Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo Toyotaka Ishibashi1, Asami Koga1, Taichi Yamamoto1, Yukinobu Uchiyama1, Yoko Mori1, Junji Hashimoto2, Seisuke Kimura1 and Kengo Sakaguchi1 Department of Applied Biological Science, Faculty of Science and Technology, Tokyo University of Science, Japan National Institute of Agrobiological Sciences, Ibaraki, Japan Keywords Arabidopsis; DNA repair; DNA replication; replication protein A; rice Correspondence K Sakaguchi, Department of Applied Biological Science, Faculty of Science and Technology, Tokyo University of Science, 2641 Yamazaki, Noda-shi, Chiba-ken 2788510, Japan Fax: +81 7123 9767 Tel: +81 7124 1501 (ext 3409) E-mail: kengo@rs.noda.tus.ac.jp (Received 20 January 2005, revised 18 March 2005, accepted 15 April 2005) doi:10.1111/j.1742-4658.2005.04719.x Replication protein A (RPA), a heterotrimeric protein composed of 70, 32 and 14-kDa subunits, has been shown to be essential for DNA replication, repair, recombination, and transcription Previously, we found that, in two seed plants, rice and Arabidopsis, there are two different types of RPA70kDa subunit Substantial biochemical and genetic characterization of these two subunits, termed OsRPA70a and OsRPA70b or AtRPA70a and AtRPA70b, respectively, is described in this report Inactivation of AtRPA70a by transfer DNA insertion or RNA interference is lethal, so the complex containing RPA70a may be essential for DNA replication Transfer DNA insertion and RNAi lines for AtRPA70b are morphologically normal, albeit hypersensitive to certain mutagens, such as UV-B and methyl methanesulfonate, suggesting that RPA70b functions mostly in DNA repair In two-hybrid, pull-down and coexpression analysis, OsRPA70b was found to interact more selectively than OsRPA70a with OsRPA32 The data suggest that two different types of RPA heterotrimer are present in seed plants, and that there may be additional 32 and 14-kDa subunit homologs that interact with OsRPA70a Each of the two probable plant RPA complexes may have different roles in DNA metabolism Replication protein A (RPA) is a heterotrimeric complex composed of 70, 32 and 14-kDa subunits which is involved in various aspects of DNA metabolism [1] RPA accumulates along stretches of ssDNA generated during DNA replication and DNA repair [2–5] RPA is known to interact specifically with numerous DNA replication proteins: including T antigen and DNA polymerase a-primase; the tumor suppressor p53; the transcription factors Gal4 and VP16; the DNA repair proteins XPA, DDB, XPF, XPG, uracil DNA glycosylase, Rad52, and Rad51; and the DNA helicases, Bloom’s and Werner’s proteins RPA was first identified as a factor necessary for simian virus 40 replication in vitro It is required for activation of the prereplication complex to form the initiation complex, and for the ordered loading of essential initiator functions, such as the DNA poly- merase a-primase complex, to origins of replication [6–9] Furthermore, during strand elongation, RPA stimulates the action of DNA polymerase a¢, d and e RPA also has essential roles in DNA repair In nucleotide excision repair, RPA interacts with XPA at sites of DNA damage, stimulates XPA–DNA interaction, and recruits the incision proteins ERCC1 ⁄ XPF and XPG to the damaged site [10–12] In addition, RPA was necessary for the removal of oxidized base lesions from genomic DNA in long-patch base excision repair [13,14] In the repair of double-strand breaks by homologous recombination, RPA greatly stimulates DNA strand exchange by Rad51 protein, provided that RPA is added to a pre-existing complex of Rad51 protein and ssDNA When double-strand breaks occur in DNA, RPA binds and protects exposed ssDNA ends until they can be coated by Rad51 RPA then catalyzes Abbreviations GST, glutathione S-transferase; MMS, methyl methanesulfonate; RPA, replication protein A 3270 FEBS Journal 272 (2005) 3270–3281 ª 2005 FEBS T Ishibashi et al the homologous pairing and strand-exchange steps of homologous recombination (HR) [15–17] The 32-kDa subunit of RPA is phosphorylated during the progression of cells from G1 to S phase and hyperphosphorylated in response to a wide variety of DNA-damaging agents, such as ionizing radiation, UV, and camptothecin [18–21] The RPA phosphorylation stimulated by DNA damage promotes DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC2–5 and Rad9–Rad1–Hus1) play a crucial role in the activation of the ATR-mediated DNA damage and DNA replication stress response pathway RPA is also required to recruit and activate Rad17 complexes for checkpoint signaling in vivo It may function in the sensing of DNA damage [22] In contrast with the intensive study of RPA in animals and yeast, little is known about this protein in plants In 1997, an ortholog of the RPA70-kDa subunit (OsRPA1) was isolated from deepwater rice (Oryza sativa L cv Pin Gaew 56), and its expression was found to be induced by gibberellin [24] Unexpectedly, we found that rice has two different types of RPA70kDa subunit, termed OsRPA70a and OsRPA70b, respectively [25] Northern blot analysis revealed different expression patterns for these two subunits, indicating that they may perform different functions [25] OsRPA70a is expressed in proliferating tissues that contain meristems, such as root tips and young leaves, but also more weakly in mature leaves; OsRPA70b is expressed mostly in proliferating tissues [25] Arabidopsis thaliana also has two different types of RPA70-kDa