Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 Hui-Jun Wu1,*, Yang Yang1,*, Shuai Wang2,*, Jun-Qing Qiao1, Yan-Fei Xia1, Yu Wang1, Wei-Duo Wang1, Sheng-Feng Gao1, Jun Liu1, Peng-Qi Xue1 and Xue-Wen Gao1 Department of Plant Pathology, College of Plant Protection, Nanjing Agricultural University, Key Laboratory of Monitoring and Management of Crop Diseases and Pest Insects, Ministry of Agriculture, China Key Laboratory of Synthetic Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, China Keywords aspartate aminotransferase; Bacillus subtilis; conserved active residues; kinetic parameters; protein sequence analysis Correspondence X.-W Gao, Department of Plant Pathology, College of Plant Protection, Nanjing Agricultural University, Key Laboratory of Monitoring and Management of Crop Diseases and Pest Insects, Ministry of Agriculture, Nanjing 210095, China Fax: +86 25 84395268 Tel: +86 25 84395268 E-mail: gaoxw@njau.edu.cn *These authors contributed equally to this work (Received December 2010, revised 20 January 2011, accepted 11 February 2011) doi:10.1111/j.1742-4658.2011.08054.x In the present study, we report the identification of a new gene from the Bacillus subtilis B3 strain (aatB3), which comprises 1308 bp encoding a 436 amino acid protein with a monomer molecular weight of 49.1 kDa Phylogenetic analyses suggested that this enzyme is a member of the Ib subgroup of aspartate aminotransferases (AATs; EC 2.6.1.1), although it also has conserved active residues and thermostability characteristic of Ia-type AATs The Asp232, Lys270 and Arg403 residues of AATB3 play a key role in transamination The enzyme showed maximal activity at pH 8.0 and 45 °C, had relatively high activity over an alkaline pH range (pH 7.0–9.0) and was stable up to 50 °C AATB3 catalyzed the transamination of five amino acids, with L-aspartate being the optimal substrate The Km values were determined to be 6.7 mM for L-aspartate, 0.3 mM for a-ketoglutarate, 8.0 mM for L-glutamate and 0.6 mM for oxaloacetate A 32-residue N-terminal amino acid sequence of this enzyme has 53% identity with that of Bacillus circulans AAT, although it is absent in all other AATs from different organisms Further studies on AATB3 may confirm that it is potentially beneficial in basic research as well as various industrial applications Database The nucleotide sequence data have been deposited in the GenBank database under accession Numbers AY040867.1 Introduction Aspartate aminotransferases (AAT; EC 2.6.1.1) catalyze the reversible reaction of transamination between four- and five-carbon dicarboxylic amino acids and the corresponding a-keto-acids by a ping-pong, bi-bi mechanism, with pyridoxal 5¢-phosphate (PLP) as an essential cofactor [1] The enzyme plays a key role in the metabolic regulation of carbon and nitrogen metabolism in all organisms [2] In eukaryotes, AAT along with malate dehydrogenase comprise a system (i.e the malate-aspartate shuttle) for transporting reducing equivalents across organellar membranes [3] In prokaryotes, AAT represents a central enzyme in metabolism of the Krebs citric acid cycle intermediates For example, AAT converts newly-formed organic nitrogen to the nitrogen carriers, Glu and Asp, and the formation of Asp is used to generate several essential amino acids such as Asn, Met, Thr, Lys and Ile AATs regenerate the carbon skeletons Abbreviations AAT, aspartate aminotransferase; PLP, pyridoxal 5¢-phosphate FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS 1345 Identification of a new aspartate aminotransferase H.-J Wu et al (a-ketoglutarate) for further primary nitrogen assimilation [4] AATs from many species have been classified into the aminotransferase family I and then divided into two subgroups, Ia and Ib, on the basis of their amino acid sequences [5,6] The Ia subgroup contains AATs from eubacteria and eukaryotes, such as Escherichia coli, yeast, chickens and pigs, whereas Ib includes those from thermophilic eubacteria and thermoacidophilic archaebacteria, such as Thermus thermophilus HB8 [6], Bacillus sp YM-2 [7] and Rhizobium meliloti [8] More recently, a novel prokaryote-type AAT was identified in plants belonging to the Ib subfamily in eukaryotic organisms [2,9] The amino acid sequence identities between subgroups Ia and Ib are only $ 15% Up until now, the most extensively investigated AATs, with studies reported on their structure as well as their function, are those from subgroup Ia, whereas much less is known about AATs from subgroup Ib Recently, the 3D structures of the subgroup Ib AATs from T thermophilus, Phormidium lapideum and Thermotoga maritima were solved, showing that the structures of the enzymes in subgroups Ia and Ib are very similar [10–12] and that the active site residues are well-conserved [6] X-ray crystallographic studies in conjunction with site-directed mutagenesis experiments have elucidated the function of several conserved active residues of AAT The Tyr70 is hydrogen bonded to the phosphate group of the co-enzyme PLP and stabilizes the transition state [13] The Asn194 and Tyr225 residues regulate the electron distribution through hydrogenbonding to O (3¢) of the co-enzyme PLP [14] Asp222 serves as a protein ligand tethering the co-enzyme in a productive mode within the active site and stabilizes the protonated N(1) of the co-enzyme to strengthen the electron-withdrawing capacity of the co-enzyme [15] The active site Lys258 transfers a proton from the amino acid substrate to the cofactor and forms an internal Schiff base with the cofactor [16] Arg292 of the large domain in subgroup Ia AAT recognizes the distal carboxyl groups of dicarboxylate substrates [17]; however, this residue is not found in the corresponding regions of subgroup Ib, and the Lys109 residue performs this function instead in subgroup Ib [18] Arg386 of the small domain binding the a-COO) of the substrate plays a key role in the activity of the enzyme [19,20] The functions of the above-mentioned conserved active residues were all identified by using the AAT from E coli as the template, except for that of the Lys109 residue in subgroup Ib, which was determined from the AAT of T thermophilus 1346 In Bacillus spp., AAT plays a very important role in the Krebs cycle, which synthesizes aspartate from oxaloacetate and is also involved in the synthesis of several essential amino acids [21] AATs have been isolated and characterized from several Bacillus spp In B subtilis 168, the AAT is encoded by the aspB gene, which appears to be constitutively expressed [22] However, there are four other putative AATs in B subtilis 168 based on whole genome analysis The AAT from alkalophilic Bacillus circulans contains an additional N-terminal sequence of 32 amino acid residues, which functions to stabilize the structure over a wide pH range and to prevent