Báo cáo khoa học: C Isotopologue editing of FMN bound to phototropin domains potx

15 237 0
  • Loading ...
    Loading ...
    Loading ...

Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống

Tài liệu liên quan

Thông tin tài liệu

Ngày đăng: 07/03/2014, 05:20

13C Isotopologue editing of FMN bound to phototropindomainsWolfgang Eisenreich1, Monika Joshi1, Boris Illarionov1, Gerald Richter2, Werner Ro¨misch-Margl1,Franz Mu¨ller3, Adelbert Bacher1and Markus Fischer41 Lehrstuhl fu¨r Organische Chemie und Biochemie, Technische Universita¨tMu¨nchen, Garching, Germany2 School of Chemistry, Cardiff University, UK3 Wylstrasse 13, Hergiswil, Switzerland4 Institut fu¨r Biochemie und Lebensmittelchemie, Abteilung Lebensmittelchemie, Universita¨t Hamburg, Germany13C-Labeled flavocoenzymes have played an importantrole for the spectroscopic analysis of flavoenzymes [1],but their use was limited by the costs and effort forthe preparation of the13C-labeled cofactors. More spe-cifically,13C can be introduced with relative ease intothe pyrimidine moiety of the isoalloxazine system [2],and the xylene moiety of flavin cofactors can belabeled by enzyme-assisted strategies [3], whereas ribi-tyl carbon atoms have been rarely included in labelingstudies due to technical hurdles. We have shown earlierthat mixtures of13C isotopologues of the riboflavinprecursor, 6,7-dimethyl-8-ribityllumazine, can be pre-pared by biotransformation of13C-labeled glucosein vivo [4]. In the present study, we report the transfor-mation of these isotopologue libraries into randomlibraries of13C isotopologues of FMN and their utili-zation for NMR studies of the plant blue light recep-tor, phototropin [5,6].Keywordsblue light receptor; isotopologue libraries;LOV domain; NMR spectroscopy;phototropinCorrespondenceW. Eisenreich, Lehrstuhl fu¨r OrganischeChemie und Biochemie, TechnischeUniversita¨tMu¨nchen, Lichtenbergstrasse 4,D-85747 Garching, GermanyFax: +49 89 289 13363Tel: +49 89 289 13336E-mail: wolfgang.eisenreich@ch.tum.deM. Fischer, Institut fu¨r Biochemie undLebensmittelchemie, AbteilungLebensmittelchemie, Universita¨t Hamburg,Grindelallee 117, 20146 Hamburg, GermanyFax: +49 40 4283 84342Tel: +49 40 4283 84357E-mail: markus.fischer@chemie.uni-hamburg.de(Received 6 June 2007, revised 12 August2007, accepted 19 September 2007)doi:10.1111/j.1742-4658.2007.06111.xThe plant blue light receptor phototropin comprises a protein kinasedomain and two FMN-binding LOV domains (LOV1 and LOV2). Bluelight irradiation of recombinant LOV domains is conducive to the additionof a cysteinyl thiolate group to carbon 4a of the FMN chromophore, andspontaneous cleavage of that photoadduct completes the photocycle ofthe receptor. The present study is based on13C NMR signal modulationobserved after reconstitution of LOV domains of different origins with ran-dom libraries of13C-labeled FMN isotopologues. Using this approach, all13C signals of FMN bound to LOV1 and LOV2 domains of Avena sativaand to the LOV2 domain of the fern, Adiantum capillus-veneris, could beunequivocally assigned under dark and under blue light irradiation condi-tions.13C Chemical shifts of FMN are shown to be differently modulatedby complexation with the LOV domains under study, indicating slightdifferences in the binding interactions of FMN and the apoproteins.AbbreviationsC(4a), carbon 4a; TARF, tetraacetylriboflavin.5876 FEBS Journal 274 (2007) 5876–5890 ª 2007 The Authors Journal compilation ª 2007 FEBSThe gene specifying phototropin, the first in theemerging family of blue light receptors in plants, wasinitially cloned from Arabidopsis thaliana and wasshown to specify a cytoplasmic protein comprisinga serine ⁄ threonine protein kinase domain and twoFMN-binding LOV domains (designated LOV1 andLOV2), which are members of the PAS domain super-family [6–8] (Fig. 1). Blue light irradiation of recombi-nant LOV domains results in substantial modulationof the visible absorption spectrum [9], which was inter-preted to result from the formation of an adductbetween the thiol group of a cystein residue and car-bon 4a [C(4a)] of the FMN chromophore by VincentMassey (a contribution to the discussion at the 13thInternational Congress on Flavins and Flavoproteins;29 August to 4 September 1999, Konstanz) (Fig. 2).This interpretation was confirmed by site-directedmutagenesis, NMR spectroscopy and X-ray crystallo-graphy [9–13]. The photocycle is best described as anaddition ⁄ elimination sequence.The structure of recombinant LOV2 domain of thefern Adiantum capillus-veneris has been determined byX-ray crystallography in the dark as well as the lightstate [12,13] (Fig. 3). The protein is characterized byfive antiparallel b-sheets and four a-helices that form acentral pocket harboring the FMN chromophore. Alight-induced change in the position of the side chainof cysteine 966 is well in line with the adduct forma-tion [12–14]. In addition to the cysteine 966 residue,11 amino acid residues were shown to contact theFMN chromophore via hydrogen bonds or van derWaals contacts. Notably, these residues are highly con-served in all LOV domains, indicating a canonicalFMN binding motif (Fig. 2).NMR studies with the LOV2 domain of Avena sati-va showed that the photoadduct formation involves aconformational change in the ribityl side chain of theflavin cofactor as indicated by31P and13C NMR data[10]. It was also shown that the adduct formation trig-gers the unfolding of the helical domain Ja, whichABFig. 