Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export Wouter S. P. Jong 1 , Corinne M. ten Hagen-Jongman 1 , Pierre Genevaux 2 , Josef Brunner 3 , Bauke Oudega 1 and Joen Luirink 1 1 Department of Molecular Microbiology, Institute of Molecular Cell Biology, Vrije Universiteit, Amsterdam, the Netherlands; 2 Department of Microbiology and Molecular Medicine, Centre Me ´ dical Universitaire, Geneva, Switzerland; 3 Institute of Biochemistry, Eidgeno ¨ ssische Technische Hochschule Zu ¨ rich, Zu ¨ rich, Switzerland Twin-arginine translocation (Tat)-mediated protein trans- port across the bacterial cytoplasmic membrane occurs only after synthesis and folding of the substrate protein that contains a signal peptide with a characteristic t win-arginine motif. This implies that p remature contact between the T at signal peptide a nd the T at translocon in the membrane must be prevented. We used site-specific photo-crosslinking to demonstrate that t he signal peptide of nascent T at proteins is in close proximity to the c haperone and peptidyl-prolyl isomerase trigger f actor (TF). The contact with TF was strictly dependent on the context of the translating ribosome, started early in biogenesis when the nascent chain left the ribosome near L 23, and p ersisted until the c hain reached i ts full length. Despite this exclusive and prolonged contact, depletion o r o verexpression of TF had little effect on the kinetics and efficiency of the Tat export process. Keywords: Escherichia coli; protein targeting; signal peptide; trigger f actor; twin-arginine translocation. In Escherichia coli, most proteins that reside in the periplasmic space are synthesized as preproteins with a cleavable N-terminal signal peptide that mediates targeting to the inner membrane. Signal peptides classically have a tri-partite structure with a positively charged N-region, a hydrophobic core, and a polar C-region that contains the signal peptidase cleavage site [1]. The majority of periplas- mic proteins are targeted to the main protein-conducting channel, the SecYEG complex, via the post-translational SecB/SecA pathway (reviewed in [2]). Recently, the cytosolic chaperone and folding catalyst trigger factor (TF) was shown to have a significant impact on the efficiency of Sec-mediated transport. Inactivation of the gene e ncoding TF increased the rate of transport and suppressed the requirement for the chaperone and targeting factor SecB, whereas overproduction of TF impeded transport [ 3]. TF is in part associated with the ribosomal protein L23 that is located near t he major n ascent ch ain exit site [4]. In vitro crosslinking studies showed that TF can be crosslinked to a variety of n ascent polypeptides when they emerge from the ribosome near L23 [5–9]. Interestingly, L23 also serves as a docking s ite f or the bacterial signal recognition particle (SRP) that delivers preproteins at the SecYEG complex in a cotranslational targeting mechanism [9]. Whether or not TF c ontrols the entry o f proteins i nto the SRP pathway is not fully clear (reviewed in [10]). The twin -arginine translocation ( Tat) pathway has been identified as a second post-translational targeting/trans- location pathway t hat operates i ndependently of the Sec pathway (reviewed in [11]). In contrast to the Sec pathway, the Tat pathway has the striking a bility to mediate the export o f s ubstrates that have acquired a fully folded or even oligomeric confo rmation in the c ytoplasm. T at substrates possess a signal peptide of the ÔclassicalÕ tri-partite stru cture but including a h ighly conserved ( S/T)RRxFLK consensus motif between the N-region and the hydrophobic core [ 12]. This motif provides specificity for the Tat machinery consisting of the i ntegral membrane proteins TatA/E, TatB and TatC [11]. Little is known about the molecular mechanism of targeting and export of Tat-dependent proteins. In partic- ular, information on the generic and s pecific interactions of the T at signal peptide and mature domain with targeting factors, chaperones a nd folding catalysts is scarce. The cytosolic DmsD protein was s hown to have affinity for immobilized Tat signal peptides of both dimethylsulfoxide reductase (DmsA) and trimethylamine N-oxide reductase (TorA) [13] and for the TatB/TatC components [14], suggesting a r ole for DmsD i n guiding substrates to the Tat machinery. H owever, recent in vivo studies suggested that DmsD is not required f or targeting but rather has a chaperone-like function in the assembly of certain Tat proteins [15]. Correspondence to J. Luirink, Department of Molecular Micro- biology, Institute of Molecular Cell Biology, Vrije Universiteit, De Boelelaan 1087, 1081 HV Amst erdam, the Netherlands. Fax: +31 20 4446979, Tel.: +31 2 0 4447175, E-mail: joen.luirink@falw.vu.nl Abbreviations: HA, hemagglutinin; Tat, twin-arginine translocation; TF, trigger factor; OmpA, outer membrane protein A; TorA, tri- methylamine N-oxide reductase; (Tmd)Phe-tRNA sup , L -[3-(trifluoro- methyl)-3-diazirin-3H -yl]phenylalanine-tRNA sup ; IMVs, inverted inner membrane vesicles; Ffh, fifty-four homologue; SRP, signal recognition particle. (Received 2 8 July 2 004, revised 6 October 2004, accepted 18 October 2004) Eur. J. Biochem. 