aromatic fluorophores from quenching by water [23] A preliminary X-ray structure of the AAT from Bacillus sp YM-2 has been obtained [7] More recently, aminotransferases were divided into six subgroups and classified from B subtilis as members of the If subgroup instead of the Ia subgroup [24] However, the generally accepted view is that AAT from B subtilis is a member of the Ib subgroup In the present study, a new gene aatB3 (accession number AY040867) encoding an AAT was cloned from the B subtilis B3 strain and analyzed phylogenetically We also describe the expression in E coli and characterization of the recombinant enzyme by determining the optimum pH and temperature, substrate specificities, kinetic parameters and the active-site residues Results DNA and protein sequence analysis The aatB3 gene and its regulatory element within a 3642 bp genomic region of B subtilis B3 were previously sequence (accession number AY040867) [25] By analysis using software available online (as described in the Materials and methods), the sequence of the aatB3 gene was shown to comprise 1308 bp, including an ATG initiation codon and a TGA termination codon The G+C ratio of the ORF is 48.6%, which is $ 2% and 6% higher than the genomic G+C ratio of Bacillus amyloliquefaciens FZB42 (46.4%) and B subtilis 168 (43.5%) [26], respectively The deduced 436 amino acid product of aatB3 was predicted to have a molecular weight of 49.1 kDa, which is slightly lower than the value obtained on SDS ⁄ PAGE ($ 55 kDa) This difference is the result of an additional 38 amino acid sequence including a · His tag fused to the N-terminus of AATB3 The calculated isoelectric point of AATB3 is $ 5.4 The putative promoter and ribosomal binding site regions were found upstream of the aatB3 gene The promoter has a typical )35, )10 and transcription start site, and there is a rho-independent FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS H.-J Wu et al Identification of a new aspartate aminotransferase transcription terminator flanking the stop codon of the aatB3 gene The amino acid sequence of AATB3 showed 97– 98% identities with the putative AATs from other B subtilis strains, although their enzymatic activities have not been identified From the protein sequence alignment of AATB3 and ATTs from several other organisms (Fig 1), the AATB3 showed 56% identity with B circulans AAT, and 16% and 14% with Bacillus sp YM-2 and T thermophilus HB8 AATs, respectively The latter two AATs belong to subgroup Ib [5,6], although AATB3 showed 12% and 10% identities, respectively, with the E coli and pig cytosolic AATs, which belong to subgroup Ia [5,6] Therefore, based on the results described above, it appeared that the AATs from B subtilis and B circulans should belong to subgroup Ib Expression and purification of AATB3 and its mutants To produce recombinant AATB3 and the three mutant proteins, the aatB3 gene and its mutants were expressed in E coli The recombinant proteins were purified by a single chromatographic step using Ni2+-nitrilotriacetic acid metal-chelating affinity chromatography as described in the Materials and methods The purified enzyme and three mutants each migrated as a single band on SDS ⁄ PAGE with a molecular weight of $ 55.0 kDa (Fig 2A), which is identical to the calculated value The sizes of the AATB3 protein and its mutant proteins were slightly larger than the natural forms (49.1 kDa) as a result of the additional 38 amino acids, including a · His Tag sequence for affinity chromatography fused to the N-terminus Activities and functions of AATB and its mutants To determine whether this new AAT from B subtilis B3 might also have AAT activity, the enzymatic activity of the recombinant AATB3 expressed and purified from E coli was analyzed Native PAGE analysis showed that the wild-type AATB3 had AAT activity when l-aspartate and the a-ketoglutarate were used as amino donor and acceptor, respectively (Fig 2C) In the paper chromatography analysis of amino acids (Fig 3), the AATB3 also demonstrated the ability to transfer the a-amino of the l-tryptophan to a-ketoglutarate and oxaloacetate to produce l-glutamate (Fig 3A) and l-aspartate, respectively (Fig 3B) The results of the spectrophotometry analysis showed that AATB3 also has weak l-tyrosine and l-phenylalanine aminotransferase activities (Table 1) Fig Alignment of sequences of AATs Alignment was performed using CLUSTAL X [29] B.B3, B subtilis B3; B.circ., B circulans; B.YM, Bacillus sp YM2; T.th., T thermophilus HB8; cPig, pig cytosolic Gaps in the alignment are shown by gray dashes Identical residues are shown in black; similar residues are shown in gray To confirm which residues play key roles in the interaction between B subtilis B3 AAT and PLP, the Asp232 and Lys270 residues (corresponding to Asp222 and Lys258 in E coli AAT) were replaced with Asn and His using site-directed mutagenesis to obtain the mutants D232N and K270H, respectively The Asp232 fi Asn replacement led to a loss of the negative charge at position 232, and the Lys270 fi His replacement introduced an imidazole ring into the enzyme and changes the structure of the enzyme No enzymatic activities were determined on native gels for the D232N and K270H mutant enzymes (Fig 2C), which is consistent with the spectrophotometry FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS 1347 Identification of a new aspartate aminotransferase H.-J Wu et al Table Activity of purified AATB3 towards different amino acids and oxo acids The reaction was performed at 25 °C for 20–40 The activity was measured as described in the Materials and methods Concentration (mM) Amino donora L-aspartate L-glutamate L-tryptophan L-tyrosine L-phenylalanine Amino acceptorb a-ketoglutarate Oxaloacetate Relative activity (%) 30 30 6 100.0 46.7 1.7 0.4 0.3 10 10 100.0 81.5 a The AAT from B subitilis B3 showed relative high activity toward and L-glutamate, although the activities were very weak toward three aromatic amino acid aminotransferases (L-tryptophan, L-tyrosine and L-phenylalanine) Therefore, 30 mM was used for L-aspartate and L-glutamate, and mM for the three aromatic amino acid substrates a-ketoglutarate (10 mM) was used as amino group acceptor except for the oxaloacetate (10 mM) used for L-glutamate The activity of L-aspartate was adjusted to 100 b 30 mM L-aspartate was used as amino donor for a-ketoglutarate, and 30 mM L-glutamate was used as amino donor for oxaloacetate The activity of a-ketoglutarate was adjusted to 100 L-aspartate Fig Purification and functional analysis of the recombinant wildtype (WT) and mutant AATB3 enzymes (A) Aliquots of purified enzyme for the wild-type and each AATB3 mutant were separated by SDS ⁄ PAGE and stained with Coomassie Brilliant Blue (B) Aliquots of purified enzyme for the wild-type and each AATB3 mutant were