subunit, suggesting that two RPA70-kDa subunits are universally present in seed plants [25] Given that OsRPA70a and OsRPA70b may have different functions in rice, the presence of two subunit types in A thaliana raises the possibility that these proteins have become functionally specialized in all seed plants Here, we report biochemical differences between OsRPA70a and OsRPA70b, and genetic differences between the A thaliana homologs of OsRPA70a and OsRPA70b (AtRPA70a and AtRPA70b), revealed using transfer DNA (T-DNA) insertion and RNA interference (RNAi) mutants Results cDNAs of OsRPA70a, OsRPA70b, OsRPA32 and OsRPA14 The cloning of the rice homologs of the RPA subunits, OsRPA70a, OsRPA70b, and OsRPA32, has been desFEBS Journal 272 (2005) 3270–3281 ª 2005 FEBS Two types of RPA in seed plants cribed [25] Here, we cloned a cDNA for the rice homolog of the RPA 14-kDa subunit (OsRPA14), which was not reported earlier Each gene was found to exist as a single copy per genome by Southern blotting analysis (data not shown) Nucleotide sequence data for OsRPA70a, OsRPA70b, OsRPA32 and OsRPA14 are deposited in the DDBJ ⁄ EMBL ⁄ GenBank nucleotide sequence databases with the accession numbers AB042415, AB111916, AB037145, and AB111915, respectively As antibodies against OsRPA70a and OsRPA70b showed cross-reactivity, each antibody was purified by subtractive affinity purification (data not shown) Analysis of T-DNA insertion mutants and RNAi mutants of A thaliana homologs of OsRPA70a and OsRPA70b (AtRPA70a and AtRPA70b) A thaliana was used for genetic analysis of the functions of OsRPA70a and OsRPA70b because it has closely related homologs (AtRPA70a and AtRPA70b, respectively) and because many T-DNA insertion mutants of A thaliana are already available [26] We were able to obtain one T-DNA insertion line each for AtRPA70a and AtRPA70b (Fig 1A) The T-DNA insertion in AtRPA70a (atrpa70a) was lethal, but the AtRPA70b T-DNA insertion mutant (atrpa70b) was viable (Table 1) and did not differ in phenotype from the wild-type To confirm these mutant phenotypes, A thaliana lines were generated in which AtRPA70a or AtRPA70b was inactivated by an RNA interference method (RNAi) The RNAi mutant of AtRPA70a also showed lethality (data not shown) On the other hand, AtRPA70b RNAi mutant lines were viable, and did not differ in phenotype from wild-type We performed RT-PCR analysis with a total RNA extract from seedlings of atrpa70b, and confirmed that AtRPA70b was not expressed (Fig 1B) As a control, S16 ribosomal protein was also analyzed to normalize for both the amount of input RNA for the RT reaction and the efficiency of the PCR (Fig 1B) We performed Western blot analysis of total proteins from seedlings of wild-type, atrpa70b, and the AtRPA70b RNAi mutant, and confirmed that very little AtRPA70b protein is present in the mutants (Fig 1C) These results indicated that RPA70a has an essential role, probably in DNA replication, whereas RPA70b is not essential under normal growth conditions However, it is known that yeast rpa70 mutants are very sensitive to mutagens such as UV and methyl methanesulfonate (MMS) [27] To determine whether RPA70b is similarly involved in mutagen tolerance, the mutagen sensitivity of atrpa70b and the AtRPA70b RNAi line was tested When one-week-old seedlings were exposed to various 3271 Two types of RPA in seed plants T Ishibashi et al A B C Fig Analysis of AtRPA70 T-DNA insertion and RNAi mutant lines (A) Disruptions of AtRPA70a and AtRPA70b by T-DNA insertion Gray rectangles represent the coding region The short arrows indicate primers used for RT-PCR of AtRPA70b: 70b F1, 70b F2, 70b R1, and 70b R2 (B) Expression of mRNA in wild-type and the AtRPA70b T-DNA insertion mutant (atrpa70b), as measured by RT-PCR Lane 1, wild-type (Columbia); lane 2, atrpa70b Upper and middle rows indicate AtRPA70b, and lower row indicates S16 ribosomal protein as a control (C) Expression of protein in western blot analysis using antibodies to OsRPA70b Lane 1, wild-type (Columbia); lane 2, atrpa70b; lane 3, AtRPA70b RNAi mutant Table Genotypes of atrpa70a and atrpa70b Genomic DNA was extracted from leaves of F2 seedlings from AtRPA70a and AtRPA70b heterozygous T-DNA insertion mutants (F1), and subjected to PCR analysis Genotypes were scored as homozygous wildtype (amplification observed only with gene-specific primers), T-DNA insertion heterozygous (amplification observed with both sets of primers), or T-DNA insertion homozygous (amplification observed only with the T-DNA ⁄ gene-specific primer pair) F2 (+) ⁄ (+) F1 AtRPA70a(+) ⁄ (–) AtRPA70b(+) ⁄ (–) (+) ⁄ (–) (–) ⁄ (–) 14 12 34 23 11 50, and 75 p.p.m MMS (Fig 2D,E), and by 0.1, 1, and mm H2O2 (Fig 2F,G) Compared with the wild-type plants, the growth of atrpa70b and AtRPA70b RNAi mutant seedlings was more inhibited by 10 000 and 20 000 JỈm)2 of UV-B (Fig 2A,C), and was completely stopped by 50 and 75 p.p.m of MMS (Fig 2D,E) On the other hand, the mutants showed little increase in sensitivity to H2O2 (Fig 2F,G) Like the yeast rpa70 mutants, atrpa70b and the AtRPA70b RNAi mutant are more sensitive than wild-type to UV and MMS, suggesting that RPA70b is involved in the repair system for DNA damaged by these mutagens Interactions among OsRPA subunits UV-B doses and then grown for an additional week in the absence of UV-B, there were no remarkable morphological differences between wild-type, atrpa70b, and AtRPA70b RNAi mutant seedlings, although leaf yellowing was somewhat