271, 4779–4787 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04442.x Here, we have used an unbiased in vitro translation and photo-crosslinking appro ach to probe the molecular inter- actions of model Tat substrates during synthesis and p rior to tar geting to t he Tat machinery. We f ound that the signal peptide of Tat-dependent proteins is extensively a nd exclu- sively crosslinked t o r ibosomal components and TF during synthesis. Interestingly, TF was found crosslinked until late in translation but only in the context of the translating ribosome. However, in vivo experiments revealed only a small effect of TF on the kinetics and efficiency of Tat- mediated export. Experimental procedures Strains, plasmids and media E. coli K-12 strains and plasmids used in this study are listed in Table 1 . Strains were routinely grown in M9-medeu m [16] containing 0.1% casaminoacids (Difco, Detroit, MI, USA). Where appropriate, streptomycin ( 50 lgÆmL )1 ), chloramphenicol ( 15 lgÆmL )1 ), kanamycin (30 lgÆmL )1 ), spectinomycin (50 lgÆmL )1 ) a nd ampicillin (100 lgÆmL )1 ) were added to the medium. Reagents and sera Restriction enzymes and t he Expand-Long template PCR system were supplied by Roche M olecular Biochemicals GmbH (Mannheim, Germany). T4-DNA ligase was from Epicentre Technologies ( Madison, WI, USA). Megashort T7 transcription kit was f rom A mbion (Austin, TX, USA). [ 35 S]Methionine and protein A–Sepharose were obtained from Amersham Biosciences (Uppsala, Sweden). All other chemicals were supplied by S igma-Aldrich (Steinheim, Germany). Antisera against L 23 and L29, TF, SufI, and OmpA were provided by R. Brimacombe (Max Planck Institute for Molec ular G enetics, Berlin, Germany), W. Wickner (Dartmouth Medical School, Hannover, NH, USA), T . P almer ( University of East Anglia, Norwich, UK), and J. W. de Gier (Stockholm University, Sweden), respectively. The rabbit polyclonal antiserum against the human influenza hemagglutinin (HA)-epitope was from Sigma. Plasmid construction Plasmid pC4Meth-100TorA/P2 was constructed by PCR, using pTorA/P2 [ 17] a s a template and the primers RRTorA-SacI-fw (5¢-GCGCG GAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCAT GGATCCCGCGCGC TTGATGTAATC-3¢, BamHI site underlined). The result- ing PCR fragment was cloned into pC4Meth [5] u sing the SacI/BamHI sites. Amber (TAG) codons were then incor- porated at position 13 or 24 via nested PCR as described [18], resulting in pC4Meth-100TorA/P2TAG13 a nd pC4Meth-100TorA/P2TAG24. Plasmids pC4Meth-57SufI, pC4Meth93-SufI and pC4Meth-SufIHA (encoding SufI with a C-terminal HA-epitope, preceded by a Pro-Gly-Gly spacer) w ere constructed b y PCR using pNR30 (gift from T. Palmer) as a t emplate. The fo rward primer w as SufI-EcoRI-fw (5¢-GCCG GAATTCTAATATGTCACTC AGTCGGCGTC-3¢, Eco RI site underlined). The reverse primers were 51SufI-BamHI-rv (5¢-ACGC GGATCCAG TCATAAACAGCGGTTGC-3¢, Bam HI site un derlined), 87SufI-BamHI-rv (5 ¢-ACGC GGATCCAACATCGTCGC CCTTCCA-3¢, BamHI site underlined) and SufIHA- XbaI+ClaI-rv (5¢-ACTG ATCGATCTAGATTACGCAT AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG GTACCGGATTGACCAAC- 3¢, ClaI site underlined, XbaI site in italics, HA-epito pe sequence in boldface). The resulting fragments were cloned into pC4Meth using the EcoRI/BamHI or EcoRI/ClaI restriction sites where appro- priate. The amber codon at position 8 was incorporated via nested PCR, resulting in pC4Meth-57SufITAG8, pC4Meth-93SufITAG8 and pC4Meth-SufIHATAG8. The in vivo expression plasmid pBAD18-SufIHA was construc- ted as follows. First, the EcoRI/XbaI f ragment from pNR30, including the SufI coding region and the first 18 bp upstream of the ATG-start codon, was c loned into pBAD18 [19]. The resulting plasmid pBAD18-SufI w as then used as a template i n PCR using the primers SufI- EcoRI-fw and SufIHA-XbaI+ClaI-rv (see above). Finally, the AatII/XbaI f ragment of t he ob tained PCR product was inserted into pBAD18-SufI. Nucleotide sequences were confirmed by semi-automated DNA sequencing. In vitro transcription, translation and crosslinking Truncated mRNA was prepared as described previously [20] from HindIII linearized pC4Meth-100TorA/P2, pC4Meth-57SufI o r p C4Meth-93SufI derivative plasmids. Full-length SufIHATAG8 mRNA was prepared from ClaI linearized pC4Meth-SufIHATAG8. In vitro translation, photo-crosslinking and sodium carbon ate e xtraction were carried out as described [18,21]. Samples were analyzed Table 1. Bacterial strains and plasmids use d in this study. Strain/plasmid Relevant genotype Reference MC4100 F’araD139D(argF-lac)U169 rpsL150 relAI flb5301 ptsF25 rbsR [40] MC4100Dtig MC4100Dtig::Cm r [33] MC4100DdnaKdnaJ MC4100DdnaKdnaJ ::Kan r thr::Tn10 [33] MC4100DtigDdnaKdnaJ MC4100Dtig::Cm r D dnaKdnaJ::Kan r thr::Tn10 [33] MC4100DtatA/E MC4100DtatADtatE [41] MC4100DtatB MC4100DtatB [41] MC4100DtatC MC4100DtatC::XSpec r [26] HDB37 MC4100araD [3] pC4Meth-100TorA/ P2TAG13 pC4Meth, 94torA/ P2TAG13 This study pC4Meth-100TorA/ P2TAG24 pC4Meth, 94torA/ P2TAG24 This study pC4Meth-57SufITAG8 pC4Meth, 51sufITAG8 This study pC4Meth-93SufITAG8 pC4Meth, 87sufITAG8 This study pC4Meth-SufIHATAG8 pC4Meth, sufIHATAG8 This study pBAD18-SufIHA pBAD18, sufIHA This study pJH42 pBAD18, tig [3] 4780 W. S. P. Jong et al.(Eur. J. Biochem. 271) Ó FEBS 2004 directly by SDS/PAGE or immunoprecipitated first using 3-fold the amount used for direct analysis. Pulse-chase analysis Strain MC4100 and its Dtig , DdnaKdnaJ, Dtig DdnaKdnaJ and DtatC mutant derivatives, all harboring pBAD18- SufIHA, were grown overnight in M9-medium contain ing 0.4% glucose, diluted to a n a ttenuance a t 6 60 nm (D 660 )of 0.05infreshmediumandgrowntoaD 660 of 0.35. Strains HDB37 and MC4100DtatA/E, both harboring p JH42, were grown overnight in M9-medium, diluted to a D 660 of 0.05 in fresh M9-medium and grown to an D 660 of 0.3. Upon reaching the a ppropriate D 660 , cells were washed and r esuspended in M9-medium containing a cysteine- and methionine-free amino acid mix. After recovery for 15 min (pBAD18-SufIHA harboring strains) o r 90 min (pJH42 harboring strains) at the appropriate temperatures, cells were pulse-labeled with 10 lCiÆmL )1 [ 35 S]methionine for 1 min andchasedwith2m M cold methionine for the times indicated. To stop the chase, cells were precipitated w ith 10% trichloroacetic acid at 4 °C. Sample s were analyzed either directly or upon immunoprecipitation by SDS/PAGE. Sample analysis Radiolabeled proteins were visualized by phosphor imagin g using a Molecular Dynamics PhosphorImager 473 and quantified using the IMAGEQUANT software from Molecular Dynamics/Amersham Biosciences. Results The TorA signal peptide is close to trigger factor early in biogenesis Tat preproteins fold in the c ytosol, prior to export by t he Tat machinery in the inner membrane that specifically recognizes the Tat signal peptide [11,22]. It has been suggested that t his signal p eptide is sheltered during synthesis a nd folding by generic or specific f actors in the cytosol to prevent premature interactions with the Tat translocon [23,24]. The molecular interactions of the signal peptides of model Tat substrates early in biosynthesis were studied using a n in vitro translation and crosslinking approach. Nascent chains of TorA/P2, a strictly Tat- dependent chimera comprising the signal peptide of TorA fused to t he periplasmic P2 domain of leader p eptidase [17], were generated from truncated mRNA to a length of 100 amino acid residues in a cell- and membrane-free E. coli lysate without addition of any purified proteins. The nascent chains were radiolabeled with [ 35 S]methionine. To specific- ally probe the m olecular environment of the TorA signal peptide, TAG-stop codons were incorporated in 100TorA/ P2 either at position 13, two residues downstream of the c onserved a rginine p air, or within the h ydrophobic core at position 24 (Fig. 1A). The TAG-codons were suppressed during in vitro synthesis by t he addition of L -[3- (trifluoromethyl)-3-diazirin-3H-yl]phenylalanine-tRNA sup [(Tmd)Phe-tRNA sup ] which carries a photo-reactive probe. After translation, one half of each sample was irradiated AB C Fig. 1. Photo-crosslinking to the signal peptide of nascent TorA/P2. (A) S chematic representation of nascent 100TorA/P2. The T orA signal peptide is ind icated as a solid line. Posi tions of the conserved twin-arginine motif ( RR) and the sto p codons (TAG) t hat are suppressed with (Tmd )Phe- tRNA sup are indicated. (B) In vitro translation o f 100TorA/P2TAG13. After translation, samples were irradiated with UV-light to induce crosslinking or kept in th e dark as indicated. UV-irradiated ribosome-nascent chain complexes were immunoprecipitated (IP) with TF a ntiserum as indicated. Prior to crosslinking, one sample was s plit into equal aliquots and incubated w ith 2 m M puromycin (Puro), 2 m M puromycin and 0.5 M potassium acetate (HS), o r mock-treated with incubation buffer at 37 °Cfor10min.(C)In vitro translation of 100TorA/P2TAG13 and 100TorA/ P2TAG24 as f or (B ), carried out in the p resence o r a bsence of IMVs. Samples with IMVs were extracted with sodium carbonate and t he re sulting carbonate-pellet ( p) and -supernatant (s) fractions were analyzed. Crosslinked p roducts, nascent c hains (NC), peptidyl-tRNA (*) and molecular mass markers ( at the left side of the pane ls in kDa) are indicated. Ó FEBS 2004 Role of trigger factor in Tat-mediated export (Eur. J. Biochem. 271) 4781 with UV-light to induce crosslinking, whereas the other half was kept in the dark to serve as a negative control. The TAG-codons at both positions wer e efficiently suppressed by (Tmd)Phe-tRNA sup (data not shown), resulting in nascent T orA/P2 of the expected m olecular mass carrying t he photo-reactive probe at the indicated position. UV-irradiation o f 1 00TorA/P2TAG13 resulted in two c rosslinked products of  70–80 kDa (Fig. 1B, l ane 2). Both adducts represented crosslinks to the cytosolic chaperone TF as shown by immunoprecipitation ( Fig. 1B, lane 3). TF was also crosslinked to position 24 within the hydrophobic core (Fig. 1C, l ane 8) but with a different ratio of the 70 and 80 kDa adducts (Fig. 1C, compare lanes 2 and 8). The observation that crosslink ing of nascent c hains to TF results in a double banded pattern has been made previously [5,8] but is not yet understood. To investigate w hether crosslinking of TF to 100TorA/P2 is dependent on the context of the ribosome, nascent 100TorA/P2TAG13 was released from the r ibosome with puromycin or puromycin in a Ôhigh saltÕ buffer after translation but prior to c rosslinking. Both t reatments diminished crosslinking to TF (Fig. 1B, lane 5 a nd 6), indicating that association w ith the ribosome is crucial for the interaction with TF. Molecular i nteractions of 100TorA/P2TAG13 a nd 100TorA/P2TAG24 were also investigated in the presence of inverted inner membrane vesicles (IMVs) that were isolated from an E. coli MC4100 wild-type strain. After translation a nd UV-irradiation, samples were extracted with sodium carbonate to separate the membrane integrated from the peripheral membrane a nd soluble p roteins. Using 100TorA/P2TAG13, no obvio us changes in crosslinking pattern a ppeared compared to the situation when mem- branes were notpresent (Fig. 1C, lanes 1–6). TF continued to be the major crosslinking partner and no crosslinking products were detected in the integral membrane f raction (Fig. 1C, lanes 4 and 6 ). Interestingly, u pon addition of IMVs, pos ition 2 4 o f the TorA signal peptide was found to specifically crosslink, in addition to TF, two low molecular mass proteins of  7kDaand 17 kDa (Fig. 1C, lane 10). These adducts were detected in the supernatant fraction a fter carbonate extraction, indicating that the crosslinked p artners are peripheral membrane proteins and not one of the known Tat p roteins [25]. The adducts could not be immunoprecip- itated with various antisera tested and remain to be identified. Taken together, the twin-arginine motif and the hydro- phobic core region of the TorA signal p eptide are adjacent to TF early during biogenesis. Additional c ontacts with two yet unknown peripheral m embrane proteins a ppeared restricted to th e hydrophobic core region. Other cytosolic factors with affinity for signal peptides w ere not detectably crosslinked. The SufI signal peptide is in close proximity to TF, L23 and L29 early in biogenesis To investigate whether the observed contact o f TF with the TorA signal peptide is generic for Tat substrates, SufI was included i n our crosslinking stud ies. SufI belongs t o the multicopper oxidase superfamily but does not contain copper cofactors [26]. It has been used extensively as a model Tat substrate [26–29]. SufI nascent chains were generated (as described above for 100TorA/P2), carrying a photo-reactive probe at positio n 8, t wo amino acids downstream from the conserved arginine pair ( Fig. 2A). Nascent chains of 5 7 a nd 93 amino acids were synthesized. 