1. Organization of phototropins used in the preent study. A, A. sativa NPH1-1 (accession no. O49003); B, A. capillus-veneris phy3(accession no Q9ZWQ6).Fig. 2. Amino acid sequence alignment of domains used in the present study. Amino acid residues derived from the vector are italicized.Asterisks indicate amino acid residues of protein from A. capillus-veneris in direct contact with the FMN chromophore [13]. Identical aminoacid residues are shown in black, and similar amino acid residues are in grey shadow typeface. The formation of a cysteinyl-flavin-C(4a) cova-lent adduct after irradiation of the LOV–FMN complex with blue light is shown and the cystein residue involved in adduct formation ismarked by an arrow.W. Eisenreich et al.13C NMR of phototropin domainsFEBS Journal 274 (2007) 5876–5890 ª 2007 The Authors Journal compilation ª 2007 FEBS 5877serves as a linker between the LOV2 domain and thekinase domain in the LOV2 domain of A. sativa [11].That unfolding is believed to modulate the activity ofthe kinase domain, which is conducive to its autophos-phorylation.The exact role of the LOV1 domain in regulatingphototropin activity is not fully understood, but theoverall architecture of LOV1 from Chlamydomonas wasfound to be almost identical with that of LOV2 [15].Recent studies indicate that LOV2 acts as the principallight sensing domain, which is coupled via the Ja helixwith the kinase activity [11], whereas LOV1 may play acrucial role in receptor dimerization [16,17].The present study was initiated in order to monitormore closely the light-induced chemical shift modula-tion of the FMN cofactors complexed to LOVdomains of different origins. For the unequivocalassignment of the13C NMR signals of all carbonatoms in the FMN chromophore, the apoproteins werereconstituted with random and ordered13C isotopo-logue libraries of FMN. The signal intensity modula-tion reflecting the different isotopologue compositionsin samples with random isotopologue libraries ofFMN served as the basis for isotope abundance editingof the13C NMR signals. The method can be adaptedfor NMR signal assignment in a variety of other pro-tein ⁄ ligand systems.ResultsWe have reported earlier on the preparation of isoto-pologue mixtures of 6,7-dimethyl-8-ribityllumazine (3;Fig. 4) by in vivo biotransformation of13C-labeled glu-cose using a recombinant Escherichia coli strain [4].These isotopologue mixtures were used in the presentstudy as a starting material for the preparation of iso-topologue mixtures of FMN by enzyme-assisted syn-thesis.The transformation of 3 into riboflavin catalyzed bythe enzyme riboflavin synthase proceeds as a dismuta-tion whereby two equivalents of 3 are transformed intoone equivalent each of riboflavin (5; Fig. 4) and5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione (4;Fig. 4). In order to avoid the inherent loss of isotope-labeled precursor, the second product 4 resulting fromthe dismutation can be reconverted into 3 by treatmentwith lumazine synthase using 3,4-dihydroxy-2-buta-none 4-phosphate as cosubstrate. The cosubstrate canbe prepared in appropriately13C-labeled form byenzymatic conversion of13C-labeled glucose. By thatapproach, the yield of riboflavin based on isotope-labeled 3 can be optimized (for details, see Experimen-tal procedures).The riboflavin arising by the in vitro biotransforma-tion can be converted into FMN by treatment withriboflavin kinase in situ; ATP required as kinase sub-strate can be conveniently recycled using phosphoenolpyruvate as phosphate donor. One-pot reaction mix-tures catalyzing the formation of FMN from randomlylabeled 3 and specifically13C-labeled glucose comprisenine enzyme catalysts and afford the product at a yieldof over 90% based on the13C-labeled 3 [3].Synthetic genes specifying the LOV1 (Fig. 5) andLOV2 domains of phototropin NPH1-1 from A. sativaand the LOV2 domain of phototropin phy3 from thefern A. capillus-veneris were constructed as describedABFig. 