increased in the mutant seedlings (Fig 2A,B) Compared with wild-type, the amounts of chlorophyll (a + b) were decreased in atrpa70b and the AtRPA70b RNAi mutant (Fig 2B) One-week-old seedlings were also grown on Murashige and Skoog (MS) medium containing various concentrations of MMS (Fig 2D,E) or H2O2 (Fig 2F,G) After week, growth of the wild-type plants was inhibited by 10 000 and 20 000 JỈm)2 of UV-B (Fig 2A)2C), by 25, 3272 We investigated the interaction between OsRPA subunits using yeast two-hybrid analysis (b-galactosidase assay) (Fig 3A) and an in vitro pull-down assay (a protein–protein interaction assay) (Fig 3C–E) In the two-hybrid assay, the interaction between OsRPA70a and OsRPA32 yielded about 20% of the relative activity of the OsRPA32 and OsRPA14 interaction The interaction of OsRPA70b and OsRPA32 yielded about 75% of the relative activity of the OsRPA32 and OsRPA14 interaction The controls (interaction with BK vector alone) yielded very little b-galactosidase activity Western analysis showed that OsRPA70a and OsRPA70b were expressed in approxiFEBS Journal 272 (2005) 3270–3281 ª 2005 FEBS T Ishibashi et al Two types of RPA in seed plants A B D C E F G Fig AtRPA70b mutants are hypersensitive to UV-B and MMS (A) Hypersensitivity of atrpa70b to UV-B The UV-B dosage is 10 000 and 20 000 JỈm)2 (B) Chlorophyll content of the wild-type, atrpa70b, and AtRPA70b RNAi mutant plants in (A) (C) Root lengths of the wild-type, atrpa70b, and AtRPA70b RNAi mutant plants in (A) (D) Hypersensitivity of the AtRPA70b mutants to MMS The MMS concentrations tested were 25, 50, 75 and 100 p.p.m (E) Root lengths of the wild-type, atrpa70b, and AtRPA70b RNAi mutant plants in (D) (F) Effect of H2O2 on the AtRPA70b mutants The H2O2 concentrations tested were 0, 0.1, and mM (G) Root lengths of the wild-type, atrpa70b, and AtRPA70b RNAi mutant plants in (F) mately the same amounts in yeast (Fig 3B), indicating that the weaker interaction seen for OsRPA70a was not due to lower OsRPA70a protein levels Taken together, the results indicate that OsRPA70b interacted more strongly with OsRPA32 than did OsRPA70a FEBS Journal 272 (2005) 3270–3281 ª 2005 FEBS (Fig 3A) Neither OsRPA70a nor OsRPA70b interacted with OsRPA14 directly (data not shown) In vitro pull-down assays were performed using the following protein pairs: T7 tag-OsRPA70a and OsRPA32-His tag (Fig 3C), OsRPA70b-His tag and 3273 Two types of RPA in seed plants T Ishibashi et al A OsRPA70b, but not OsRPA70a, can form a complex with OsRPA32 and OsRPA14 B C D E Fig OsRPA32 interacts with OsRPA70b more strongly than with OsRPA70a (A) pGBKT7-OsRPA32 was cotransfected into AH109 yeast with pGADT7-OsRPA70a, OsRPA70b, or OsRPA14, and three independent transformants were isolated for each plasmid pair Liquid cultures of each transformant were prepared and tested for b-galactosidase activity Shown are the average activity units for triplicate assays of representative clones for each plasmid pair (B) Expression levels of pGADT-OsRPA70a and OsRPA70b were compared by western blot analysis with HA epitope tag antibody (C–E) In vitro pull-down analysis For each experiment, the indicated proteins were incubated together in NaCl ⁄ Pi containing 250 mM NaCl at °C for h, and then incubated with Talon beads The amount of protein present in the fraction bound to the affinity column was quantified by western blot analysis with T7 tag monoclonal antibody On each gel, lanes and show the individual input proteins, and lane shows the fraction bound to the Talon beads (C) OsRPA70a-T7 mixed with OsRPA32-His (D) OsRPA70b-His mixed with OsRPA32-T7 (E) OsRPA32-T7 mixed with OsRPA14-His T7 tag-OsRPA32 (Fig 3D), and T7 tag-OsRPA32 and OsRPA14-His tag (Fig 3E) Western blots were probed with T7 monoclonal antibody OsRPA70b, but not OsRPA70a, efficiently interacted with OsRPA32 (Fig 3C,D) OsRPA32 also interacted with OsRPA14 (Fig 3E) 3274 The human RPA70-kDa subunit is known to be insoluble when expressed in Escherichia coli, whereas the RPA 32–14 kDa complex may be soluble [28] When the human 70-kDa subunit was coexpressed with both the 32 and 14-kDa subunits, it became soluble This resulted from stabilization of the 70-kDa subunit, which can form a complex with the 32 and 14-kDa subunits [29] To test whether plant 70-kDa subunits show similar properties, we investigated expression of OsRPA70a or OsRPA70b in the presence of OsRPA32 and OsRPA14 in E coli Expressed proteins were purified first on a Ni–nitrilotriacetate column, then on a glutathione S-transferase (GST) column, and then the GST tag was removed by treatment with PreScission Protease With this purification scheme, His-tagged OsRPA70a, OsRPA70b, and OsRPA14 will not be recovered in the final elution unless they interact with GST-tagged OsRPA32 Furthermore, unless OsRPA70a and OsRPA70b interact with OsRPA32, they will be insoluble, because these proteins were insoluble when expressed on their own (data not shown) The recombinant RPA complex resulting from OsRPA70b–OsRPA32–OsRPA14 coexpression contained OsRPA70b (Fig 4A), but that resulting from OsRPA70a–OsRPA32–OsRPA14 coexpression did not have OsRPA70a (Fig 4A) Therefore, OsRPA70b, but not OsRPA70a, could form a complex with OsRPA32 and OsRPA14 (Fig 4A) Compared with OsRPA32 and OsRPA14, the amount of OsRPA70b in the complex was very small This imbalance may reflect free OsRPA32 and OsRPA14, or a complex of OsRPA32 and OsRPA14, in the OsRPA70b–OsRPA32–OsRPA14 extracts (Fig 4C) A