93SufITAG8 is comparable to 100TorA/P2TAG13 with respect to the position of the photo-reactive probe relative to the peptidyl-transferase center (compare Figs 2A and 1A). 57SufITAG8 w as analyzed to monitor t he earliest inter- actions in nascent SufI (Fig. 2A). A B Fig. 2. Photo-crosslinking to the signal p eptide of nascent SufI. (A) Schematic represen tation o f nascent Su fI c onstructs. T he SufI signal peptide is ind icated as a solid line. Positions of the conserved twin- arginine motif (RR) and the stopcodons (TAG) that are suppressed with (Tmd)Phe-tRNA sup are indicated. (B) In vitro tran slation of 57SufITAG8 an d 93SufITAG8. After translation, one hal f of each sample was irradiated with UV-lig ht to induce crosslinking and one half was kep t in t he dark. UV-irradiated ribosome-nascent ch ain complexes were i mmunoprecipitated (IP) with antiserum aga inst TF, L23 or L29 as indicated. Molecular mass markers (kDa) are indicated at th e left side of t he panels. 4782 W. S. P. Jong et al.(Eur. J. Biochem. 271) Ó FEBS 2004 Upon irradiation o f 57SufITAG8 a nd 93SufITAG8 w ith UV-light, adducts o f  65–75 kDa were detected (Fig. 2B, lanes 2 and 7) that represented crosslinking to TF, as shown by immunoprecipitation (Fig. 2B, lanes 5 and 10). Using 57SufITAG8, two adducts of lower molecular mass w ere identified as the ribosomal subunits L23 (Fig. 2B, l ane 3) and L29 ( Fig. 2 B, lane 4). L23 a nd L29 are l ocated near the major r ibosomal exit site [30]. 93SufITAG8 was also found to crosslin k to L23 an d L29 (Fig. 2B, lanes 8 and 9), but to a much lower e xtent. In con trast, t he 93-mer crosslinked much more strongly to TF than the 57-mer (Fig. 2B, compare lanes 2 and 7) . Together, t he data suggest that nascent SufI leaves the ribosome via the major ribosomal exit site and that, upon extension o f the nascent c hain, the SufI signal peptide moves away from L23 and L29 and interacts w ith TF. Further- more, the combined data obtained with nascent TorA/P2 and SufI constructs strongly suggest that interaction of TF with the signal peptide early i n biosynthesis i s generic for Tat substrates. The SufI signal peptide is close to TF until late in translation In the crosslinking experiments described above we showed th at TF interacts with t he signal peptide of relatively short nascent Tat substrates in which the signal peptide is barely exposed. T o investigate the influence of nascent chain l ength on the ability of TF to crosslink to the Tat signal peptide we made u se of a full-length version of SufI that carries an immunogenic HA-epitope at its C-terminus (SufIHA), and a photo-reactive probe at position 8 in the signal peptide (SufIHATAG8). Translation o f this construct resulted in a ladder of distinct truncates (Fig. 3 , lane 2) that could be released from the ribosome upon incubatio n with EDTA (data not shown). Only a small yield of full-length product was obtained, as sho wn by i mmunoprecipitation using a n antiserum d irected against the C-terminal HA-epitope (Fig. 3, lane 1). UV -crosslinking of this random array of translation intermediates resulted in numerous distinct adducts (Fig. 3, lane 4). TF antiserum immunoprecipi- tated many of these adducts up to a mass o f  120 kDa (Fig. 3, lane 5), corresponding to a complex of TF and an approximately full-length version of SufIHATAG8. This suggests that the signal peptide of SufI interacts with TF until completion of translation. As observed before (Fig. 2B, lanes 2 and 7), efficient crosslinking to TF started from a nascent-chain length between 57 and 93 amino acid residues (Fig. 3, compare lane 5 with lanes 6and7). A crosslinked c omplex at  170 kDa [Fig. 3, lane 4, indicated with (*)] was not precipitated with the TF antiserum. Strikingly, this band appeared more intense upon incubation of the translation mixture with EDTA and was immunoprecipitated with a n antiserum against the HA-epitope (data not shown), indicative of cross- linking to the released full-length form of SufIHA. Notably, an identical  170 kDa crosslinked complex was observed upon completion of synthesis and release of SufIHATAG8 from the ribosome in a tr anscription/ translation system optimized for t he production of full- length SufIHA (data not shown). T he crosslinked partner(s) in this complex h ave not been identified yet. In the presence of membrane vesicles derived from a strain that overproduces all components of the Tat translocase, released full-length S ufIHA was crosslinked to TatB (data not shown) consistent with earlier data obtained by Alami and coworkers [29] and confirming that our in v itro system sustains faith ful targeting o f Tat substrates. TF is dispensable for the export of SufI in vivo The in vitro crosslinking experiments described above suggested that TF s equesters the signal peptide of a Tat substrate while it is being synthesized on the r ibosome. To investigate whether this interaction