separated by native PAGE and stained with Coomassie Brilliant Blue (C) Native PAGE gel was stained with Fast Blue in accordance with the method described by de la Torre et al [9] of Arg403 (corresponding to Arg386 in E coli AAT) in B subtilis B3, the R403Y mutant enzyme was constructed The Arg403 fi Tyr replacement disrupted the PLP-Asn194-Arg403 hydrogen-bond linkage system and changed the conformation of the active center of the enzyme The enzyme activity analysis showed that the R403Y mutant also lost transamination activity (Fig 2C) These results showed that the Asp232, Lys270 and Arg403 residues of B subtilis B3 AAT play key roles in transamination Comparison and alignment of AAT sequences Fig Detection of L-tryptophan aminotransferase activity using paper chromatography of amino acids (A) the a-ketoglutarate was used as the amino acceptor; L-Glu, standard L-Glu; L-Try, standard L-Try; 1-3, reaction sample (B) The oxaloacetate was used as the amino acceptor; L-Asp, standard L-Asp; L-Try, standard L-Try; 1–3, reaction sample analysis These two mutants also lost their transamination ability when using l-Trp and l-Phe as amino donors (data not shown) To determine the exact role 1348 To confirm the exact contributions of the Asp232, Lys270 and Arg403 residues to the function of B subtilis B3 AAT, the deduced amino acid sequence was compared with the five AATs identified from B circulans, pig cytosolic, E coli, T thermophilus HB8 and Bacillus sp YM-2 The alignment results revealed 19 invariant amino acids in these six AATs (Fig 1) Among these conserved residues, the Tyr70, Asn194, Asp222, Tyr225, Lys258 and Arg266 residues in E coli AAT (numbered on the basis of the pig cytosolic AAT) are involved in the binding of PLP, which acts as the co-enzyme [19,27] The Asp232 and Lys270 residues in B subtilis B3 AAT correspond to Asp222 and Lys258, respectively, in E coli AAT Together with FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS H.-J Wu et al analysis of the activities of the mutants D232N and K270H (Fig 2C), we concluded that Asp232 in B subtilis B3 AAT, which corresponds to Asp222 in E coli AAT [15], is the residue that enhances the function of the enzyme-bound co-enzyme PLP The Lys270 residue of B subtilis B3 AAT serves the same function as Lys258 in E coli AAT, which binds to PLP and forms an internal Schiff base [16] The conserved residues Asn194 and Arg386 in E coli AAT participate in substrate binding [14,20], which correspond to Asn199 and Arg403, respectively, in B subtilis B3 AAT The loss of transamination activity of the R403Y mutant confirmed that the B subtilis B3 AAT utilizes the Arg403 residue to bind the a-COO) of the substrate, which is similar to the role of Arg386 in E coli AAT The Arg292 residue, which is the invariant residue in the subgroup Ia AATs [17] identified in the primary structure of B subtilis B3 and B circulans AATs, interacts directly with the distal carboxyl groups of dicarboxylate substrates (Fig 1) However, this residue is not found in the corresponding regions of subgroup Ib By contrast, the conserved active residue Lys109 in subgroup Ib carries out the function of recognizing the substrates as does the Arg292 residue in subgroup Ia [18] From the alignment, the Thr109 was shown also to be conserved in B subtilis B3, B circulans, E coli and pig cytosolic AATs, and the Trp140 invariant among the six AATs (Fig 1) These two residues provide hydrogen bonds to the phosphate group and distal carboxyl group of the substrate [27,28] Molecular phylogeny To examine the phylogenetic relationship of this new bacteria gene with AAT genes from plants, animals, protozoa, eubacteria and archeabacteria, a phylogram was constructed using the Neighbor-joining method with 44 full-length AAT amino sequences from GenBank As shown in Fig 4, the AATs were divided into six main branches: animal mitochondrial, animal cytoplasmic, plant mitochondrial, plant cytoplasmic and the two branches in bacteria The AAT from B subtilis B3, clustering together with the AAT from B circulans, is in the large branch of bacterial AATs From the phylogenetic tree analysis, the AATs from different organisms can also be divided into two major subgroups according to the classification system established by Jensen and Gu [5] The Ia subgroup contains eubacterial and eukaryotic AATs, including enzymes from E coli, Haemophilus influenzae, animals and plants The Ib subgroup consists almost exclusively of AATs from prokaryotes, including AATs from proto- Identification of a new aspartate aminotransferase zoa, archaebacteria and bacteria Interestingly, plants also have Ib subgroup-prokaryote-type AATs [2,9] Although the AATs from B subtilis B3 and B circulans belong to the Ib subgroup in our analysis, these new AATs show significant differences from other Ib subgroup-type AATs They occupy a small separate branch at a far phylogenetic distance from AATs belonging to another large branch of the Ib subgroup From the homology analysis, the identity between the two AATs from B subtilis B3 and B circulans was $ 56%, and the AAT from B subtilis B3 showed relatively high identity ($ 19%) with the AAT from Synechocystis sp compared to other AATs from the Ib subgroup Enzyme specificity and kinetics parameters The purified AATB3 was optimally active at 45 °C (at pH 7.2), and more than 80% of the maximum activity was retained in the temperature range 25–55 °C (Fig 5A) After incubation at 50 °C for 30 min, the enzyme had more than 85% of the maximum activity (Fig 5B) When incubated at 60 °C for 15 min, the enzyme also had 65% activity, although increasing the treatment time to 30 caused the enzyme to lose almost all activity Above 65 °C, the stability of the enzyme decreased rapidly (Fig 5B) The optimal pH for the enzyme activity was pH 8.0 at the optimal temperature (45 °C) (Fig 5C) The enzyme activity over the pH range 7.0–8.6 was more than 80% of the maximum activity From these results, we demonstrated that AATB3 tended to have relatively high activity and stability in alkaline environments Table summarizes the effect of some metal ions on the activity of the purified aminotransferase At a low concentration (1 mm), Cu2+ and Mn2+ could inhibit the activity of the purified aminotransferase, and other metal ions had no remarkable effects, although Ca2+ and Co2+ could promote the reaction to some extent Partial inhibition was observed in the presence of some metal ions at 10 mm, and the order of the ions by enzyme inhibitory activity was Zn2+>Cu2+>Mg2+ >Mn2+ It could be concluded that the enzyme is not metal ion-dependent because EDTA had no inhibitory or stimulatory effects on the activity (Table 2) AATB3 showed transamination activity between various amino acids and a-ketoglutarate (Table 1), with l-aspartate being the best substrate Aromatic amino acids such as l-tryptophan, l-tyrosine and l-phenylalanine were weakly active as amino donors, and the activity of transamination activity toward l-tryptophan was relatively higher than the other two residues FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS 1349 Identification of a new aspartate aminotransferase H.