3. Adiantum phy3 LOV2 structures. (A) dark and (B) light state(protein databank ID code 1G28, respectively, 1JNU) [12,13]. Atomsin amino acid residues are colored by elements: carbon, white; oxy-gen, red; nitrogen, blue; sulfur, yellow.13C NMR of phototropin domains W. Eisenreich et al.5878 FEBS Journal 274 (2007) 5876–5890 ª 2007 The Authors Journal compilation ª 2007 FEBSin the Experimental procedures. All genes were opti-mized for hyperexpression in E. coli host strains. Gen-erally, the assembled DNA fragments were cloned intoan expression vector specifying fusion proteins com-prising hisactophilin from Dictyostelium discoideumand a thrombin cleavage site. All sequences have beendeposited in GenBank. The cognate fusion proteinswere expressed efficiently in recombinant E. coli strainsand could be bound to nickel-chelating Sepharose dueto the large number of histidine residues present in thehisactophilin domain. The column was washed withbuffer containing 8 m urea to release the protein-bound FMN, and the resulting apoprotein was recon-stituted on the column with isotope-labeled FMN. Theprotein was then eluted with imidazole. The solutionwas treated with thrombin and passed again through anickel-chelating column in order to remove the cleavedhisactophilin domain that was bound, whereas theLOV2 domains were not retained.Figure 6 shows13C NMR signals of the recombi-nant LOV2 domain from A. capillus-veneris (LOV2fern)reconstituted with [U-13C17]FMN and with two isoto-pologue mixtures of FMN obtained by biotransforma-tion of [2-13C1]- or [3-13C1]glucose, respectively. Theleft panel shows spectra that were acquired under darkconditions. In the spectrum of protein reconstitutedwith universally13C-labeled FMN (Fig. 6A), all signalswith the exception of C(2) appear as broadened multi-plets due to13C13C coupling of directly adjacentcarbon atoms. In the samples reconstituted with theisotopologue mixtures, the carbon signals of the boundFMN appear as singlets, and their apparent intensitiesvary over a wide range (Fig. 6B,C). This intensity vari-ation is due to the presence of the singly13C-labeledisotopologues at different abundances in the FMN iso-topologue mixtures. The relative intensities of the indi-vidual carbon signals observed in the protein samplereflect the relative abundances of the different FMNisotopologues (cf.13C enrichments of the FMN speci-mens from the different13C-labeled glucoses indicatedby filled circles in Fig. 6) and constitute the basis forunequivocal signal assignment.Fig. 4. Synthesis of isotopologue libraries of FMN from [2-13C1]glucose. 1, Ribulose 5-phosphate; 2, 3,4-dihydroxy-2-butanone 4-phosphate;3, 6,7-dimethyl-8-ribityllumazine; 4, 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimdinedione; 5, riboflavin.W. Eisenreich et al.13C NMR of phototropin domainsFEBS Journal 274 (2007) 5876–5890 ª 2007 The Authors Journal compilation ª 2007 FEBS 5879For example, the position 8a methyl group, but notthe position 7a methyl group, is significantly labeled inthe sample of 3 obtained by biotransformation of[2-13C1]glucose, and the signal detected at 23.2 p.p.m.in the spectrum with the isotopologue library from[2-13C1]glucose can be clearly assigned to C(8a)(Fig. 6B). The C(7a) atom is not13C-enriched fromeither [2-13C1]- or [3-13C1]glucose; therefore, no signalFig. 5. Construction of a synthetic gene forA. sativa LOV1 domain. Alignment of thewild-type DNA sequence (ASNPH1), and thesynthetic DNA sequence (ASLOV1-syn) with5¢ and 3¢ overhangs including the syntheticBglII and HindIII sites. Changed codons areshaded in black. New single restriction sitesare shaded in grey. Oligonucleotides usedas forward primers are drawn above, andreverse primers below, the aligned DNAsequences.Fig. 6.13C NMR signals of13C-labeled FMN complexed to LOV2 domain from A. capillus-veneris under dark conditions or under blue lightirradiation. A, [U-13C17]FMN; B, FMN obtained from [2-13C1]glucose; C, FMN obtained from [3-13C1]glucose. Asterisks indicate impurities.13C NMR of phototropin domains W. Eisenreich et al.5880 FEBS Journal 274 (2007) 5876–5890 ª 2007 The Authors Journal compilation ª 2007 FEBScan be detected in the13C NMR spectra of the corre-sponding protein samples. On the other hand, a secondmethyl signal (doublet with a coupling constant of43 Hz) is observed at 21.9 p.p.m. in the spectrum with[U-13C17]FMN as a cofactor. It is immediately obviousthat this signal has to be assigned to C(7a).Due to the specific13C enrichments in the ribitylmoiety of the FMN samples, the signals for C(1¢),C(2¢) and C(4¢) are observed in the isotopologue mix-ture from [2-13C1]glucose, whereas only the signals forC(2¢) and C(3¢) are detected in the spectrum of the iso-topologue mixture from [3-13C1]glucose with higherintensity of the C(2¢) signal. On this basis, all ribitylsignals can be unequivocally assigned (Table 1 andFig. 