small amount of OsRPA70a recombinant protein was found in the soluble fraction of OsRPA70a–OsRPA32–OsRPA14 extracts but most of it failed to bind to the GST column (Fig 4A), indicating that it could not interact with the OsRPA32 and OsRPA14 complex To confirm this selectivity, purified recombinant RPA complexes from OsRPA70a– OsRPA32–OsRPA14 or OsRPA70b–OsRPA32–OsRPA14 extracts were passed through a S300 gel-filtration column, and then the fractions were analyzed by Western blotting The results clearly show that the complex from OsRPA70a–OsRPA32–OsRPA14 extracts did not contain any OsRPA70a (Fig 4C), whereas that from OsRPA70b–OsRPA32–OsRPA14 extracts did contain OsRPA70b (Fig 4D) These data suggest that seed plants contain OsRPA70b–OsRPA32–OsRPA14 complexes in vivo, but also imply the existence of other FEBS Journal 272 (2005) 3270–3281 ª 2005 FEBS T Ishibashi et al A B Two types of RPA in seed plants using purified OsRPA70a, OsRPA70b, and OsRPA32 (Fig 5) Both OsRPA70a and OsRPA70b had ssDNA-binding activity (Fig 5A) On the other hand, OsRPA32 could not bind to ssDNA (Fig 5C) Preincubation of OsRPA70a and OsRPA70b with their respective antibodies before the gel shift assay diminished or eliminated the shifted bands (Fig 5B) Next, the effect of OsRPA32 on the ssDNA-binding activity of OsRPA70a and OsRPA70b was tested (Fig 5C) OsRPA32 increased the binding activity of OsRPA70b, but hardly affected that of OsRPA70a, suggesting that OsRPA32 is physiologically related to the function of OsRPA70b Discussion C Fig Coexpression of three subunits of RPA For coexpression, OsRPA70a-His-tag or OsRPA70b-His-tag, combined with OsRPA32GST and OsRPA14-His-tag, were cloned into the pet32A vector and expressed in E coli at 37 °C for h (A) SDS ⁄ PAGE analysis of the proteins at each step of the purification Lanes and 4, crude extracts of isopropyl b-D-thiogalactoside-induced cells; lanes and 5, eluate from Ni2+-chelate column chromatography; lanes and 6, GST column chromatography through fraction after treatment with PreScission Protease Lanes 1, and are OsRPA70a–OsRPA32– OsRPA14, lanes 4, and are OsRPA70b–OsRPA32–OsRPA14 Purified sample was separated by SDS ⁄ 14% polyacrylamide gel electrophoresis, and stained with Coomassie Brilliant Blue (CBB) (B) OsRPA70a–OsRPA32–OsRPA14 purified sample was loaded on a S300 gel-filtration column Eluted fractions were separated by SDS ⁄ 14% polyacrylamide gel electrophoresis, blotted on to a poly(vinylidene difluoride) membrane, and probed with OsRPA70a, OsRPA32 and OsRPA14 antibodies (C) OsRPA70b–OsRPA32– OsRPA14 purified sample was loaded on a S300 gel-filtration column Eluted fractions were separated by SDS ⁄ 14% polyacrylamide gel electrophoresis, blotted on to a poly(vinylidene difluoride) membrane, and probed with OsRPA70b, OsRPA32, and OsRPA14 antibodies molecules, homologous to OsRPA32 and OsRPA14, that interact with OsRPA70a SsDNA-binding activity of OsRPA70b is increased in the presence of OsRPA32 To determine the functional significance of the interactions among the RPA subunits, we tested the effect of RPA32 on the ssDNA-binding activity of OsRPA70a or OsRPA70b in a gel mobility-shift assay FEBS Journal 272 (2005) 3270–3281 ª 2005 FEBS The lethality of the T-DNA insertion and RNAi mutants of A thaliana AtRPA70a indicate that this gene plays an essential role, such as in DNA replication, in living cells In contrast, mutants of AtRPA70b were viable but showed high sensitivity to UV and MMS, suggesting involvement of AtRPA70b in the repair of damaged DNA (Figs and 2) Biochemical analysis of the interactions between the RPA subunits (Figs 3, 4, and 5) showed that OsRPA70b, but not OsRPA70a, could interact with OsRPA32 to form a heterotrimeric complex with OsRPA32 and OsRPA14 In rice, there is reported to be coregulation of OsRPA70b and OsRPA32 during the cell cycle and regulation of OsRPA32 in response to UV [30] RPA70-kDa has been reported to be unstable when not in a complex Because expression of OsRPA70a was observed at both the mRNA and protein levels, and because mutants of AtRPA70a, a homolog of OsRPA70a, were nonviable, we suggest that the rice genome contains another protein, distinct from Os32-kDa, that might form a stable complex with OsRPA70a (Fig 6) RPA70-kDa has two RPA ssDNA-binding domains, DBD-A and DBD-B, located within the central region, and a third, DBD-C, in the C-terminal region DBD-A and DBD-B are the most important regions for binding of ssDNA, whereas DBD-C has only weak ssDNA-binding activity At the N-terminus of RPA70kDa is another related and structurally defined DBD domain, termed DBD-F DBD-F has been shown to interact with multiple proteins and to interact weakly with DNA In RPA32-kDa, the DBD-D domain is located in the central region In yeast, RPA1 can only bind to the RPA2 ⁄ dimer, in contrast with our findings which show binding of OsRPA70b to OsRPA32 (Figs and 4) Trimerization is mediated by three domains: DBD-C (in RPA70), DBD-D (in RPA32), and RPA14, which together form 3275 Two types of RPA in seed plants A B C T Ishibashi et al Fig Gel mobility-shift analysis (A) DNA-binding activity of OsRPA70a and OsRPA70b OsRPA70a (lanes 2–5) or OsRPA70b (lanes 6–9) were incubated with ssDNA for 30 on ice DNA– protein complexes were electrophoretically resolved (B) Gel mobility-shift assays of no protein (lane 1), lM OsRPA70a (lanes 2–5) or OsRPA70b (lanes 6–9) were performed by incubation with ssDNA after pretreatment with OsRPA70a antibody (lanes 3, and 9) or OsRPA70b antibody (lanes 5, and 8) (C) Gel mobility-shift assays of lM OsRPA70a (lanes and 4) or OsRPA70b (lanes and 6) were performed by incubation with ssDNA, in the presence (lanes 2, 4, 6) or absence (lanes 1, 3, 5) of lM OsRPA32 the trimerization core [31] The DBD-C and DBD-D regions of rice are quite similar to the Saccharomyces cerevisiae DBD-C and DBD-D regions However, OsRPA14 has only low similarity to ScRPA14 This sequence divergence may account for the differences in binding observed between the yeast and rice proteins We would like to emphasize that, compared with the domain homologs of human and yeast RPA70-kDa, the rice DBD-A and DBD-B domains are more conserved than DBD-C and DBD-F This implies that the primary function of OsRPA70a and OsRPA70b is to bind DNA, and that this function has been conserved during evolution, even though the secondary functions of these proteins may have diverged OsRPA70a is expressed not only in actively dividing tissues but also in ears [25], where replication and recombination of DNA are occurring As RPA is an essential factor for DNA recombination, RPA70a may be presumed to function not only in the replication of DNA but also in DNA recombination in the ears On the other hand, based on the high expression of OsRPA70b in actively dividing tissues [24,25], OsRPA70b may function in DNA repair and DNA replication In summary, the results and discussion presented here suggest the very interesting possibility that there are two forms of RPA in higher plants which perform different roles in DNA metabolism Fig Model of plant RPA complex 3276 FEBS Journal 272 (2005) 3270–3281 ª 2005 FEBS T Ishibashi et al Experimental procedures Plant materials Rice plants (O sativa L cv Nipponbare) were grown in a growth cabinet under a 16-h light ⁄ 8-h dark cycle at 28 °C Cells were grown in suspension culture as described [32] A thaliana (Columbia) seeds were germinated on MS medium or soil, and plants were grown in a growth cabinet under a 16 h light ⁄ h dark cycle at 22 °C Cloning of OsRPA14 The rice EST database was searched using the tblastn program One clone (R0618) was identified that encodes a predicted protein with homology with the 14-kDa subunit of RPA The cDNA of this gene, named OsRPA14, was isolated from rice mRNA using the Rneasy Plant Mini kit (Qiagen, Valencia, USA), and was amplified with the SuperScript One-Step RT-PCR System (Invitrogen, Carlsbad, CA, USA) The nucleotide sequence data reported in this paper appear in the DDBJ ⁄ EMBL ⁄ GenBank nucleotide sequence databases with the accession number AB111915 for OsRPA14 Rice genomic DNA was digested with BglII, EcoRI, HindIII, or XbaI, and the digested DNA resolved on 1% agarose gels The restriction fragments were transferred on to nylon membranes (Hybond-N; Amersham Biosciences, Piscataway, NJ, USA) according to the manufacturer’s recommendations A 32P-labeled probe was prepared by random priming of OsRPA14 cDNA (Rediprime II; Amersham Biosciences) After prehybridization, hybridization was carried out at 42 °C for 16 h, followed by two washes with 6· NaCl ⁄ Cit ⁄ 1% SDS at room temperature for 15 min, two washes with 2· NaCl ⁄ Cit ⁄ 1% SDS at 65 °C for 15 min, one wash with 0.1· NaCl ⁄ Cit ⁄ 0.1% SDS at 65 °C for 15 min, and one wash with 0.1· NaCl ⁄ Cit ⁄ 0.1% SDS at 65 °C for 15 OsRPA14 was shown to exist as a single copy per genome (data not shown) Production of polyclonal antibody and immunological analysis Polyclonal antibodies against OsRPA70a and OsRPA70b were raised in rabbits using proteins purified as described above (Overexpression of recombinant OsRPA70a and OsRPA70b) These antibodies were shown to be crossreactive Therefore, the antibody against OsRPA70a was depleted of anti-OsRPA70b cross-reactive components by absorption on Sepharose-bound OsRPA70b Similarly, the polyclonal antibody against OsRPA70b was depleted of anti-OsRPA70a cross-reactive components by absorption on OsRPA70a This procedure abolished the cross-reactiv- FEBS Journal 272 (2005) 3270–3281 ª 2005 FEBS Two types of RPA in seed plants ity with other proteins observed in western blot analysis (data not shown) The OsRPA14 coding region was cloned into the pET21a expression vector (Novagen, San Diego, CA, USA) and transformed into E coli for protein induction Extracts prepared from cells induced for h were shown to contain a six-histidine C-terminal-tagged OsRPA14 fusion protein The OsRPA14 protein was purified by His-Bind resin column chromatography The purified protein was used for immunization of rabbits Anti-rabbit IgG conjugated with alkaline phosphatase (Promega) was used as a secondary antibody with nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate as substrates [33] A thaliana T-DNA insertion mutant analysis A thaliana lines with T-DNA insertions in atrpa70a (SALK017580) and atrpa70b (SALK088429) were obtained from The Salk Institute Genomic Analysis Laboratory (SIGnAL) Insertion mutant information was obtained from the SIGnAL website (http://www.signal.salk.edu) One-week-old seedlings were used for UV-B, MMS, and H2O2 treatments UV-B lamps (Philips, Eindhoven, Netherlands) were used to irradiate A thaliana seedlings A thaliana seedlings were exposed to MMS and H2O2 for a week for sensitivity analysis RT-PCR cDNAs were synthesized using a Superscript II kit (Invitrogen) following the manufacturer’s procedures, and used as templates for PCR, with 70b F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b