-J Wu et al Fig Phylogenetic tree of AATs from different organisms The phylogenetic tree was constructed with full-length AAT amino acid sequences using the Neighbor-joining method of MEGA 4.0 Bootstrap values are expressed as percentages of 1000 replications Bar 0.1 sequence divergence c, cytosolic; ch, chloroplastic; cy, cytoplastimic; p, plastidic; m, mitochondrial GenBank accession numbers of the AATs are shown The black circle represents the branch of AAT from B subtilis B3 and B circulans; the black triangle shows the prokaryote-type AATs from plants To further characterize the enzyme, the kinetic parameters Km, Vmax and kcat were determined for the purified AATB3 Values for Km and Vmax for both amino donors (l-aspartate and l-glutamate) and acceptors (a-ketoglutarate and oxaloacetate) were calculated from the double-reciprocal plots The Km values of AATB3 were 6.7, 0.3, 8.0 and 0.6 mm for l-aspartate, a-ketoglutarate, l-glutamate and oxaloacetate, respectively For the amino donors, AATB3 showed more affinity for l-aspartate than l-glutamate, whereas, for the amino acceptors, this enzyme had more affinity for a-ketoglutarate (Table 3) The calculated Vmax for l-aspartate, a-ketoglutarate, l-glutamate and oxaloacetate were 0.23, 0.21, 0.07 and 0.11 mmỈmin)1, respectively (Table 3) The kcat ⁄ Km ratios listed in the Table 3, which represent the catalytic efficiency, show that the enzyme had relative higher catalytic efficiency for oxo acids than for amino acids The enzyme variants D232N, K270H and 1350 R403Y were almost inactive (Fig 2C), and therefore no kinetic parameters could be determined Discussion AATs that catalyze the tricarboxylic acid cycle intermediates to amino acids have been studied in a variety of organisms These enzymes play a key role in aspartate catabolism and biosynthesis as well as in linking carbon metabolism with nitrogen metabolism In the present study, we cloned and characterized such an AAT from the B subtilis B3 strain This enzyme consists of 436 amino acid residues and is encoded by the aatB3 gene We found the typical promoter and terminator regions upstream and downstream, respectively, of this new gene To examine explicitly the phylogenetic relationship between the AATB3 and other AATs from different organisms, a phylogenetic tree was constructed using FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS H.-J Wu et al Identification of a new aspartate aminotransferase Table Effect of metal ions on the activity of purified AATB3 Values represent the means of triplicates relative to the untreated control samples Relative activity (%) Chemicals mM None MgCl2 CaCl2 MnSO4 CuSO4 ZnSO4 CoCl2 EDTA 100 96.9 115.5 90.1 84.3 99.7 122.1 106.4 10 mM ± ± ± ± ± ± ± ± 0.6 4.4 2.7 2.3 2.0 7.4 2.5 10.1 100 34.7 75.7 42.8 4.9 3.1 54.1 99.3 ± ± ± ± ± ± ± ± 0.6 3.1 3.0 7.9 1.3 1.3 4.5 1.8 Table Kinetic parameters for recombinant AATB3 from Bacillus subtilis B3 Kinetic parameters were obtained from double reciprocal plots as described in the Materials and methods Values represent the mean ± SD of three determinations B subtilis B3 AATB3 Substrates L-aspartate L-glutamate a-ketoglutarate Oxaloacetate Fig Characterization of the purified AATB3 (A) Effect of temperature on activity of AATB3 (pH 7.2) (B) Thermostability of AATB3 The enzyme was pre-incubated at 40, 50, 60 or 65 °C for 5, 15 or 30 before the assay (C) Effect of pH on activity of AATB3 The assay was performed at 45 °C in buffers with pH in the range 4.4–10.2 previously characterized AAT sequences from animals, plants and prokaryotes The AATs from B subtilis B3 and B circulans clustered together with other bacterial AATs and appeared to be more closely related to the Ib-type of bacterial AATs than to the Ia-type of other bacterial AATs (Fig 4) However, AATB3 showed low identify with AATs from the Ib subgroup, and the highest identity was only $ 19% compared to AAT from Synechocystis sp (Ib subgroup) Multiple alignments, which were built using AATs of distant species, clearly show that most of the residues interacting with the PLP and the substrates [27,29] are conserved in AATB3 (Fig 1) From this comparison, the AATB3 tends to have more conserved active residues that belong to the Ia subgroup but not exist in the Ib subgroup For example, the Gly38, Thr109 and Arg292 residues (numbered on the basis of Vmax (mMỈL)1Ỉmin) 0.23 0.07 0.21 0.11 30 14 27 22 Km (mM) kcat (s)1) ± ± ± ± 0.03 0.01 0.01 0.01 ± ± ± ± 1 kcat ⁄ Km (mM)1Ỉs)1) 6.68 8.00 0.32 0.60 4.50 1.75 84.38 36.67 ± ± ± ± 1.45 1.32 0.08 0.06 the pig cytosolic AAT), which are conserved in AATB3 and Ia subgroup AATs, are not found in the Ib subgroup AATs These three residues are all involved in the interaction with the substrate [27,28], especially the Arg292 residue, which plays a key role in recognizing the distal carboxylate of the substrate [17] In subgroup Ib, the same role appears to be carried out by Lys109 [18] Therefore, AATB3 is more similar to the AATs from the Ia subgroup than the Ib subgroup in structure We used site-directed mutagenesis to determine the exact role of three residues in AATB3 The loss of the activity from the mutations together with the multiple alignment analysis indicated that the Asp232 residue of AATB3 enhances the function of the enzyme-bound coenzyme PLP and that the Lys270 residue mediates binding of PLP, whereas the Arg403 residue is responsible for recognizing the a-COO) of the substrate These functions are performed by the corresponding residues of Asp222, Lys258 and Arg386 of the AAT from E coli [15,16,19,20] We also described in detail the physicochemical and catalytic properties of AAT from B subtilis B3 The purified enzyme was demonstrated to have an optimal temperature at 45 °C and thermostability of only up to FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS 1351 Identification of a new aspartate aminotransferase H.