6).Using the same isotopologue editing approach,unequivocal signal assignments can be obtained for thecarbon atoms of the isoalloxazine ring. Thus, labelfrom [2-13C1]glucose is diverted to the ring carbonatoms 4a, 5a, 6 and 8 with13C enrichments of6 > 4a > 5a  8 (cf. filled circles in Fig. 6). The car-bon atoms 4, 5a, 7, 8, 9a and 10a acquire13C labelfrom [3-13C1]glucose with enrichments in the order of5a  8 > 10a > 4 > 9a  7. Indeed, in the signalregion for aromatic carbon atoms (115–165 p.p.m),four signals were observed in the protein samples withFMN from [2-13C1]glucose (Fig. 6B), and six signalswere detected with FMN from [3-13C1]glucose(Fig. 6C). The signal intensities were found to vary inthe same pattern as determined for the free FMN iso-topologue mixture, and thus provided the basis for theassignments. Additional validation is provided by thesimultaneous detection of the signals for C(8), andC(5a) in both samples because both molecular posi-tions acquire13C enrichment from [2-13C1]glucose, aswell as from [3-13C1]glucose. Due to low13C enrich-ments of C(9) in the used FMN libraries, no signalshould be detectable for that atom. However, a signalfor C(9) has to be present in the sample with[U-13C17]FMN and was indeed observed at118.9 p.p.m. (Fig. 6A). In summary, the observed sig-nal intensities in the spectra with universally13C-labeled FMN and two isotopologue libraries of FMN(i.e. obtained from biotransformation of [2-13C1]- and[3-13C1]glucose) allowed the assignments of all 17 car-bon atoms of FMN. The results are summarized inTable 2. The validity of the experimental approachwas confirmed by signal assignments using an orderedlibrary of13C-labeled FMN isotopologues. More spe-cifically, we measured the13C NMR chemical shiftsof seven selectively13C-labeled FMN isotopologuesTable 1.13C abundance of FMN obtained from [2-13C1]glucose andFMN obtained from [3-13C1]glucose bound to the LOV2 domainfrom A. capillus-veneris under dark and light conditions. The corre-sponding values with the isotopologue mixtures of free FMN aregiven for comparison. On the basis of the low signal-to-noise ratiosof the NMR spectra, the errors can be estimated as ± 30% of agiven13C abundance value.Carbonposition13C abundance (%)[2-13C1]glucose [3-13C1]glucoseFreeFMNLOV2-boundFMNFree FMNLOV2-boundFMNDark Light Dark Light43131c+b4a 49 +bNDa5a 16 26 NDa87 70 +b687++b++b71626+b816+b+b87 ++b++b8a 87 ++b++b9a 16 +b+b10a 43 ++b+b1¢ 72 90 +b2¢ 30 27 NDa62 81 ++b3¢ 25 28 +b4¢ 34 34c+baNot determined due to signal overlapping.bSignal observed at high(+) and very high intensity (+ +).cReference value.Table 2. NMR chemical shifts of TARF, free FMN and FMN boundto LOV2 domain from A. capillus-veneris in dark and light condi-tions.FMNatomNMR chemical shifts (p.p.m.)TARFFreeFMNLOV-2 bound FMNDark Light2 154.4 159.8 159.4 159.24 159.2 63.7 161.3 165.94a 135.1 136.2 134.2 65.75a 134.5 136.4 136.2 130.16 132.5 131.8 133.1 119.17 137.2 140.4 138.9 136.07a 19.5 19.9 21.9 21.88 148.7 151.7 150.2 130.18a 21.6 22.2 23.2 22.29 115.8 118.3 118.9 119.69a 131.4 133.5 134.4 127.710a 150.8 152.1 150.8 156.71¢ 45.0 48.8 44.8 46.82¢ 70.2 70.7 68.1 66.73¢ 70.0 74.0 75.1 75.54¢ 69.5 73.1 72.9 73.05¢ 62.1 66.4 65.8 66.7P 5.1 4.8 4.1W. Eisenreich et al.13C NMR of phototropin domainsFEBS Journal 274 (2007) 5876–5890 ª 2007 The Authors Journal compilation ª 2007 FEBS 5881bound to the LOV2 domain of A. capillus-veneris(Fig. 7). The chemical shifts observed with these sam-ples were in agreement with the signal assignmentsmade on the basis of the random isotopologue libraries(Fig. 6).The interpretation of the NMR chemical shifts ofprotein-bound flavins is usually based on the compari-son with the chemical shifts of free flavins [1]. There-fore, the published assignments for free FMN [10]were checked by the isotopologue abundance editingmethod using labeled FMN obtained from [1-13C1]-[2-13C1]- and [3-13C1]glucose. The previous assignments[10] of the isoalloxazine ring carbons could be com-pletely confirmed (Table 2 and Fig. 6). The previous,tentative assignments of C(3¢) and C(4¢) [10] had to beinterchanged. All13C NMR assignments of tetra-acetylriboflavin (TARF) were assigned by 2D13C inadequate experiments using [U-13C17]TARF. Inthis case, the previous assignment for C(2¢ ) and C(4¢)[18,19] had to be interchanged (Table 2).The isotopologue editing method was then used toassign the13C NMR signals of FMN bound to theLOV domains under study under blue light irradiationconditions. In order to keep photodamage of the pro-tein as low as possible, the acquisition times weresomewhat reduced under blue light as compared todark conditions. As a consequence, the signal-to-noiseratios of the NMR spectra of the irradiated sampleswere lower than those of the corresponding spectra inthe dark (Fig. 6, right column). The signal assignmentsobtained from the random isotopologue librariesmatched those from the selectively labeled FMN