is functionally relevant for the export of Tat p roteins, we monitored the effect of the intracellular TF level on the efficiency and kinetics of SufI export in vivo. Steady state analysis of e ndogenous SufI in w hole cell samples o f a Dtig mutant strain did not show accumulation of the precursor of SufI (pre-SufI) (Fig. 4A, lane 4), Fig. 3. Photo-crosslinking of TF to the signal peptide of nascent SufI chains of various lengths. In vitro translation o f f ull-length Su fIHA- TAG8 from non-truncated mRNA in the presence of (Tmd)Phe- tRNA sup . Translation products were immunoprecipitated (IP) with antiserum against the HA-epitope as indicated. After translation, half of the sample w as irradiated with UV-light to induce crosslinking and half was kept in the dark. C rosslinked material w as im munoprec ipi- tated with TF antiserum as indicated. An  170 kDa complex that could be precipitated with a nti-HA, but not with anti-TF serum is indicated with an asterisk. Samples were a nalyzed by SDS/PAGE. F or comparison, cro sslinks o f TF to 57SufI and 93SufI, im munoprec ipi- tated with antiserum against TF (corresponding with Fig. 2B, lanes 5 and 10), were run on the same gel (lanes 6 and 7). Molecular m ass markers ( kDa) are i ndicated at the left s ide of the pa nels. Ó FEBS 2004 Role of trigger factor in Tat-mediated export (Eur. J. Biochem. 271) 4783 suggesting SufI export i s not significantly affected. TF has been shown to o verlap with the DnaK chaperone machinery with respect t o f olding and substrate specificity [31,32]. Interestingly, DnaK has also been shown to interact with an immobilized Tat s ignal peptide [13]. In light of this evidence, we monitored the effect of deletion of DnaK and its co-chaperone DnaJ on SufI export. Notably, a s mall but reproducible accumulation of pre-SufI was observed i n a DdnaKdnaJ double mutant (Fig. 4A, lane 5). This effect was enhanced in a Dtig DdnaKdnaJ triple mutant (Fig. 4A, lane 3). The latter strain was recently constructed and is viable only in a narrow temperature range [33]. The precursor o f the SecB-dependent outer membrane protein A (OmpA) was not detected in any of t he mutants t ested. This is consistent with published data that suggest acceleration rather than deceleration of t he export of SecB-dependent secretory proteins in the absence of TF [3]. We next investigated the kinetics o f SufI e xport by pulse- chase analysis in t he different genetic backgrounds (Fig. 4B). In this a ssay we h ad to rely on SufI, provided with a C-terminal HA-tag, expresse d from an exp ression vector to obtain detectable SufI signals. I n a wild-type strain, tagged pre-SufI was processed to its mature form with the slow kinetics characteristic of T at proteins (Fig. 4 B, lanes 1–5) [17,23,26]. Furthermore, pre-SufIHA w as not processed in a tatC minus background during t he chase period (Fig. 4B, lanes 21–25), confirming that the HA-tag does not change targeting pathway specificity. The kinetics of processing appeared not significantly affected in a Dtig, DdnaKdnaJ or Dtig DdnaKdnaJ mutant as compared to the wild-type M C4100 s train (Fig. 4B, lanes 6 –10, 11 –15 and 16–20). Together, the results demonstrate a s mall, additive and specific effect of dnaKdnaJ and tig deletion on SufI e xport. The e ffect is only observed in steady state and may be the result of a s mall subpopulation of pre-SufI that accumulates in an export-incompetent conformation due to impaired folding or premature targeting. To investigate the effect of increased i ntracellular TF levels on the efficiency of Tat-mediated export, steady state signals and export kinetics of endogeneous SufI were monitored upon overproduction of TF from an inducible expression vector (pJH42) (Fig. 5 B). When TF expression was induced for 9 0 min prior to labeling, no significant effect on the kinetics of SufI e xport was apparent (Fig. 5B, compare l anes 5– 8 and 1–4). Massive overexpression of TF under these conditions was c onfirmed by trichloroacetic acid precipitation of the labeled cells (Fig. 5B, lanes 5–8). As a control, export o f SufI in a Tat-deficient MC4100DtatA/E strain w as completely blocked in the presence of pJH42 (Fig. 5B, lane 10). Similarly, steady state analysis did not A B Fig. 4. In vivo analysis of S ufI export in Dtig, DdnaKdnaJ and Dtig DdnaKdnaJ mu tants. S teady state (A) and pulse-chase (B) analysis of SufI e xport in strains M C4100, MC4100Dtig,MC4100DdnaKdnaJ, MC4100DtigDdnaKdnaJ and MC4100DtatC at 30 °C. (A) Cells were grown i n medium c ontaining glucose (0.2%) t o an D 660 of  0.6 and analyzed by SDS/PAGE an d immun oblotting using a nti-SufI (top ) and a nti-OmpA se rum (bottom). (B) Cells, harboring pBAD18- SufIHA, were grown in medium containing glucose (0.4%) to an D 660 of 0.35, radiolabeled with [ 35 S]methionine for 1 min and chased for the times indicated. Expression of SufIHA was induced by addit ion o f L -arabinose (0.2%) 5 min prior to labeling. Samples were immuno- precipitated using a n tiserum against SufI. A B Fig. 5. In vivo analysis of SufI upon overexpression of TF. Steady state (A) and pulse-chase ( B) analysis of SufI export in strains HDB37 and MC4100DtatA/E, both harboring TF-overexpressing pla smid pJH42, at 37 °C. (A) Cells were grown to an D 660 of  0.4 an d induced f or TF overexpression by the a ddition of L -arabinose (0.2%) as in dicated. Samples were t aken 0.5 h and 4 h a fter i nduction as ind icated. Cells were analyzed b y SDS/PAGE and im munoblotting using antiserum against SufI (top) an d OmpA ( center), or Coomassie Blue staining (bottom). (B) Cells were grown to an D 660 of  0.3, radiolabeled with [ 35 S]methionine for 1 min a nd chased for the tim es i ndic ated. W here indicated, overexpression of TF was induced b y the addition of 0.2% L -arabinose 9 0 m in prior to labeling. Before analysis by SDS/PAGE, samples were i mmunoprecipitated using antiserum against S ufI (top) and OmpA (center), or pre cipitated with trichloroacetic acid (bottom). 