-J Wu et al 50 °C These characteristics are similar to those of the AAT from E coli [30] and not of AATs from the Ib subgroup, which usually have high thermostability The thermostability appears to be related to the amino acid composition of the AAT Okamoto et al [6] reported that the high Pro content of the Ib-type AAT from T thermophilus (6.5%) will render the enzyme rigid and thermostable The same features are also found in other subgroup Ib AATs, such as Thermus aquaticus YT1 AAT (7.0%) [31] and Phormidium lapdideum (6.1%), as well as the newly found Ib-prokaryote-type AAT in Pinus pinaster (6.4%) [9,11] The Pro content of B subtilis B3 AAT is 4.1%, which is similar to that of subgroup Ia E coli AAT (3.8%) and is much lower than that of subgroup Ib T thermophilus AAT For this reason, the thermostability of B subtilis B3 AAT is similar to that of E coli AAT and is lower than that of T thermophilus AAT by $ 20 °C [6] We showed that the AAT from B subtilis B3 had an optimal pH at 8.0 and had relatively high activity over a wide alkaline pH range (pH 7.0–9.0) This characteristic is similar to that of the AAT from B circulans The B circulans AAT has been reported to have high optimal pH and a wide pH stability range as a result of the N-terminal two a-helical segments, which contain an additional sequence of 32 acid residues not found in many AATs [23] Interestingly, B subtilis B3 AAT also has a similar additional N-terminal sequence of 32 acid residues (Fig 1), which shows 53% identity with that of B circulans AAT, and the additional N-terminus of B subtilis B3 AAT appears to perform the same function as that of B circulans AAT The results obtained in the present study indicate that the AAT from B subtilis B3 can catalyze l-aspartate, l-glutamate, l-tryptophan, l-tyrosine and l-phenylalanine transamination, with l-aspartate being the best substrate However, the activity of AATB3 toward three aromatic amino acids were weak, similar to that of AAT from Bacillus sp YM-2 strain [32], and was unlike AAT from E coli, which was shown to have 22% of the activity of the total tyrosine aminotransferase [33] The Km values for AATB3 were 6.7, 0.3, 8.0 and 0.6 mm for l-aspartate, a-ketoglutarate, l-glutamate and oxaloacetate, respectively Similar to the other AATs, the Km values for oxo acids are lower than that for the amino acids [9,32,34] However, it is worth noting that both kcat and kcat ⁄ Km values are lower than those of AAT from E coli [35] This new AAT phylogenetically belongs to subgroup Ib of AAT, although it also has conserved active residues and thermostability characteristic of Ia-type AATs Although our combined results appear to be contradictory, we propose that the B subtilis gene 1352 described in the present study may have arisen from the interaction between the Ia-type and Ib-type aat genes during evolution A similar phenomenon is seen when the genome segment of B subtilis B3 is compared with those of B subtilis A1 ⁄ and B amyloliquefaciens FZB42 The aatB3 gene frequently appears in the region between the srf operon and sfp gene This region is the putative regulatory region relevant to biosynthesis of the lipopeptides, especially for the sfp gene, which is essential for biosynthesis of the lipopeptides [26] We presume that the aat gene in this region can regulate the biosynthesis of the lipopeptides The experiments performed in the present study showed that this AAT can form Glu and Asp, and the formation of Glu and Asp is used to synthesize Gln and Asn, respectively These four residues are common components in lipopeptides, such as surfactin, iturin and fengycin Another interesting observation was that the B subtilis B3 has another aat gene similar to aspB outside this region This could be explained by the need to synthesize more AATs to provide adequate nutrients (carbon and nitrogen sources) and lipopeptides so as to survive in complex environments and deal with competitors In summary, a new AAT with an additional N-terminal sequence was identified from B subtilis B3 Having both Ia-type and Ib-type characteristics and a high activity over an alkaline pH range, this enzyme may regulate the biosynthesis of lipopeptides and has various potential industrial applications, such as in the synthesis of l-tyrosine, l-phenylalanine and l-homophenylalanine A detailed characterization of the role of B subtilis B3 AAT and its structure are in progress Materials and methods Bacterial strains, plasmids and growth conditions The bacterial strains and plasmids used in the present study are described in Table E coli DH5a was used as the host for amplification of all plasmids, and recombinant proteins were expressed in E coli BL21 B subtilis B3 was used for cloning the aatB3 gene LB broth was used for the growth of E coli and B subtilis strains When required, antibiotics were added at the final concentrations: ampicillin (Amp), 100 lgỈmL)1; kanamycin (Km), 50 lgỈmL)1 DNA manipulation and transformation The isolation and manipulation of recombinant DNA were performed using standard techniques All enzymes used in the present study were purchased from Takara Bio Inc FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS H.-J Wu et al Identification of a new aspartate aminotransferase Table Bacterial strains and plasmids used in the present study Resistance markers were: Ampr, ampicillin resistance; Kmr, kanamycin resistance Strain or plasmid Strains E coli DH5a BL21(DE3) B subtilis B3 Plasmids pET30a(+) pUC19 pETAAT pUCAAT pUCD232N pUCK270H pUCR403Y pETD232N pETK270H pETR403Y a Relevant genotype or characteristics Source or reference F) F80dlacZ DM12 minirecA F) ompT hsdSB(rB) mB)) gal dcm(DE3) Stored in this laboratorya Stored in this laboratory Wild-type; bacillomycin D and fengycin producer Present study T7 promoter-based expression vector; Kmr Novagen (Merck KGaA, Darmstadt, Germany) Stored in this laboratory Present study E coli clone vector; lacZ; Ampr The aatB3 fragment was inserted into KpnI and EcoRI sites of pET30a(+) for the expression of protein AATB3; T7 promoter-based expression vector; Kmr The aatB3 fragment was inserted into KpnI and EcoRI sites of pUC19 for construction the mutant of AATB3 protein; Ampr pUC19 carrying a fragment encoding the D232N mutant; Ampr pUC19 carrying a fragment encoding the K270H mutant; Ampr pUC19 carrying a fragment encoding the R403Y mutant; Ampr The fragment from pUCD232N was inserted into KpnI and EcoRI sites of pET30a(+) for the expression of protein D232N; T7 promoter-based expression vector; Kmr The fragment from pUCK270H was inserted into KpnI and EcoRI sites of pET30a(+) for the expression of protein K270H; T7 promoter-based expression vector; Kmr The fragment from pUCR403Y was inserted into KpnI and EcoRI sites of pET30a(+) for the expression of protein R403Y; T7 promoter-based expression vector; Kmr Present study Present Present Present Present study study study study Present study Present study Key Laboratory of Monitoring and Management of Crop Diseases and Pest Insects, Ministry of Agriculture, Nanjing, China Table Oligo DNA primers used in the present study Restriction sites or mutation sites in primers are underlined Name Sequence of primers (5¢- to 3¢) P1 P2 D232N-F D232N-R K270H-F K270H-R R403Y-F R403Y-R GGTACCATGAATGATGCAGCAAAAG (KpnI) GAATTCTCAGCCTGATATTTCCGCCT (EcoRI) CGTGCTCGTAAACGATGCGTATTAC ACAATCTCTTTGCCGGCCTCCGC GGCGCGACGCACGAAAATTACGC GTCTATTTTCACGCAAAGCACCCGGT AAACCGATTTGTACATCGCATTTTC