sam-ples (Fig. 7 and supplementary Fig. S1). The resultsare presented in Table 2 and confirm previous assign-ments for LOV2 from A. sativa (LOV2oat) [10], exceptthat the chemical shifts due to C(7) and C(8), C(6) andC(9), as well as those due to C(3¢) and C(4¢), have tobe interchanged.In analogy to the above procedure, the chemicalshifts of the LOV1 domain from A. sativa (LOV1oat)were also investigated. The results are given in supple-mentary Tables S1 and S2 and supplementary Figs S4and S5. In summary, the FMN signals of (LOV2oat)and (LOV1oat) were detected at similar chemical shifts(± 0.2 p.p.m), with the exception of the signals forC(5¢) and C(7a), which were upfield shifted by0.5 p.p.m and 0.7 p.p.m., respectively, and the signalsfor C(2) and C(4), which were downfield shifted by1.6 p.p.m and 0.7 p.p.m., respectively, in the LOV1domain. A correlation diagram of the chemical shiftsfor all proteins investigated in this study is shown inFig. 8.Fig. 7.13C NMR signals of of13C-labeledFMN with LOV2 domain from A. capillus-veneris under dark conditions. A,[U-13C17]FMN; B, [xylene-13C8]FMN; C,[7a,9-13C2]FMN; D, [6,8a-13C2]FMN; E,[4,10a-13C2]FMN; F, [7,9a-13C2]FMN; G,[5a,8-13C2]FMN; H, [4a-13C1]FMN. Asterisksindicate impurities.13C NMR of phototropin domains W. Eisenreich et al.5882 FEBS Journal 274 (2007) 5876–5890 ª 2007 The Authors Journal compilation ª 2007 FEBSDiscussionThe approach described in the present study opens anew way to unambiguously assign all carbon atoms inthe13C NMR spectra of protein-bound flavin cofac-tors using no more than three FMN samples (i.e. auniformly labeled and two partially labeled flavinsamples that can be biosynthetically obtained by in vivobiotransformation of [2-13C1]- and [3-13C1]glucose).Since, in the latter two cases, the degree of13C enrich-ment of a given carbon atom in the flavin samples dif-fers, the13C NMR signal strength (amplitude) of agiven carbon atom provides an additional constraint inthe signal assignment procedure. By contrast to previ-ous NMR work on flavoproteins [18], where variousiosotopologues, selectively enriched in the xylenemoiety of flavin, also were used [20], the isotopologuesobtained by the new biosynthetic approach allowassignment of the carbon atoms of the ribityl sidechain in the NMR spectra of flavin. The13C chemicalshifts of these atoms can provide important informa-tion about the binding interaction between the hydro-xyl groups of the side chain of flavin and theapoprotein, and could also report possible conforma-tional changes of the side chain (e.g. due to reductionof a flavoprotein).In supplementary Table S2, the13C chemical shiftsof LOV1 domain of A. sativa in the two states arelisted. In the dark state, the chemical shifts of the iso-alloxazine moiety of flavin are very similar to thoseobserved with LOV2 of the same species and of dif-ferent organisms (Fig. 8). Most of the differences(± 0.3 p.p.m) between the two sets are within theaccuracy limits of chemical shift determination, exceptfor C(8) of LOV2fern, which is upfield shifted by0.6 p.p.m., and C(8a) of LOV2fern, which is downfieldshifted by 0.7 p.p.m., respectively, compared toLOV1oatand LOV2oat. The chemical shifts of the sidechain carbon atoms 1¢ and 3¢ of LOV2fernshow signifi-cant differences, which may be ascribed to variation inthe strength of the hydrogen bond of the correspond-ing hydroxyl groups with the proteins and ⁄ or to con-formational changes in the side chain (Fig. 8). Asimilar effect is shown by the proteins in the blue lightirradiated state. The greatest difference in chemicalshifts is observed for C(2) of LOV1oat, which is down-field shifted by 1.6 p.p.m. compared to the LOV2molecules. Similarly, the C(4) and C(7a) of LOV1oatare downfield shifted by 0.7 p.p.m and upfield shiftedby 0.5 p.p.m., respectively, compared to LOV2oatandLOV2fern. A significant difference is also observed forC(9) and C(1¢) of LOV2fern,which are upfield shiftedby 0.9 and 0.6 p.p.m., respectively, and C(2¢), which isdownfield shifted by 0.7 p.p.m., compared to LOV1oatand LOV2oat.Based on extensive13C and15N NMR studies onfree flavins in aprotic and protic media [21], whichhave shown that a direct correlation exists between thep-electron density and the13C chemical shift of aparticular atom of the flavin molecule, the observedFig. 