4784 W. S. P. Jong et al.(Eur. J. Biochem. 271) Ó FEBS 2004 reveal any effect on pre-SufI processing after 4 h of TF overexpression (Fig. 5 A). Here, overexpression of TF was evident from t he Coomassie s taining of whole cell samples used for the immunoblot analysis (Fig. 5A, lanes 2 and 4). In marked contrast, overproduction of TF decelerated the export of OmpA in a ccordance with published data [3] resulting in a substantial accumulation of pre-OmpA after 4 h of TF overproduction (Fig. 5A, lane 4). A pparently, TF overproduction has a differential effect on the export of proteins that follow disparate targeting/translocation path- ways. In conclusion, the d ata suggest that TF, althou gh interacting with Tat signal peptides, does not play a critical role in the export of Tat-dependent proteins. Discussion Molecular interactions of the signal peptide of two model Tat proteins, TorA and SufI, were investigated during in vitro biosynthesis in a n effort to identify ta rgetin g factors or escort proteins that p lay a role in t he Tat targeting process. Surprisingly, the chaperone and folding catalyst TF was t he only cytosolic factor that was extensively cross- linked to the Tat signal peptides. The association with TF persisted during synthesis of the entire protein at the ribosome. Deletion or overexpression of TF did not significantly influence the efficiency or kinetics of Tat- mediated translocation. TF has been suggested to play a regulatory role in controlling t he entry of secretory proteins in distinct targeting/translocation pathways [ 6,8]. Photo-crosslink ing experiments revealed contacts of the signal peptide of nascent OmpA (a SecB-dependent outer membrane protein) with fifty-four homologue (Ffh, the protein component of the E. coli SRP), SecA, S ecB and TF added to a semire- constituted in vitro tra nslation system [8]. Ffh- a nd SecA- crosslinking occurred when the signal peptide had just emerged from the ribosome (up to 89 amino acid nascent chain length) whereas T F was crosslinked to t he signal peptide o f slightly longer nascent chains. SecB was only crosslinked to the signal peptide upon release of nascent OmpA from the r ibosome. In comparison, the molecular landscape of Tat signal peptides in a similar experimental set-up is less complex ( this study). TF is the only photo- crosslinked cytosolic protein that is detected, probed from two postitions in the T orA signal peptide, close to the twin- arginine motif (position 13) and in the (moderately hydro- phobic) core region (position 24) (Fig. 1B,C). Similar results were obtained using a l ysine-specific chemical crosslinker (data not shown). Using SufI, photo-crosslinking to TF was demonstrated from the shortest nascent SufI w ith exposed Tat signal p eptide (57 amino acid nascent chain length; probe at position 8 ) ( Fig. 2B) up t o full-length, but ribosome associated SufI (Fig. 3). What is the role o f TF in Tat-mediated export? Does it prevent the cotranslational engagement of Tat-dependent proteins in other targeting/translocation pathways? We have no evidence for this conjecture. First, in t he absence of TF, we could not identi fy any other partners (e.g. Ffh, SecA) for n ascent Tat proteins using the in vitro crosslinking approach described above (data n ot shown). Possibly, the relatively mild hydrophobicity of the Tat signal peptide prohibits inte raction w ith F fh [5,34,35]. Furthermore, the ÔSec-avoidanceÕ motif in the C-terminal re gion of the Tat signal peptide [ 36] might p revent rerouting via the S ec pathway e ven when TF is absent. Second, deletion of tig does not affect th e export of SufI which proceeds in vivo with the slow kinetics that are characteristic for the Tat translocation process ( Fig. 4). In contrast, t he export o f SecB substrate s is markedly accele rated in the absence of TF probably by the disclosure of a more direct cotranslational targeting pathway to the Sec translocon [3]. Perhaps, the proofreading activity of the Sec t ranslocase [37] prevents the use of this alternative targeting p athway by Tat proteins. On the other hand, overproduction o f TF inhibits SecB- mediated transport [3] whereas Tat-mediated transport proceeds unaffected (Fig. 5). The latter observation is not unexpected because TF only associates with Tat substrates during s ynthesis prior to their folding in an export- competent conformation [22]. Does TF prevent a premature interaction of Tat substrates with the Tat translocase? It seems conceivable t hat interac- tion of nascent Tat proteins with the Tat translocase compromises the folding process that is a prerequisite for export. On the o ther hand, when IMVs were added during synthesis of n ascent Tat proteins, crosslinking to the T at translocase w as not observed i rrespective o f t he presence of TF (data not shown). Also, the lack of s ignificant effect in a Dtig mutant strain (Fig. 4) argues against such a seemingly important function for TF in T at export. In light of this n egative evidenc e we are i nclined to believe that TF interacts by default with nascent Tat proteins due to its location near the n ascent chain exit site (see below). At present it is unclear whether TF keeps the signal peptide close to the exit site [8] forcing a looped conformation of the nascent chain or whether TF moves from the ribosome with the Tat signal peptide for which it may have a relatively high affinity. As p roposed for other substrates, TF may prevent aggregation of nascent Tat substrates in polysomes, a function that can be t aken over by the DnaK/DnaJ-chaperone machinery. DnaK/DnaJ and TF possess an overlapping substrate specificity but DnaK/DnaJ does n ot dock a t ribosomes and plays a more prominent r ole in post-translational folding [31,32]. Strik- ingly, in the absence of DnaK/DnaJ a s mall s ubpopulation of pre-SufI accumulated, an effect that was augmented in the a bsence of TF (Fig . 