As a control, A thaliana putative 40S ribosomal protein S16 (At5g18380) was used (5¢ primer: GGCGACTCAACCAGCTACTGA; 3¢ primer: CGGTAA CTCTTCTGGTAACGA) The three-step cycling conditions were: 29 PCR cycles for AtRPA70b (F1-R1), 35 cycles for AtRPA70b (F2-R2), and 25 cycles for S16, at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for A thaliana RNAi Sequences encoding the inverted-repeat RNA were cloned into the pBE2113 intermediate vector, which contains an enhanced CaMV 35S promoter, and a nopaline synthase promoter:neomycin phosphotransferase (Pnos:NPTII) gene for the selectable marker [34] A 460-bp section of b-glucoronidase (GUS) (1038–1498 bp) was cloned into the 3277 Two types of RPA in seed plants vector as the 5¢ and 3¢ arms of the intron To construct RNAi transgenic lines for AtRPA70a and AtRPA70b, gene-specific cDNA fragments were amplified by PCR using the following primer pairs: AtRPA70a-5¢ (TGT AACCGAGATGGTCGGCAAC) and AtRPA70a-3¢ (AA CAGTCATCTTCACTCTTTGT); AtRPA70b-5¢ (TTCAA CTTTGTACCCATTGAT) and AtRPA70b-3¢ (TTCACCG CCATTATATACCTTA) These primers were used to obtain a fragment of 722 bp corresponding to nt 1135– 1857 of the AtRPA70a cDNA (NM_126648), and of 683 bp corresponding to nt 823–1511 of the AtRPA70b cDNA (NM_120884) The PCR products were cloned into the intermediate vector Constructs were introduced into Agrobacterium tumefaciens strain EHA106, and transformed into wild-type (Columbia) plants by floral infiltration [35,36] The transgenic lines were selected on MS agar medium containing kanamycin, rifampicin, and chloramphenicol Chlorophyll extraction The concentration of chlorophyll extracted in 80% acetone was determined as described by Porra et al [37] Yeast two-hybrid analysis (b-galactosidase assay) The coding region of OsRPA32 was fused in-frame with the GAL4 DNA-binding domain in the pBKDT7 vector The cDNAs of OsRPA70a, OsRPA70b, and OsRPA14 were subsequently cloned into the pGADT7 vector encoding the GAL4 activation domain The GAL4 fusion constructs were transformed into the yeast strain AH109, and cells were plated on synthetic medium Transformation was carried out according to the MATCMAKER Two-Hybrid System manual (Clontech, Mountain View, CA, USA) Proteins were extracted from yeast carrying the pGADT7 vector, pGADT7-OsRPA70a+pBKDT7-OsRPA32, and pGADT7-OsRPA70b+pBKDT7-OsRPA32 using a urea ⁄ SDS method [38] Yeast transformants were grown in liquid medium overnight at 30 °C, centrifuged, and resuspended in Z buffer (60 mm Na2HPO4.7H2O, 40 mm NaH2PO4.H2O, 10 mm KCl, mm MgSO4.7H2O pH 7.0) A600 was determined for each sample o-Nitrophenol b-galactoside (4 mgỈmL)1) was added, and, when a medium yellow color had developed, the reaction was stopped The A420 of the supernatants was determined To calculate b-galactosidase units, the following equation was applied: U ¼ 1000A420 =5tA600 where t represents the time of reaction (min), A600 represents the cell density at the start of the assay, and A420 is a combination of absorbance by o-nitrophenol and light scattering by cell debris All the measurements were performed in triplicate [39,40] 3278 T Ishibashi et al Pull down assay (protein–protein interaction assay) T7 tag-OsRPA70a, OsRPA70b-6His tag, T7 tag-OsRPA32, OsRPA32–6His tag, and OsRPA14–6His tag were obtained by in vitro translation in wheatgerm extract (Invitrotec) according to the manufacturer’s procedure OsRPA70a (or OsRPA70b) and OsRPA32, or OsRPA32 and OsRPA14 were incubated with Talon beads (Clontech) for h at °C The beads were washed four times in NaCl ⁄ Pi buffer containing 250 mm NaCl and 0.2% Triton X-100, then eluted in NaCl ⁄ Pi buffer containing 200 mm imidazole After SDS ⁄ PAGE, proteins were blotted on to poly(vinylidene difluoride) membrane and probed with monoclonal antibody against T7 Overexpression of recombinant OsRPA70a and OsRPA70b The coding regions of OsRPA70a and OsRPA70b were cloned into the pET24a (OsRPA70a) and pET28a (OsRPA70b) expression vectors (Novagen) For protein expression, these constructs were introduced into Rosetta (DE3) E coli (Novagen), and the bacteria grown in 300 mL Luria–Bertani medium Cells were grown to an A600 of 0.8, and isopropyl b-d-thiogalactoside was added to a final concentration of mm Cells were harvested after h by centrifugation at 3000 g for 10 at °C Cell pellets were resuspended in 10 mL ice-cold binding buffer (20 mm Tris ⁄ HCl pH 7.9, 0.5 m NaCl, mm imidazole, 0.1% Nonidet P40) and sonicated with 15 bursts of 10 s each Cell lysates were centrifuged at 39 000 g for 30 Six-histidine fusion proteins of OsRPA70a and OsRPA70b were present in the inclusion body fraction, so cell pellets were subjected to three rounds of resuspension in binding buffer, sonication, and centrifugation After three repetitions of this procedure, the cell pellet was soluble in the presence of m urea Soluble fractions were loaded on to columns containing 10 mL His-Bind resin (Novagen) The columns were washed with 50 mL binding buffer containing m urea and then 50 mL wash buffer (20 mm Tris ⁄ HCl, pH 7.9, 0.5 m NaCl, 20 mm imidazole, 0.1% Nonidet P40, m urea) The bound proteins were eluted with 30 mL elution buffer (20 mm Tris ⁄ HCl, pH 7.9, 0.5 m NaCl, 500 mm imidazole, m urea) The eluted proteins were dialyzed against buffer A (50 mm Tris ⁄ HCl, pH 7.5, mm EDTA, mm 2-mercaptoethanol, 15% glycerol, 0.1% Nonidet P40) with decreasing concentrations of urea, as follows: m for 1.5 h, 1.5 m for 1.5 h, 0.5 m for 1.5 h, and