8.13C Chemical shifts of13C-labeled FMN in complex withLOV domains: black lines, dark conditions; blue lines, irradiatedwith blue light.W. Eisenreich et al.13C NMR of phototropin domainsFEBS Journal 274 (2007) 5876–5890 ª 2007 The Authors Journal compilation ª 2007 FEBS 5883chemical shifts can be interpreted in terms of the elec-tronic structure of the protein-bound flavin and itsperturbation by binding interaction and chemical reac-tions. Thus, the dark state interaction between FMNand the LOV domains under study is characterized bystrong hydrogen bonding with the C(2)O group offlavin. The strength of the hydrogen bond correspondsapproximately to that of free FMN in water, indi-cating polarization of the flavin along the axisC(8)-C(6)-C(9a)-N(5)-C(10a)-C(2). This is manifestedby the observed downfield shifts of the correspondingC atoms (Table 2 and supplementary Table S2).Although there exists a hydrogen bond between theprotein and the flavin at C(4)O group, its strength isconsiderably weaker than that observed in free FMNin water. These observations are in good agreementwith recent X-ray data showing a distance of 0.31 nmbetween the Ndgroup of N998 and the oxygen atomof the C(2)O group (Table 3). To the C(4)O group,two hydrogen bonds (Negroup of Q1029, Ndgroup ofN1008) have been suggested by X-ray data, yet thedistance between the bond-forming atoms is largerthan that observed at C(2)O, supporting our inter-pretation. A strong hydrogen bond to C(4)O wouldhave influenced the chemical shift of the C(4a) atomby a downfield shift compared to that of FMN [10].The even slightly upfield shifted resonance of theC(4a) atom in comparison to TARF indicates extrap-electron density allocation to this position, releasedfrom the N(10) atom, which is downfield shiftedcompared to TARF, as shown previously [10]. Theresonance position of C(4a) is thus in full agreementwith the weak hydrogen bond observed at C(4)O. Thepartial positive charge created on N(10) [21] by therelease of electron density onto C(4a) is distributedmainly onto the C(5a) and the C(9) atom, and, to alesser extent, onto the C(7) atom, in agreement withthe fact that the latter atom experiences a smallerdownfield shift than the other two atoms. The datademonstrate that, with regard to the isoalloxazinemoiety of flavin, there are only minor electronic differ-ences of the prosthetic group of the different proteinsinvestigated in the present study. Taking also intoaccount the previously published15N NMR data onLOV2 [10], it can be concluded that the chemical shiftof the N(5) atom of flavin indicates no hydrogen bondformation with this atom and a rather hydrophobicenvironment at this site. This interpretation of theNMR data is fully supported by the X-ray data [22].On the other hand, the chemical shift of the N(1) atomindicates the presence of a strong hydrogen bond atthis site, although the X-ray data suggest the absenceof a hydrogen bond. The opposite holds for the N(3)atom: the X-ray data propose a hydrogen bond withthe protein whereas the15N NMR data suggest theabsence of such a bond.The chemical shifts of the C(3¢) and C(4¢) atomsof the side chain of protein-bound flavin resembleTable 3. Distances between FMN atoms (Ligand) and amino acid residues of LOV2 from Adiantum phy3 (chimeric fern photopreceptor)[12,13]. For comparison,13C chemical shifts of bound FMN atoms are given.Atom Dark state Light stateLigand ProteinDistance(A˚)13C NMR chemicalshifts (p.p.m.)Distance(A˚)13C NMR chemicalshifts (p.p.m.)C(4a) Sc[C(966)] 4.2 134.2 1.8 65.7Oe[Q(1029)] 4.7 4.0O(4) Ne[Q(1029)] 3.5 161.3 [C(4)] 3.1 165.9 [C(4)]Nd[N(1008)] 3.4 3.4N(3) Od[N(998)] 2.8 3.0O(2) Nd[N(998)] 3.1 159.4 [C(2)] 3.3 159.2 [C(2)]N(5) Ce[F(1010)] 3.2 136.2 [C(5a)] 3.8 130.1 [C(5a)]Od[N(965)] 2.7 2.9O(2¢)Nd[N(965)] 3.9 68.1 [C(2¢)] 3.9 66.7 [C(2¢)]O(H2O-2) 3.4 3.4O(H2O-1) 3.6 3.6O(3¢)O(H2O-1) 3.1 75.1 [C(3¢)] 3.1 75.5 [C(3¢)]O(4¢)Oe(Q970) 3.3 72.9 [C(4¢)] 3.7 73.0 [C(4¢)]Ne(Q970) 3.2 3.0O(1) (on P) Ne[R(967)] 2.6 2.5O(2) (on P) Ng[R(967)] 2.6 4.8 (P) 2.7 4.1 (P)O(3) (on P) Ng[R(983)] 2.8 3.0O(3) (on P) Ne[R(983)] 2.6 2.713C NMR of phototropin domains W. Eisenreich et al.5884 FEBS Journal 274 (2007) 5876–5890 ª 2007 The Authors Journal compilation ª 2007 FEBSthose of FMN in water, indicating stronger hydrogenbonding interactions with the hydroxyl group at C(3¢)and a somewhat weaker one with that at C(4¢)compared to those observed in FMN. This hydrogenbonding pattern agrees with that observed by X-raycrystallography [22]. The resonance position due toC(1¢) reflects the increased sp2hybridization of N(10)[21]. Both C(2¢) and C(5¢) are upfield shifted by morethan 1 p.p.m. compared to those of FMN. Whereasthe X-ray data indicate no hydrogen bond between theC(5¢)O group and the protein, but a strong one atC(2¢)O, the NMR data do not indicate hydrogenbonding at these atoms. It is suggested that the appar-ent absence of a hydrogen bond at C(2¢)O, as revealedby13C NMR, may be masked by a counteractingfactor, most probably a conformational change.Upon blue light irradiation of the proteins, ratherdrastic changes are observed in the NMR spectra [10].The most obvious one is the large upfield shift()68.5 p.p.m) of the C(4a) resonance. This proves theconversion of the C(4a) atom from sp2to sp3hybrid-ization, in line with the