CATTAATGGATATCGTTCCGATTCC firmed by sequencing (Invitrogen Biotechnology Co., Ltd, Shanghai, China) (Otsu, Japan) The specific primers used for the PCR are described in Table The original sequence of the aatB3 gene was obtained through the B subtilis B3 gene library constructed in a previous study (accession number AY040867) [25] To express the recombinant AATB3 protein in E coli, the entire aatB3 ORF was amplified using primers P1 and P2 using B subtilis B3 chromosomal DNA as the template; the amplified product was digested with KpnI and EcoRI, and cloned into the same sites of the cloning vector pUC19 and expression vector pET30a(+), resulting in the plasmids pUCAAT and pETAAT, respectively The entire cloned regions were con- Site-directed mutagenesis via PCR Single mutations were introduced into the cloned AATB3 using the Takara MutanBEST Kit (Takara) Reactions were carried out using the primer pairs: for D232N, D232N-F and D232N-R; for K270H, K270H-F and K270H-R; and, for R403Y, R403Y-F and R403Y-R The pUCAAT vector was used as a template The introduced mutations in the aatB3 gene were confirmed by DNA sequencing The resulting vectors were designated pUCD232N, pUCK270H and pUCR403Y, and the three different DNA fragments carrying mutant aatB3 genes from these vectors were subcloned into the KpnI and EcoRI restriction sites of the pET30a(+) expression vector to obtain pETD232N, pETK270H and pETR403Y, respectively Expression and purification of recombinant wild-type and mutant AATB3 enzymes The E coli strain BL21 (DE3) was transformed with pETAAT or the three expression plasmids carrying different FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS 1353 Identification of a new aspartate aminotransferase H.-J Wu et al mutant aatB3 genes The transformants were cultivated at 37 °C with shaking in LB medium containing 50 lgỈmL)1 kanamycin until D600 of 0.5–0.7 was reached Flasks containing the cultures were supplemented with isopropyl thiob-d-galactoside at a final concentration of mm After incubation at 37 °C for a further h with vigorous shaking, the cells were harvested by centrifugation at 6000 g for 20 The cell pellets were resuspended in a buffer containing 20 mm potassium phosphate, 500 mm NaCl, 5% glycerol and 20 mm imidazole buffer at pH 7.3 Cells were lysed by sonication, and cell debris was removed by centrifugation at 10 000 g for 20 The recombinant enzymes were purified by a single chromatographic step using HisTrapHP (GE Healthcare, Milwaukee, WI, USA) The column was loaded with the bacterial cell lysate, and the non-adherent proteins were removed by rinsing with 20 volumes of wash buffer (20 mm potassium phosphate, pH 7.3, 5% glycerol, 500 mm NaCl, 20 mm imidazole) The proteins were eluted with a gradient of 10–500 mm imidazole in wash buffer The purified enzymes were stored at )20 °C after salt removal using the HiTrap Desalting columns (GE Healthcare) Protein concentrations were measured with a BCA-100 protein quantitative analysis kit (Biocolor Biotech, Shanghai, China) using BSA as the standard A paper chromatography assay for amino acids was also used to detect the activity toward tryptophan The reaction was performed as described above, and a-ketoglutarate and oxaloacetate were used as amino acceptors At the end of the reaction, 10 lL of the reaction solution was spotted onto a filter paper and separated by chromatography (n-butyl alcohol ⁄ ethanol ⁄ water at : : 1, v ⁄ v) Subsequently, the filter paper was sprayed with 0.1% ninhydrin After drying, the products of the amino acid on the filter paper were displayed purple in color To determine the effects of pH, temperature and inhibitors, l-aspartate and a-ketoglutarate were used as amino donor and acceptor, respectively, and the reactions were performed as described above To investigate the effect of pH at the optimum temperature (45 °C), three buffered systems at a final concentration of 50 mm were used: acetate ⁄ sodium acetate (pH 4.4–6.0), potassium phosphate (pH 6.0–8.0) and glycine ⁄ sodium hydroxide (pH 8.0–10.2) The temperature dependence was determined at pH 7.2, and the stability of the enzyme was examined by keeping the pure preparation for 5, 15 and 30 at 40, 50, 60 and 65 °C before the assay The effect of inhibitors was established with the reaction system containing different metal ions at final concentrations of and 10 mm The specific activities for amino acids were analyzed under similar conditions Determination of enzyme activities AAT activity was assayed as described by Collier and Kohlhaw [36] The assay mixture contained (in 0.8 mL total volume): 0.1 m potassium phosphate buffer (pH 7.2), 30 mm l-aspartate, 10 mm a-ketoglutarate, 38 lm pyridoxal 5¢-phosphate and enzyme The stock solution of a-ketoglutarate was prepared daily, and its pH was adjusted to 7.2 with NaOH The assay was performed at 25 °C for 20– 40 min, and the reaction was stopped with 0.1 mL of 10 m NaOH After 30 at room temperature, the increase in absorbance at 265 nm was measured for the test sample, as well as a control to which NaOH had been added before the addition of a-ketoglutarate A molar extinction coefficient for oxaloacetate of 780 m)1Ỉcm)1 was used, and one unit of activity was defined as the amount of enzyme necessary to form lmolỈmin)1 of oxaloacetate The aromatic amino acid aminotransferases were assayed according to Mavrides and Orr [37] The assay was established for AAT except that aspartate was replaced with mm tryptophan, tyrosine or phenylalanine, and the concentration of the a-ketoglutarate was decreased to 10 mm The increase in absorbance of the reaction solution was measured at 335, 330 and 315 nm The molar extinction coefficients for the reaction products indole pyruvate, q-hydroxyphenylpyruvate and phenylpyruvate were 10 000, 19 500 and 17 500 m)1Ỉcm)1, respectively One unit of aromatic amino acid aminotransferase activity was defined as the amount of enzyme necessary to form lmol of indole pyruvate, q-hydroxyphenylpyruvate or phenylpyruvate 1354 Kinetic experiments For determination of kinetic parameters, an assay was established by coupling with malate dehydrogenase as described previously [38] In the routine assay, the reaction mixture contained 0.1 m potassium phosphate buffer (pH 7.6), 25 lm pyridoxal 5¢-phosphate, 0.5 mm NADH, 0.08 U malate dehydrogenase and 0.5 lL of purified enzyme in a reaction volume of 200 lL The temperature was 30 °C The reaction was monitored by the decrease in absorbance of NADH at 340 nm over 180 s with a Thermo Multiskan Ascent (Thermo Fisher Scientific Inc., Waltham, MA, USA) and the data were recorded every 20 s AAT substrate concentrations were varied in the range 1–20 mm l-aspartate with a fixed concentration of 10 mm a-ketogluLÀasp ) and in the range 0.5–10 mm a-ketoglutatarate (for Km rate with a fixed concentration of 20 mm l-aspartate (for aÀKG ) The kinetic parameters for l-glutamate and oxaloKm acetate were coupled to glutamate dehydrogenase [39] Our assay was established using the same methods, and the 200 lL reactions contained l-glutamate, oxaloacetate, mm NADH, U of glutamate dehydrogenase and 12 mm NH4Cl (as second substrate for glutamate dehydrogenase) in 0.1 m potassium phosphate buffer (pH 7.6) AAT substrate concentrations were varied in the range 1.0–27 mm l-glutamate with a fixed concentration of mm oxaloaceLÀglu ) and in the range 0.5–20 mm oxaloacetate tate (for Km with a fixed concentration of 12 mm l-glutamate OAA (for Km ) Km and Vmax values were estimated from the FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS H.