4A). The relatively small effect, even in the Dtig DdnaKdnaJ triple mutant, may relate to the capacity o f Tat substrates to fold rapidly. Also, other chaperones such as SecB may protect nascent Tat polypeptides from unwelcome interactions [38]. Photo- crosslinking of the mature domain of Tat proteins will be required to settle this point. When emerging from the ribosome, the SufI signal peptide also crosslinked to L 23 and L29 that are located near the exit site of t he main ribosomal tunnel and constitute the TF attachment site [4,30] (Fig. 2). Similarly, SecB-dependent secretory p roteins such as OmpA [8], SRP- dependent inner membrane proteins, such as FtsQ [9] and cytosolic proteins, such as RpoB [38] were shown to crosslink L23/L29 early during b iogenesis. This suggests that, irrespective of their final l ocation, E. coli proteins follow the same pathway through the ribosome and leave the ribosome at a universal exit site near L23/L29. Ó FEBS 2004 Role of trigger factor in Tat-mediated export (Eur. J. Biochem. 271) 4785 The p resence of I MVs during synthesis of nascent TorA/ P2 gave rise to two extra crosslinking products (Fig. 1C). T he adducts ( 7and 17 kDa) appeared specific for the hydrophobic core of the TorA signal peptide (position 24) and were sensitive to carbonate extraction, indicating that they represent peripheral membrane proteins a nd are not related to any of the known Tat translocase s ubunits. This raises the i ntriguing possibility that (a subpopulation of) TorA associates with a distinct membrane bound mach inery early during translation. It has been suggested before that translocation through the Tat translocase is preceded by a Tat-independent targeting and insertion process that was speculated to function in the quality c ontrol of Tat substrates [39]. Translation, folding a nd membrane inse rtion may be coordinated at this location. In this context, it is of interest to note that the efficiency of translocation of Tat substrates is dramatically improve d whe n the membrane v esicles are present during translation instead of being added after translation [28], an observation that has been difficult to reconcile with a strictly post-translational t argeting and translocation m echanism. Work is in progress to elucidate the identity o f the  7and 17 kDa crosslinked partners. Acknowledgements We are g rateful to E .N.G. H ouben a nd M.L. Urbanus for their help during initial stages of the project and to T . Palmer and F. Sargent f or providing reagents a nd suggestions. We also thank C. Georgopoulos in whose lab part of the work was carriedout.N.Harms,G.J.Haanand M. Mu ¨ ller are acknowledged for their comments on the manuscript an d stimulating discussions. P .G. was suppo rted by Swiss National Science Foundation Grant F N-31–65403. References 1. von H eijne, G. (1990) The signal peptide. J. Membr. Biol. 115, 195–201. 2. Mori, H . & Ito, K. (2001) The Sec protein-translocation pathway. Trends Microbiol. 9, 494–500. 3. Lee, H.C. & Bernstein, H.D. (2002) Trigger factor retards protein export in Escherichia c oli. J. Biol. C hem. 277, 4 3527–43535. 4. Kramer,G.,Rauch,T.,Rist,W.,Vorderwu ¨ lbecke, S., Patzelt, H., Schulze-Speck ing, A., Ban, N., D euerling, E. & Bukau, B. ( 2002) L23 protein functions as a chaperone docking site on the ribo- some. Nature 41 9, 171–174. 5. Valent, Q.A., de Gier, J .W.L., von Heijne, G., K endall, D.A., ten Hagen-Jongman, C.M., Oudega, B. & Luirink, J. (1997) Nascent membrane and presecretory proteins synthesized in Escherichia c oli associate with signal recognition particle and trigger f actor. Mol. Microbiol. 25, 53–64. 6. Beck, K., Wu, L.F., Brunner, J. & Mu ¨ ller, M. (2000) Dis- crimination between SRP- and SecA/S ecB-depend ent substrates involves selective recognition of n ascent chains by SRP and t rigger factor. EMBO J. 19, 134–143. 7. Beha , D., Deitermann, S., Mu ¨ ller, M. & Koch, H.G. (2003) Export of beta-lactamase is independent of the signal recognition particle. J. Biol. Chem. 278, 22161–22167. 8. Eisner, G., Koch, H.G., Beck, K., Brunner, J. & Mu ¨ ller, M. (2003) Ligand crowding at a nasc ent signal sequence. J. Cell Bio l. 163, 35–44. 9. Ullers, R.S., H ouben, E .N., Rain e, A., te n Hagen- Jongman, C.M.,Ehrenberg,M.,Brunner,J.,Oudega,B.,Harms,N.& Luirink, J. (2003) Interplay of signal r ecognition particle and trigger factor at L23 near the nascent chain exit site on the Escherichia coli ri b os om e. J. Cell Biol. 161, 679–684. 10. Luirink, J. & S inning, I. (2004) SRP-mediated protein targeting: structure a nd function revisited. Biochim. Biophys. Acta. 1697, 17–35. 11. Berks, B.C., Palmer, T. & Sargent, F. (2003) The Tat protein translocation pathway and i ts role in microbial physiology. Adv. Microb. Physiol. 47, 1 87–254. 12. Berks, B.C. (1996) A common export pathway f or proteins binding c omplex red ox cofactors. Mol. Microbiol. 22, 393–404. 13. Oresnik, I.J., Ladner, C.L. & Turner, R.J. (2001) Identification of a twin-arginine leader-binding protein. Mol. Microbiol. 40, 323–331. 14. Papish, A.L., Ladne r, C.L. & Turner, R .J. (2003) T he twin- arginine leade r-binding protein, DmsD, interacts with the TatB and TatC subun its of the Escherichia coli twin-arginine translo- case. J. Biol. Chem. 278 , 32501–32506. 15. Ray,N.,Oates,J.,Turner,R.J.&Robinson,C.(2003)DmsDis required for the biogenesis of DMSO reductase in Esch erichia coli but not for the interaction of the DmsA signal peptide with the Tat apparatus. FEBS L ett. 534, 1 56–160. 