no urea for 12 h RPA complex analysis RPA complexes were generated in E.coli Rosetta (DE3) (Novagen) OsRPA70a and OsRPA70b were cloned in FEBS Journal 272 (2005) 3270–3281 ª 2005 FEBS T Ishibashi et al pET21a, OsRPA14 in pET28a, and OsRPA32 in pGEX6p-1 (Amersham Biosciences) The regions containing the T7 promoter and the C-terminal His or GST tag were cloned in pET32a We made two constructs for coexpression: OsRPA70a(His)-OsRPA32(GST)-OsRPA14(His) and OsRPA70b(His)-OsRPA32(GST)-OsRPA14(His) For protein expression, each construct was introduced into BL21 (DE3) (Novagen), and the transformed bacteria grown in 200 mL Luria–Bertani medium Cells were grown to an A600 of 0.8, and isopropyl b-d-thiogalactoside was added to a final concentration of mm Cells were harvested after h by centrifugation at 3000 g for 10 at °C Cell pellets were resuspended in 10 mL ice-cold binding buffer and sonicated with 15 bursts of 10 s each Cell lysates were centrifuged at 39 000 g for 30 at °C The soluble RPA complexes of OsRPA70a(His)–OsRPA32(GST)–OsRPA14 (His) and OsRPA70b(His)–OsRPA32(GST)–OsRPA14 (His) were purified through His-Bind and GST–Sepharose (Amersham Biosciences) columns and treated with PreScission Protease (Amersham Biosciences) to remove the GST tags Purified proteins were loaded on to a HiPrep 16 ⁄ 60 Sephacryl S-300 HR (Amersham Biosciences), using a column buffer of 50 mm Tris ⁄ HCl, pH 7.5, 0.2 m NaCl, mm EDTA, 15% (v ⁄ v) glycerol, 0.1% Tween 20, and mm 2-mercaptoethanol Gel mobility-shift assay Binding of OsRPA70a, OsRPA70b, and OsRPA32 to ssDNA was studied by gel mobility-shift assay OsRPA70a and OsRPA70b were purified as described above (Overexpression of recombinant OsRPA70a and OsRPA70b) OsRPA32 was purified as described by Ishibashi et al [25] 32 P-labeled 30-bp single-stranded DNA (2 pmol) was heated at 95 °C for 10 and placed on ice immediately The DNA was then incubated in 20 lL of a reaction mixture containing 25 mm Hepes (pH 7.5), 100 mm NaCl, mm EDTA, 10% (v ⁄ v) glycerol, 0.1% Tween 20, 0.02% 2-mercaptoethanol, 0.5 mg poly(dI–dC), and 0.5 mg salmon sperm DNA on ice for OsRPA70a, OsRPA70b, and OsRPA32 proteins were then added, and the reaction mixture was incubated for a further 30 on ice DNA–protein complexes were resolved by electrophoresis on 4% polyacrylamide gels in 100 mm Tris ⁄ borate buffer, pH 8.3, containing mm EDTA and 2.5% (v ⁄ v) glycerol at °C The gels were dried and then autoradiographed Acknowledgements We thank the Rice Genome research Program (RGP) of Japan for providing the rice EST clone R0618 and are grateful to the Salk Institute Genomic Analysis Laboratory for providing the sequence-indexed Arabidopsis T-DNA insertion mutants (SALK 017580 and FEBS Journal 272 (2005) 3270–3281 ª 2005 FEBS Two types of RPA in seed plants SALK 088429) We also wish to express our appreciation to Dr Mitsuhara and Dr Ohashi (National Institute of Agrobiological Sciences) for providing the pBE2113 vector This work was supported by a grant from the Ministry of Agriculture, Forestry and Fisheries of Japan (Rice Genome Project IP-5006) and by a grant from the Ministry of Education, Science, Sports and Culture of Japan (Grant-in-Aid for Young Scientists (B), 15770031) This work was also supported by a grant from Futaba Electronics Memorial Foundation (Japan), The Asahi Glass Foundation (Japan) and The Sumitomo Foundation (Japan) References Iftode C, Daniely Y & Borowiec JA (1999) Replication protein A (RPA): the eukaryotic SSB Crit Rev Biochem Mol Biol 34, 141–180 Wold MS (1997) Replication protein A: a heterotrimeric, single-stranded DNA-binding protein required for eukaryotic DNA metabolism Annu Rev Biochem 66, 61–92 Raderschall E, Golub EI & Haaf T (1999) Nuclear foci of mammalian recombination proteins are located at single-stranded DNA regions formed after DNA damage Proc Natl Acad Sci USA 96, 1921–1926 Wang H, Guan J, Perrault AR, Wang Y & Iliakis G (2001) Replication protein A2 phosphorylation after DNA damage by the coordinated action of ataxia telangiectasia-mutated and DNA-dependent protein kinase Cancer Res 61, 8554–8563 Oakley GG, Loberg LI, Yao J, Risinger MA, Yunker RL, Zernik-Kobak M, Khanna KK, Lavin MF, Carty MP & Dixon K (2001) UV-induced hyperphosphorylation of replication protein a depends on DNA replication and expression of ATM protein Mol Biol Cell 12, 1199–1213 Hubscher U, Maga G & Spadari S (2002) Eukaryotic DNA polymerases Annu Rev Biochem 71, 133–163 Wobbe CR, Weissbach L, Borowiec JA, Dean FB, Murakami Y, Bullock P & Hurwitz J (1987) Replication of simian virus 40 origin-containing DNA in vitro with purified proteins Proc Natl Acad Sci USA 84, 1834– 1838 Wold MS & Kelly T (1988) Purification and characterization of replication protein A, a cellular protein required for in vitro replication of simian virus 40 DNA Proc Natl Acad Sci USA 85, 2523–2527 Fairman MP & Stillman B (1988) Cellular factors required for multiple stages of SV40 DNA replication in vitro EMBO J 7, 1211–1218 10 Wakasugi M, Reardon JT & Sancar A (1997) The noncatalytic function of XPG protein during dual incision in human nucleotide excision repair J Biol Chem 272, 16030–16034 3279 Two types of RPA in seed plants 11 Buschta-Hedayat N, Buterin T, Hess MT, Missura M & Naegeli H (1999) Recognition of nonhybridizing base pairs during nucleotide excision repair of DNA Proc Natl Acad Sci USA 96, 6090–6095 12 Aboussekhra A, Biggerstaff M, Shivji MK, Vilpo JA, Moncollin V, Podust VN, Protic M, Hubscher