-J Wu et al variation in initial reaction velocity with substrate concentration using the Hanes transformation [40] The kcat parameter was defined as Vmax divided by the enzyme concentration in the 200 lL reaction PAGE PAGE was performed with a Mini Protean II cell (Bio-Rad, Hercules, CA, USA) in accordance with the manufacturer’s instructions For SDS ⁄ PAGE, the separating gel was made with 12% acrylamide and the stacking gel was made with 5% acrylamide The Prestained Protein Marker (Fermentas China Co., Ltd, Shenzhen, China) was used as the molecular weight marker Proteins were visualized by Coomassie Brilliant Blue staining Native PAGE was carried out with discontinuous gels in which the separating gel consisted of 8% acrylamide and the stacking gel consisted of 5% acrylamide The running buffer contained 25 mm Tris-HCl and 250 mm Gly (pH 8.3) The gels were run at 15 mA for 90 at °C They were then placed in a bath containing 50 mL of AAT substrate solution with gentle shaking for AAT activity was detected when the AAT substrate solution was supplemented with mgỈmL)1 Fast Blue (Sigma-Aldrich Shanghai Trading Co., Ltd, Shanghai, China) The composition of the AAT substrate solution (pH 7.4) was 2.2 mm a-ketoglutarate, 8.6 mm Asp, 0.5% (w ⁄ v) polyvinylpyrrolidone-40, 1.7 mm EDTA and 100 mm Na2HPO4 [9] Sequence analysis Alignments of DNA and protein sequences were conducted with blastn and blastp software, respectively (http:// www.ncbi.nlm.nih.gov/BLAST/) Genes were predicted using genemark (http://exon.gatech.edu/GeneMark/) The promoter and terminator were predicted using the online tools neural network promoter prediction (http://www fruitfly.org/seq_tools/promoter.html) and findterm (http:// linux1.softberry.com/berry.phtml), respectively Additional aminotransferase sequences were obtained from GenBank and aligned by using clustal x, followed by manual adjustments [41] Aligned sequences were visualized with genedoc [42] Phylogenetic trees were constructed using the Neighbor-joining algorithm [43] in mega 4.0 [44], with its reliability assessed by 1000 bootstrap repetitions Acknowledgements This work was supported by grants from the National Natural Science Fund of China (30570041); the National 863 Program of China (2006AA10Z172; 2006AA10A203); the Special Nonprofit Scientific Research Program, P R China (3-23); the Program of International Science and Technology Cooperation Identification of a new aspartate aminotransferase (2009DFA32740); the Specialized Research Fund for the Doctoral Program of Higher Education, P R China (20060307012); the National Transgenic Major Program (2009ZX08009-055B); and Youth Science and Technology Innovation Fund of Nanjing Agricultural University (KJ09007) References Deu E, Koch KA & Kirsch JF (2002) The role of the conserved Lys68*:Glu265 intersubunit salt bridge in aspartate aminotransferase kinetics: multiple forced covariant amino acid substitutions in natural variants Protein Sci 11, 1062–1073 de la Torre F, De Santis L, Fernanda SM, Crespillo R & Canovas FM (2006) Identification and functional analysis of a prokaryotic-type aspartate aminotransferase: implications for plant amino acid metabolism Plant J 46, 414–425 Wilkie SE, Lambert R & Warren MJ (1996) Chloroplastic aspartate aminotransferase from Arabidopsis thaliana: an examination of the relationship between the structure of the gene and the spatial structure of the protein Biochem J 319, 969–976 Miesak BH & Coruzzi GM (2002) Molecular and physioligical analysis of Arabidopsis mutants defective in cytosolic or chloroplastic aspartate aminotransferase Plant Physiol 129, 650–660 Jensen R & Gu W (1996) Evolutionary recruitment of biochemically specialized subdivisions of Family I within the protein superfamily of aminotransferases J Bacteriol 178, 2161–2171 Okamoto A, Kato R, Masui R, Yamagishi A, Oshima T & Kuramitsu S (1996) An aspartate aminotransferase from an extremely thermophilic bacterium, Thermus thermophilus HB8 J Biochem 119, 135–144 Sung MH, Tanizawa K, Tanaka H, Kuramitsu S, Kagamiyama H, Hirotsu K, Okamoto A, Higuchi T & Soda K (1991) Thermostable aspartate aminotransferase from a thermophilic Bacillus species Gene cloning, sequence determination, and preliminary x-ray characterization J Biol Chem 266, 2567–2572 Watson RJ & Rastogi VK (1993) Cloning and nucleotide sequencing of Rhizobium meliloti aminotransferase genes: an aspartate aminotransferase required for symbiotic nitrogen fixation is atypical J Bacteriol 175, 1919–1928 de la Torre F, Moya-Garcia AA, Suarez MF, Rodriguez-Caso C, Canas RA, Sanchez-Jimenez F & Canovas FM (2009) Molecular modeling and site-directed mutagenesis reveal essential residues for catalysis in a prokaryote-type aspartate aminotransferase Plant Physiol 149, 1648–1660 FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS 1355 Identification of a new aspartate aminotransferase H.-J Wu et al 10 Nakai T, Okada K, Akutsu S, Miyahara I, Kawaguchi S, Kato R, Kuramitsu S & Hirotsu K (1999) Structure of Thermus thermophilus HB8 aspartate aminotransferase and its complex with maleate Biochemistry 38, 2413–2424 11 Kim H, Nakaoka M, Yagi M, Ashida H, Hamada K, Shibata H & Sawa Y (2003) Cloning, structural analysis and expression of the gene encoding aspartate aminotransferase from the thermophilic cyanobacterium Phormidium lapideum J Biosci Bioeng 95, 421–424 12 Schwarzenbacher R, Jaroszewski L, von Delft F, Abdubek P, Ambing E, Biorac T, Brinen LS, Canaves JM, Cambell J, Chiu HJ et al (2004) Crystal structure of an aspartate aminotransferase (TM1255) from Thermoto˚ ga maritima at 1.90 A resolution Proteins 55, 759–763 13 Inoue K, Kuramitsu S, Okamoto A, Hirotsu K, Higuchi T & Kagamiyama H (1991) Site-directed mutagenesis of Escherichia coli aspartate aminotransferase: role of Tyr70 in the catalytic processes Biochemistry 30, 7796–7801 14 Yano T, Mizuno T & Kagamiyama H (1993) A hydrogen-bonding network modulating enzyme function: asparagine-194 and tyrosine-225 of Escherichia coli aspartate aminotransferase Biochemistry 32, 1810–1815 15 Yano