort M, Derbyshire V, Parker MM, Cousineau B & Lambowitz AM (2002) Mobile introns: pathways and proteins In Mobile DNA II (Craig NL, Craigie R, Gellert M & Lambowitz AM eds), pp 761–783 ASM Press Publishers, Washington, DC Lambowitz AM & Zimmerly S (2004) Mobile group II introns Annu Rev Genet 38, 1–35 10 Mohr G, Perlman PS & Lambowitz AM (1993) Evolutionary relationships among group II intron-encoded proteins and identification of a conserved domain that may be related to maturase function Nucleic Acids Res 21, 4991–4997 11 San FilippoJ & Lambowitz AM (2002) Characterization of the C-terminal DNA-binding ⁄ DNA endonuclease region of a group II intron-encoded protein J Mol Biol 324, 933–951 Group II intron maturase C-terminal region 12 Cui X, Matsuura M, Wang Q, Ma H & Lambowitz AM (2004) A group II intron-encoded maturase functions preferentially in cis and requires both the reverse transcriptase and X domains to promote RNA splicing J Mol Biol 340, 211–231 13 Blocker FJH, Mohr G, Conlan LH, Qi L, Belfort M & Lambowitz A (2005) Domain structure and threedimensional model of a group II intron-encoded reverse transcriptase RNA 11, 14–28 14 Gorbalenya AE (1994) Self-splicing group I and group II introns encode homologous (putative) DNA endonucleases of a new family Protein Sci 3, 1117–1120 15 Shub DA, Goodrich-Blair H & Eddy SR (1994) Amino acid sequence motif of group I intron endonucleases is conserved in open reading frames of group II introns Trends Biochem Sci 19, 402–404 16 Zimmerly S, Guo H, Eskes R, Yang J, Perlman PS & Lambowitz AM (1995) A group II intron RNA is a catalytic component of a DNA endonuclease involved in intron mobility Cell 83, 529–538 17 Guo H, Zimmerly S, Perlman PS & Lambowitz AM (1997) Group II intron endonucleases use both RNA and protein subunits for recognition of specific sequences in double-stranded DNA EMBO J 16, 6835–6848 18 Matsuura M, Saldanha R, Ma H, Wank H, Yang J, Mohr G, Cavanagh S, Dunny GM, Belfort M & Lambowitz AM (1997) A bacterial group II intron encoding reverse transcriptase, maturase, and DNA endonuclease activities: biochemical demonstration of maturase activity and insertion of new genetic information within the intron Genes Dev 11, 2910–2924 19 Singh NN & Lambowitz AM (2001) Interaction of a group II intron ribonucleoprotein endonuclease with its DNA target site investigated by DNA footprinting and modification interference J Mol Biol 309, 361– 386 20 Toor N, Hausner G & Zimmerly S (2001) Coevolution of group II intron RNA structures with their intron-encoded reverse transcriptases RNA 7, 1142–1152 21 Zimmerly S, Hausner G & Wu X (2001) Phylogenetic relationships among group II intron ORFs Nucleic Acids Res 29, 1238–1250 ´ ´ ´ 22 Toro N, Molina-Sanchez MD & Fernandez-Lopez M (2002) Identification and characterization of bacterial class E group II introns Gene 299, 245–250 23 Ferat JL, Le Gouar M & Michel F (2003) A group II intron has invaded the genus Azotobacter and inserted within the termination codon of the essential groEL gene Mol Microbiol 49, 1407–1423 24 Toro N (2003) Bacteria and archaea group II introns: additional mobile genetic elements in the environment Environ Microbiol 5, 143–151 FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS 253 ´ M D Molina-Sanchez et al Group II intron maturase C-terminal region ´ 25 Toro N, Jimenez-Zurdo JI & Garcı´ a-Rodrı´ guez FM (2007) Bacterial group II introns: not just splicing FEMS Microbiol Rev 31, 342–358 26 Simon DM, Claske NA, McNeil BA, Johnson I, Pantuso D, Dai L, Chai D & Zimmerly S (2008) Group II introns in Eubacteria and Archaea: ORF-less introns and new varieties RNA 14, 1704–1713 27 Martı´ nez-Abarca F, Garcı´ a-Rodrı´ guez FM & Toro N (2000) Homing of a bacterial group II intron with an intron-encoded protein lacking a recognizable endonuclease domain Mol Microbiol 35, 1405– 1412 28 Dai L & Zimmerly S (2002) Compilation and analysis of group II intron insertions in bacterial genomes: evidence for retroelement behavior Nucleic Acids Res 30, 1091–1102 29 Munoz-Adelantado E, San Filippo J, Martı´ nez-Abarca ˜ F, Garcı´ a-Rodrı´ guez FM, Lambowitz AM & Toro N (2003) Mobility of the Sinorhizobium meliloti group II intron RmInt1 occurs by reverse splicing into DNA, but requires and unknown reverse transcriptase priming mechanism J Mol Biol 327, 931–943 ´ ´ 30 Martı´ nez-Abarca F, Barrientos-Duran A, Fernandez´ Lopez M & Toro N (2004) The RmInt1 group II intron has two different retrohoming pathways for mobility using predominantly the nascent lagging strand at DNA replication forks for priming Nucleic Acids Res 32, 2880–2888 ´ 31 Jimenez-Zurdo JI, Garcı´ a-Rodrı´ guez FM, Barrientos´ Duran A & Toro N (2003) DNA target site requirements for homing in vivo of a bacterial group II intron encoding a protein lacking the DNA endonuclease domain J Mol Biol 326, 413–423 254 32 Costa M, Michel F & Toro N (2006) Potential for alternative intron-exon pairings in group II intron RmInt1 from Sinorhizobium meliloti and its relatives RNA 12, 338–341 ´ 33 Molina-Sanchez MD, Martı´ nez-Abarca F & Toro N (2006) Excision of the Sinorhizobium meliloti group II intron RmInt1 as circles in vivo J Biol Chem 281, 28737–28744 34 Crooks GE, Hon G, Chandonia JM & Brenner SE (2004) WebLogo: a sequence logo generator Genome Res 14, 1188–1190 35 Schneider TD & Stephens RM (1990) Sequence logos: a new way to display consensus sequences Nucleic Acids Res 18, 6097–6100 Supplementary information The following supporting information is available: Fig S1 Retrohoming in vivo of wild-type intron and C-terminal region mutant derivatives using RmInt1engineering constructs DORF Table S1 List of RmInt1 IEP mutants with the corresponding oligonucleotides used in its construction This supplementary material can be found in the online version of this article Please note: As a service to our authors and readers, this journal provides supporting information supplied by the authors Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset Technical support issues arising from supporting information (other than missing files) should be addressed to the authors FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS ... the N-terminus of the RT domain is required for protein interactions with the high-affinity binding site in subdomain DIVa of the intron, whereas other regions of the RT and domain X interact with... unlike lactococcal and yeast introns, the RmInt1 IEP and the members of Group II intron maturase C-terminal region this class lack the C-terminal D ⁄ En region [11,14,21,24,27,28] In vitro assays... et al Group II intron maturase C-terminal region A B C Fig Effect of RmInt1 IEP C-terminal mutations on intron RNA splicing (A) Detailed sequence of the C-terminal region of the RmInt1 IEP Highly