formation of a covalent bondbetween this atom of flavin, and the sulfur atom ofC966 in LOV2 of A. capillus-veneris (Fig. 2). The reso-nance line of N(5) also undergoes a large upfield shift()283 p.p.m) [10], indicating the change from an aro-matic to an aliphatic nitrogen atom. The other carbonatoms of flavin most affected by conversion of the pro-tein by light are: C(8) ()19.9 p.p.m), C(6) ()14.0 pm),C(9a) ()6.7 p.p.m) and C(10a) (+ 5.9 p.p.m). All theseatoms are involved in the possible mesomeric struc-tures of oxidized flavin [21] that are disturbed by theC(4a) substitution. The upfield shifts of the resonancesof these atoms, with the exception of C(10a), whichshows a downfield shifted signal, demonstrates theallocation of the incoming electron density at thesepositions. The downfield shift of the resonance linedue to C(10a) is caused by the higher electron densitywithdrawal from this atom by the further polarizationof the C(2)O group compared to that of the moleculeunder dark conditions. Since the sp2hybridization ofthe N(10) atom increases considerably upon formationof the C(4a) adduct [10], the upfield shifts of the reso-nances of C(5a) ()6.1 p.p.m) and C(7) ()2.9 p.p.m)atoms can be ascribed to electron density release ontothese atoms from N(10). Overall, with regard to thechemical shifts of the carbon atoms of the isoalloxa-zine ring, the electronic structure of the different pro-teins investigated in the present study is very similar, ifnot almost identical. Only the chemical shifts of theC(2), C(4) and C(4a) atoms of the adduct of LOV1and LOV2 proteins differ considerably from eachother. The chemical shifts of the former protein aredownfield from those due to LOV2, indicating strongerhydrogen bonding in LOV1 than in LOV2 at thesepositions. The hydrogen bond pattern as observed byNMR of the oxidized proteins is also observed in theadduct forms. The hydrogen bond at N(3), as observedby X-ray, is now also evident in the NMR data.Whereas the chemical shifts of the C(4a) signals inLOV2oatand LOV1oatare very similar, the corre-sponding signal in LOV2fernis upfield shifted withrespect to the former. This observation suggests somestructural difference(s) at the C(4a) position betweenthe proteins from oat and that from fern.The hydrogen bonding pattern observed for theC(3¢) and the C(4¢) atoms of the ribityl side chain inthe oxidized proteins is also observed in the corre-sponding adducts, but the strength of hydrogen bond-ing with the C(3¢)O group is considerably increased,especially that in LOV2fern. With regard to C(5¢) atom,the LOV2 proteins exhibit similar chemical shifts forthis atom, whereas that of LOV1 is upfield shifted by0.5 p.p.m. The chemical shift for the C(2¢) atomincreases in the order: LOV2oat, LOV1oatand LOV2-fern, possibly reflecting variations in the strength ofhydrogen bonding interactions at this position.The13C NMR data show that there exist some subtledifferences between the proteins investigated in the pres-ent study, as far as the isoalloxazine moiety of the flavinin the resting and photo-adduct state is concerned. Thelargest difference among the three proteins is observedfor the resonance line of the C(2)O group (downfieldshift) of LOV1 in the photo-adduct state. However,there are some resonances of ribityl side chain carbonatoms, which differ to a greater extent among the threeproteins (Fig. 8), indicating variations in the interactionwith the proteins and ⁄ or conformational differences.The LOV1 and LOV2 domains from A. sativa havealso been investigated by optical (light absorption, fluo-rescence, CD) and chemical techniques (kinetics) [9,23].The light absorption and13C NMR data indicate ahydrophobic environment at the isoalloxazine moiety ofthe protein-bound flavin, whereas the fluorescence quan-tum yield of flavin bound to the two proteins reflectprobably the sequence difference between the two pro-teins in the neighborhood of the flavin (residue 1010 isphenylalanine in LOV2 of A. capillus-veneris and thepositionally equivalent residue in LOV1 of A. sativa isleucine 117). From these data, it can be concluded thatthe microenvironment of flavin in LOV2 is more hydro-phobic than that in LOV1. This property of the proteinsappears to be correlated with the kinetic data, where ithas been determined that LOV2 is more reactive to formthe photo-adduct than LOV1 and its photo-adductis more stable than that of LOV1 [9]. Moreover, theW. Eisenreich et al.13C NMR of phototropin domainsFEBS Journal 274 (2007) 5876–5890 ª 2007 The Authors Journal compilation ª 2007 FEBS 5885[...]