T, Kuramitsu S, Tanase S, Morino Y & Kagamiyama H (1992) Role of Asp222 in the catalytic mechanism of Escherichia coli aspartate aminotransferase: the amino acid residue which enhances the function of the enzyme-bound coenzyme pyridoxal 5¢-phosphate Biochemistry 31, 5878–5887 16 Jeffery CJ, Gloss LM, Petsko GA & Ringe D (2000) The role of residues outside the active site: structural basis for function of C191 mutants of Escherichia coli aspartate aminotransferase Protein Eng 13, 105–112 17 Almo SC, Smith DL, Danishefsky AT & Ringe D (1994) The structural basis for the altered substrate specificity of the R292D active site mutant of aspartate aminotransferase from E coli Protein Eng 7, 405–412 18 Nobe Y, Kawaguchi SI, Ura H, Nakai T, Hirotsu K, Kato R & Kuramitsu S (1998) The novel substrate recognition mechanism utilized by aspartate aminotransferase of the extreme thermophile Thermus thermophilus HB8 J Biol Chem 273, 29554–29564 19 Matharu A, Hayashi H, Kagamiyama H, Maras B & John RA (2001) Contributions of the substrate-binding arginine residues to maleate-induced closure of the active site of Escherichia coli aspartate aminotransferase Eur J Biochem 268, 1640–1645 20 Danishefsky AT, Onnufer JJ, Petsko GA & Ringe D (1991) Activity and structure of the active-site mutants R386Y and R386F of Escherichia coli aspartate aminotransferase Biochemistry 30, 1980–1985 21 Belitsky BR (2002) Biosynthesis of amino acids of the glutamate and aspartate families, alanine, and polyamines In Bacillus subtilis and its Closest Relatives 1356 22 23 24 25 26 27 28 29 30 31 32 (Sonenshein AL ed), pp 203–231 ASM Press, Washington, DC Iijima T, Diesterhaft MD & Freese E (1977) Sodium effect of growth on aspartate and genetic analysis of a Bacillus subtilis mutant with high aspartase activity J Bacteriol 129, 1440–1447 Kravchuk Z, Tsybovsky Y, Koivulehto M, Vlasov A, Chumanevich A, Battchikova N, Martsev S & Korpela T (2001) Truncated aspartate aminotransferase from alkalophilic Bacillus circulans with deletion of N-terminal 32 amino acids is a non-functional monomer in a partially structured state Protein Eng 14, 279–285 Berger BJ, English S, Chan G & Knodel MH (2003) Methionine regeneration and aminotransferases in Bacillus subtilis, Bacillus cereus, and Bacillus anthracis J Bacteriol 185, 2418–2431 Yao S, Gao X, Fuchsbauer N, Hillen W, Vater J & Wang J (2003) Cloning, sequencing, and characterization of the genetic region relevant to biosynthesis of the lipopeptides iturin A and surfactin in Bacillus subtilis Curr Microbiol 47, 272–277 Chen XH, Koumoutsi A, Scholz R, Eisenreich A, Schneider K, Heinemeyer I, Morgenstern B, Voss B, Hess WR, Reva O et al (2007) Comparative analysis of the complete genome sequence of the plant growth-promoting bacterium Bacillus amyloliquefaciens FZB42 Nat Biotechnol 25, 1007–1014 Okamoto A, Higuchi T, Hirotsu K, Kuramitsu S & Kagamiyama H (1994) X-ray crystallographic study of pyridoxal 5¢-phosphate-type aspartate aminotransferases from Escherichia coli in open and closed form J Biochem 116, 95–107 Jager J, Moser M, Sauder U & Jansonius JN (1994) ă Crystal structures of Escherichia coli aspartate aminotransferase in two conformations: comparison of an unliganded open and two liganded closed forms J Mol Biol 239, 285–305 Rhee S, Silva MM, Hyde CC, Rogers PH, Metzler CM, Metzler DE & Arnone A (1997) Refinement and comparisons of the crystal structures of pig cytosolic aspartate aminotransferase and its complex with 2methylaspartate J Biol Chem 272, 17293–17302 Yagi T, Kagamiyama H, Motosugi K, Nozaki M & Soda K (1979) Crystallization and properties of aspartate aminotransferase from Escherichia coli B FEBS Lett 100, 81–84 O’Farrell PA, Sannia G, Walker JM & Doonan S (1997) Cloning and sequencing of aspartate aminotransferase from Thermus aquaticus YT1 Biochem Biophys Res Commun 239, 810–815 Sung MH, Tanizawa K, Tanaka H, Kuramitsu S, Kagamiyama H & Soda K (1990) Purification and characterization of thermostable aspartate aminotransferase from a thermophilic Bacillus species J Bacteriol 172, 1345–1351 FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS H.-J Wu et al 33 Mavrides C & Orr W (1974) Multiple forms of plurispecific aromatic: 2-oxoglutarate (oxaloacetate) aminotransferase (transaminase A) in Escherichia coli and selective repression by L-tyrosine Biochem Biophys Acta 336, 70–78 34 Wilkie SE & Warren MJ (1998) Recombinant expression, purification, and characterization of three isoenzymes of aspartate aminotransferase from Arabidopsis thaliana Protein Expr Purif 12, 381–389 35 Kohler E, Seville M, Jager J, Fotheringham I, Hunter ă ¨ M, Edwards M, Jansonius JN & Kirschner K (1994) Significant improvement to the catalytic properties of aspartate aminotransferase: role of hydrophobic and charged residues in the substrate binding pocket Biochemistry 33, 90–97 36 Collier RH & Kohlhaw G (1972) Nonidentity of the aspartate and the aromatic aminotransferase components of transaminase A in Escherichia coli J Bacteriol 112, 365–371 37 Mavrides C & Orr W (1975) Multispecific aspartate and aromatic amino acid aminotransferases in Escherichia coli J Biol Chem 250, 4128–4133 38 Yagi T, Kagamiyama H, Nozaki M & Soda K (1985) Glutamate-aspartate transaminase from microorganisms Methods Enzymol 113, 83–89 Identification of a new aspartate aminotransferase 39 Turano FJ, Wilson BJ & Matthews BF (1990) Purification and characterization of aspartate aminotransferase isoenzymes from carrot suspension cultures Plant Physiol 92, 587–594 40 Price NC & Stevens L (1989) Fundamentals of Enzymology, 2nd edn, pp 143–146 Oxford University Press, New York 41 Thompson JD, Higgins DG & Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice Nucleic Acids Res 22, 4673–4680 42 Nicholas KB, Nicholas HB Jr & Deerfield DW II (1997) GeneDoc: Analysis and Visualization of Genetic Variation EMBnet news 4(2), 1–4 43 Saitou N & Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees Mol Biol Evol 4, 406–425 44 Tamura K, Dudley J, Nei M & Kumar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software, version 4.0 Mol Biol Evol 24, 1596–1599 FEBS Journal 278 (2011) 1345–1357 ª 2011 The Authors Journal compilation ª 2011 FEBS 1357 ... exclusively of AATs from prokaryotes, including AATs from proto- Identification of a new aspartate aminotransferase zoa, archaebacteria and bacteria Interestingly, plants also have Ib subgroup-prokaryote-type... mean ± SD of three determinations B subtilis B3 AATB3 Substrates L -aspartate L-glutamate a- ketoglutarate Oxaloacetate Fig Characterization of the purified AATB3 (A) Effect of temperature on activity... purified AATB3 Values for Km and Vmax for both amino donors (l -aspartate and l-glutamate) and acceptors (a- ketoglutarate and oxaloacetate) were calculated from the double-reciprocal plots The Km values