U, Egly JM & Wood RD (1995) Mammalian DNA nucleotide excision repair reconstituted with purified protein components Cell 80, 859–868 13 Dianov GL, Jensen BR, Kenny MK & Bohr VA (1999) Replication protein A stimulates proliferating cell nuclear antigen-dependent repair of abasic sites in DNA by human cell extracts Biochemistry 38, 11021–11025 14 Otterlei M, Warbrick E, Nagelhus TA, Haug T, Slupphaug G, Akbari M, Aas PA, Steinsbekk K, Bakke O & Krokan HE (1999) Post-replicative base excision repair in replication foci EMBO J 18, 3834–3844 15 Sugiyama T, Zaitseva EM & Kowalczykowski SC (1997) A single-stranded DNA-binding protein is needed for efficient presynaptic complex formation by the Saccharomyces cerevisiae Rad51 protein J Biol Chem 272, 7940–7945 16 Golub EI, Gupta RC, Haaf T, Wold MS & Radding CM (1998) Interaction of human rad51 recombination protein with single-stranded DNA binding protein, RPA Nucleic Acids Res 26, 5388–5393 17 Stauffer ME & Chazin WJ (2004) Physical interaction between replication protein A and Rad51 promotes exchange on single-stranded DNA J Biol Chem 279, 25638–25645 18 Din S, Brill SJ, Fairman MP & Stillman B (1990) Cell-cycle-regulated phosphorylation of DNA replication factor A from human and yeast cells Genes Dev 4, 968– 977 19 Brush GS & Kelly TJ (2000) Phosphorylation of the replication protein A large subunit in the Saccharomyces cerevisiae checkpoint response Nucleic Acids Res 28, 3725–3732 20 Binz SK, Sheehan AM & Wold MS (2004) Replication protein A phosphorylation and the cellular response to DNA damage DNA Repair (Amst) 3, 1015–1024 21 Dutta A, Ruppert JM, Aster JC & Winchester E (1993) Inhibition of DNA replication factor RPA by p53 Nature 365, 79–82 22 Zou L & Elledge SJ (2003) Sensing DNA damage through ATRIP recognition of RPA-ssDNA complexes Science 300, 1542–1548 23 Unsal-Kacmaz K & Sancar A (2004) Quaternary structure of ATR and effects of ATRIP and replication protein A on its DNA binding and kinase activities Mol Cell Biol 24, 1292–1300 24 van der Knaap E, Jagoueix S & Kende H (1997) Expression of an ortholog of replication protein A1 (RPA1) is induced by gibberellin in deepwater rice Proc Natl Acad Sci USA 94, 9979–9983 3280 T Ishibashi et al 25 Ishibashi T, Kimura S, Furukawa T, Hatanaka M, Hashimoto J & Sakaguchi K (2001) Two types of replication protein A 70 kDa subunit in rice, Oryza sativa: molecular cloning, characterization, and cellular & tissue distribution Gene 272, 335–343 26 Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana Science 301, 653–657 27 Longhese MP, Plevani P & Lucchini G (1994) Replication factor A is required in vivo for DNA replication, repair, and recombination Mol Cell Biol 14, 7884–7890 28 Gomes XV & Wold MS (1995) Structural analysis of human replication protein A Mapping functional domains of the 70-kDa subunit J Biol Chem 270, 4534– 4543 29 Henricksen LA, Umbricht CB & Wold MS (1994) Recombinant replication protein A: expression, complex formation, and functional characterization J Biol Chem 269, 11121–11132 30 Hata S, Tsukamoto T, Osumi T, Hashimoto J & Suzuka I (1992) Analysis of carrot genes for proliferating cell nuclear antigen homologs with the aid of the polymerase chain reaction Biochem Biophys Res Commun 184, 576–581 31 Kimura S, Furukawa T, Kasai N, Mori Y, Kitamoto HK, Sugawara F, Hashimoto J & Sakaguchi K (2003) Functional characterization of two flap endonuclease-1 homologues in rice Gene 314, 63–71 32 Baba A, Hasezawa S & Syono K (1986) Cultivation of rice protoplasts and their transformation mediated by Agrobacterium spheroplast Plant Cell Physiol 27, 463–471 33 Towbin H, Staehelin T & Gordon J (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications Proc Natl Acad Sci USA 76, 4350–4354 34 Mitsuhara I, Ugaki M, Hirochika H, Ohshima M, Murakami T, Gotoh Y, Katayose Y, Nakamura S, Honkura R, Nishimiya Ueno K, et al (1996) Efficient promoter cassettes for enhanced expression of foreign genes in dicotyledonous and monocotyledonous plants Plant Cell Physiol 37, 49–59 35 Chuang CF & Meyerowitz EM (2000) Specific and heritable genetic interference by double-stranded RNA in Arabidopsis thaliana Proc Natl Acad Sci USA 97, 4985–4990 36 Smith NA, Singh SP, Wang MB, Stoutjesdijk PA, Green AG & Waterhouse PM (2000) Total silencing by intron-spliced hairpin RNAs Nature 407, 319–320 37 Porra RJ, Thompson A & Friedelman PE (1989) Determination of accurate extraction and simultaneously equation for assaying chlorophyll a and b extracted with different solvents: verification of the FEBS Journal 272 (2005) 3270–3281 ª 2005 FEBS T Ishibashi et al concentration of chlorophyll standards by atomic absorption spectroscopy Biochim Biophys Acta 975, 384–394 38 Printen JA & Sprague GF Jr (1994) Protein–protein interactions in the yeast pheromone response pathway: Ste5p interacts with all members of the MAP kinase cascade Genetics 138, 609–619 FEBS Journal 272 (2005) 3270–3281 ª 2005 FEBS Two types of RPA in seed plants 39 Miller JH (1972) Experiments in Molecular Genetics Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 40 Miller JH (1992) A Short Course in Bacterial Genetics Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 3281 ... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC2–5 and Rad9–Rad1–Hus1)... (AtRPA7 0a and AtRPA70b, respectively) and because many T-DNA insertion mutants of A thaliana are already available [26] We were able to obtain one T-DNA insertion line each for AtRPA7 0a and AtRPA70b