... CATCAATATTTTCTGCAGTTTTCTTAATCAGCATGACACCCTCACGCTCGGCCGCATCACGGACATG ATAATAGGATCCGAATTTCTTGCTACTACACTTGAACGTATTGAGAAGAACTTTGTCATTACTGACCCACGTTTGCCAG CCTCTGGACGCAGATTAGCATCTGGAAGTTCTTTTGCCGCCTCATCAATATTTTCTGCAGTTTTCTTAATC TATTATTATAAGCTTAGTTAGCCCACAAATCCTCTGGACGCAGATTAGCATCTGG GAGGAAGTCCTAGGTAACAACTGCCGTTTCCTGCAGGGCCGCGGTACTGATCGTAAAGCAGTGCAG GACATCGCGCTGCTCCTTGACTGCATCACGGATCAGCTGCACTGCTTTACGATCAGTACCGCGGCC CATCTTCGCGAGTGACCGGTTTCTGGAGCTCACGGAGTATACACGTGAGGAAGTCCTAGGTAACAACTGC... AGGCTGCAAGTGAAAGAGGTTCCAGAACTTTTTACCACTCTTTGTATAATTAATCAGCTGTACAGTGAC AACTGCCGTTTTCTTCAAGGTCCTGAAACCGATCGCGCGACAGTGCGCAAAATTCGTGATGCCATCGATAAC GGACACCAATAAAGTACTGGACATCACCCTTCTGATCACGCATAGGCTGCAAGTGAAAGAGGTTCCAG AGTTTCTTGCAGTTGACAGAATATTCGCGAGAAGAAATTCTGGGTCGTAACTGCCGTTTTCTTCAAGGTCC CACGCTCGGCCGCATCACGGACATGTTCGGTACCATCCAACTGGACACCAATAAAGTACTGGACATC GTCATTACTGACCCACGTTTGCCAGATAATCCCATTATCTTCGCGTCCGATAGTTTCTTGCAGTTGACAGAATATTC CATCAATATTTTCTGCAGTTTTCTTAATCAGCATGACACCCTCACGCTCGGCCGCATCACGGACATG... CATCTTCGCGAGTGACCGGTTTCTGGAGCTCACGGAGTATACACGTGAGGAAGTCCTAGGTAACAACTGC CCAAAAGGCGCGCCCACCTTTTGTATAGTTTAAAACCTGTACAGTGACATCGCGCTGCTCCTTGACTGC AAGTCTTTCGTGATCACAGATCCTCGTTTACCAGACAACCCTATCATCTTCGCGAGTGACCGGTTTCTG GGACGTCGCCATTTTCATCACGCATGACTTGAAGATGGAAGAGATTCCAAAAGGCGCGCCCACCTTTTG ATAATAGGATCCGGTCTGGTACCACGCGGTGAGCGTATCGGTAAGTCTTTCGTGATCACAGATCCTC TATTATTATAAGCTTACATCTCCTGCTGAACTCCGATGAAATATTGGACGTCGCCATTTTCATCACGCATG (2.6... CCAGGTCACCCAATCATGTACGCAAGCGCTGGTTTCTTCAACATGACCGGTTACACATCCAAG ACTTACTTCCACTTGCATGCCGATGAACTTGAGGACACGACCTTCTTCATCCTTGATTGGTGCAATGG GCACTGTCCGCATTCCAACAGACCTTCGTAGTTTCGGACGCCAGCCGTCCAGGTCACCCAATCATGTACGCAAG ATTATTATAAGCTTATTCAGTGTATTTACTTACTTCCACTTGCATGCCGATGAA ATAATAATAAGATCTGCACTGTCCGCATTCCAACAGACCTTC GCGCAAAATTCGTGATGCCATCGATAACCAAACAGAGGTCACTGTACAGCTGATTAATTATACAAAG AGGCTGCAAGTGAAAGAGGTTCCAGAACTTTTTACCACTCTTTGTATAATTAATCAGCTGTACAGTGAC... ASLOV2-12 ACVLOV2-1 ACVLOV2-2 ACVLOV2-3 ACVLOV2-4 ACVLOV2-5 ACVLOV2-6 ACVLOV2-7 ACVLOV2-8 TTCCTCCAAGGTTCCGGCACGGATCCAGCTGAGATTGCCAAGATCCGTCAGGCTCTGGCAAATGGTTCGAAC GCGGTACCGTCTTTCTTGTAGTTGAGGACACGGCCGCAGTAGTTCGAACCATTTGCCAGAGCCTGACGGATC CAACATGACCGGTTACACATCCAAGGAAGTGGTAGGTCGTAACTGTCGTTTCCTCCAAGGTTCCGGCACGGATC CTTCATCCTTGATTGGTGCAATGGTCAGGAGATTCCAGAATGCGGTACCGTCTTTCTTGTAGTTG CCAGGTCACCCAATCATGTACGCAAGCGCTGGTTTCTTCAACATGACCGGTTACACATCCAAG... hisactophilin of D discoideum and a thrombin cleavage site with 3¢-BamHI and HindIII cloning sites pNCO-HISACT- (C4 9S)-BH vector with the LOV1 domain (amino acids 130–244) of phototropin NPH1-1 of A sativa pNCO-HISACT- (C4 9S)-BH vector with the LOV2 domain (amino acids 404–559) of phototropin NPH1-1 of A sativa pNCO-HISACT-BH vector with the LOV2 domain (amino acids 925–1032) of phototropin PHY3 of A capillus-veneris... pNCO-HISACT-ACVLOV2-syn pRFN4 Accession numbers Relevant characteristics recA1, endA1, gyrA96, thi-1, hsdR17, supE44, relA1, lac[F¢, proAB, lacIqZDM15, Tn10(tetr)] lac, ara, gal, mtl, recA+, uvr+, StrR (pREP4: KanR, lacI) pNCO113 vector with the gene coding for hisactophilin of D discoideum with 3¢-BamHI and HindIII cloning sites pNCO113 vector with a gene coding for a cystein-free mutant of hisactophilin... plant photoreceptor domain reveals a light-driven molecular switch Plant Cell 14, 1067–1075 Crosson S & Moffat K (2001) Structure of a flavinbinding plant photoreceptor domain: insights into lightmediated signal transduction Proc Natl Acad Sci USA 98, 2995–3000 Schleicher E, Kowalczyk RM, Kay CW, Hegemann P, Bacher A, Fischer M, Bittl R, Richter G & Weber S (2004) On the reaction mechanism of adduct formation... 13 C NMR spectra of LOV proteins in complex with FMN obtained by biotransformation of selectively 1 3C- labeled glucose and universally 1 3C- labeled glucose, respectively, were measured under the same experimental conditions The ratios of the signal integrals were then calculated for each respective carbon atom Relative 1 3C abundances were normalized to the known abundance for particular carbon atoms of. .. beta-galactosidase selection Biotechniques 5, 376–378 31 Zamenhof PJ & Villarejo M (1972) Construction and properties of Escherichia coli strains exhibiting a-complementation of b-galactosidase fragments in vivo J Bacteriol 110, 171–178 32 Kay CW, Schleicher E, Kuppig A, Hofner H, Rudiger ¨ W, Schleicher M, Fischer M, Bacher A, Weber S & Richter G (2003) Blue light perception in plants 5890 Detection and characterization . ACTTACTTCCACTTGCATGCCGATGAACTTGAGGACACGACCTTCTTCATCCTTGATTGGTGCAATGGASLOV1-7 GCACTGTCCGCATTCCAACAGACCTTCGTAGTTTCGGACGCCAGCCGTCCAGGTCACCCAATCATGTACGCAAGASLOV1-8. AGTTTCTTGCAGTTGACAGAATATTCGCGAGAAGAAATTCTGGGTCGTAACTGCCGTTTTCTTCAAGGTCCASLOV2-6 CACGCTCGGCCGCATCACGGACATGTTCGGTACCATCCAACTGGACACCAATAAAGTACTGGACATCASLOV2-7 GTCATTACTGACCCACGTTTGCCAGATAATCCCATTATCTTCGCGTCCGATAGTTTCTTGCAGTTGACAGAATATTCASLOV2-8
- Xem thêm -

Xem thêm: Báo cáo khoa học: C Isotopologue editing of FMN bound to phototropin domains potx, Báo cáo khoa học: C Isotopologue editing of FMN bound to phototropin domains potx, Báo cáo khoa học: C Isotopologue editing of FMN bound to phototropin domains potx