16. Miller, J.H. (1992) A short course in bacterial genetics: A laboratory manual and handbook for Escherichia coli and related bacteria. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N Y. 17. Cristobal, S. , de G ier, J.W., Nielsen, H. & von Heijne, G. (1999) Competition between Sec- and TAT-depen dent protein translo- cation in Escherichia c oli. EMBO J. 18, 2982–2990. 18.Scotti,P.A.,Urbanus,M.L.,Brunner,J.,deGier,J.W.,von Heijne,G.,vanderDoes,C.,Driessen,A.J.,Oudega,B.& Luirink, J. (2000) YidC, the Escherichia coli homologue of mitochondrial Oxa1p, is a compo nent of the Sec tran slocase. EMBO J. 19 , 542–549. 19. Guzman, L.M., Belin, D., Carson, M.J. & Beckwith, J. (1995) Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J. Bacteriol. 177, 4121– 4130. 20. Scotti, P.A., Valent, Q.A., Mant ing, E.H., Urbanus, M.L., Dri- essen, A.J., O udega, B. & Lu irink, J. (19 99) SecA is not required for signal recognition particle-mediated targeting and initial membrane insertion o f a nascent inner membrane protein. J. Biol. Chem. 274, 29883–29888. 21. Urbanus, M.L., Scotti, P.A., Fro ¨ derberg, L., Sa ¨ a ¨ f, A., de Gier, J.W., Brunner, J ., Samuelson, J.C., Dalb ey, R.E ., O udeg a, B . & Luirink, J. (2001) Sec-dependen t membrane p ro tein insertion: sequential interaction of nascent FtsQ with SecY and YidC. EMBO Report 2, 524–529. 22. DeLisa, M.P., Tullman, D . & Georgiou, G . (2003) Folding q uality control in the export o f protein s by the bacte rial twin -arginine translocation pathway. Proc. N atl Acad. Sc i. USA 100, 6115 – 6120. 23. Santini, C.L., Ize, B., Chanal, A., Mu ¨ ller, M., Giordano, G. & Wu, L.F. (1998) A novel s ec-independent periplasmic p rotein translocation pathway in Escherichia c oli. EMBO J. 17 , 101–112. 24. Berks, B.C., Sargent, F. & Palmer, T. (2000) The Ta t protein export pathway. Mol. Microbiol. 35, 260–274. 25. De Leeuw, E., P orcelli, I., Sargent, F., Palmer, T. & Berks, B.C. (2001) Membrane interactions and self association of the TatA and TatB components of the t win-arginin e translocation pathway. FEBS Lett. 506 , 143–148. 26. Stanley, N.R., Palmer, T. & B erks, B.C. (2000) The t win arginine consensus motif o f Tat s ignal p eptides is involved i n Sec- independent protein targeting in Escherichia coli. J. Biol. Chem. 275, 1 1591–11596. 27. Yahr, T.L. & Wickner, W.T. (2001) Functional reco nstitutio n of bacterial Tat translocation in vitro. EMBO J. 20, 2472–2479. 4786 W. S. P. Jong et al.(Eur. J. Biochem. 271) Ó FEBS 2004 28. Alami, M., Trescher, D. , Wu, L.F. & Mu ¨ ller, M. (2 002) Separate analysis o f twin-arginine tran slocation (Tat)-specific memb rane binding a n d translocation in Escherichia coli. J. Biol. Chem. 277, 20499–20503. 29. Alami, M., Luke, I., Deite rmann, S., Eisner, G., Koch, H.G., Brunner, J. & Mu ¨ ller, M. (2003) Differential in teractions betw een a twin-arginine signal peptide and its tran slocase in Escherichia coli. Mol. Cell. 12 , 937–946. 30. Nissen, P., H ansen, J., Ban, N., Moore, P.B. & Steitz, T.A. (2000) The structural basis of ribosome activity in peptide bond synthesis. Science 289, 920–930. 31. Frydman, J. (2001) Folding of newly translated proteins in vivo: the role o f molecular chaperon es. Annu. Rev. Biochem. 70, 603–647. 32. Deuerling, E., Patzelt, H., Vorderwulbecke, S., Rauch, T., Kramer, G ., Schaffitzel, E., Mogk, A., Schulze-Specking, A., Langen, H. & Bukau, B. (2003) Trigger Factor and DnaK possess overlapping substrate pools and binding specificities. Mol. Microbiol. 47 , 1317–1328. 33. Genevaux, P., Keppel, F., Schwager, F., Lange ndijk-Genevaux, P.S., Hartl, F.U. & Georgopoulos, C. (2004) In vivo analysis of the overlapping f unctions of DnaK and trigger factor. EMBO Report 5, 195–200. 34. Lee, H.C. & B ernstein, H.D. (2001) The t argeting pathway of Escherichia coli presecretory and integral membrane proteins is specified by the hydrophobicity of the targeting signal. Proc. Natl Acad. Sc i. USA 98 , 3471–3476. 35. Adams, H., Scotti, P.A., De Cock, H., Luirink, J. & Tommassen, J. (2002) The presence of a helix breaker i n the hydrophob ic core of signal sequences o f se cretory pro teins prevents recognition by the signal-recognition particle in Escherichia coli. Eur. J. Biochem. 269, 5 564–5571. 36. Bogsch, E., Brink, S. & R obinson, C. (1997) Pathway specificity for a delta pH-dependent precursor thylakoid lumen protein is governed by a ÔSec-avoidanceÕ motif in t h e transfer peptide and a ÔSec-in compatib leÕ mature protein. EMBO J. 16, 3851–3859. 37. Osborne, R.S. & Silhavy, T.J. (1993) PrlA suppres sor mutations cluster in regions corresponding to three distinct topological domains. EMBO J. 12, 3391–3398. 38. Ullers, R.S., Luirink, J., Harms, N., Schwager, F., Georgopoulos, C. & Genevaux, P. (2004) SecB is a bona fide generalized cha- perone in Escherichia c oli. Proc. N atl Acad. Sci. USA 101, 7583– 7588. 39. Bru ¨ ser, T. & Sanders, C. (200 3) An alternative m odel of t he twin arginine tra nslocation system. Microbiol. Res. 158 , 7–17. 40. Casadaban, M.J. (1976) Transposition a nd fusion of the lac genes to selected promoters in Escherichia coli using bacteriop hage lambda and M u. J. Mol. B iol. 104, 5 41–555. 41. Sargent, F., Stanley, N.R., Berks, B.C. & Palmer, T. (1999) S ec- independent protein transloc at ion in Escherichia coli.Adistinct and pivotal role for the TatB protein. J. Biol . Chem. 274, 36073– 36082. Ó FEBS 2004 Role of trigger factor in Tat-mediated export (Eur. J. Biochem. 271) 4787 . Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat- mediated export Wouter. disparate targeting/translocation path- ways. In conclusion, the d ata suggest that TF, althou gh interacting with Tat signal peptides, does not play a critical role