Báo cáo khoa học: Fluorescence studies of the replication initiator protein RepA in complex with operator and iteron sequences and free in solution pdf

15 405 0
  • Loading ...
    Loading ...
    Loading ...

Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống

Tài liệu liên quan

Thông tin tài liệu

Ngày đăng: 07/03/2014, 04:20

Fluorescence studies of the replication initiator proteinRepA in complex with operator and iteron sequencesand free in solutionRutger E. M. Diederix1,2, Cristina Da´vila1,2, Rafael Giraldo2and M. Pilar Lillo11 Departamento de Biofı´sica, Instituto de Quı´mica Fı´sica ‘Rocasolano’, CSIC, Madrid, Spain2 Departamento de Microbiologı´a Molecular, Centro de Investigaciones Biolo´gicas, CSIC, Madrid, SpainRepA is the DNA replication initiator protein of thePseudomonas plasmid pPS10. It is representative of afamily of plasmid replication initiators active in manyGram-negative bacteria, including the initiators fromplasmids such as pSC101, F and R6K [1]. The opera-tor region preceding the repA gene contains a partiallypalindromic sequence (inverted repeat, IR) to whichRepA can bind, which acts as an autogenous repressorof transcription [2]. The plasmid also carries an originof replication, containing a sequence with four conti-guous tandem repeats (direct repeats, DR; termediterons) of the same 6 bp sequence found inverted inthe operator region of RepA. RepA thus has dualDNA-binding activity: it can bind as a dimer to itsoperator region, in which case it functions in trans-cription repression; and it can bind in a highly cooper-ative fashion to the four directly repeated iterons, inwhich case it functions in replication initiation [3].Keywordsanisotropy; DNA replication; fluorescence;hydrodynamics; RepACorrespondenceM. P. Lillo, Departamento de Biofı´sica,Instituto de Quı´mica Fı´sica ‘Rocasolano’,CSIC, Serrano 119, 28006 Madrid, SpainFax: +34 91 564 2431Tel: +34 91 561 9400, ext. 1027E-mail: pilar.lillo@iqfr.csic.es(Received 26 June 2008, revised 8 August2008, acccepted 5 September 2008)doi:10.1111/j.1742-4658.2008.06669.xRepA, the replication initiator protein from the Pseudomonas plasmidpPS10, regulates plasmid replication and copy number. It is capable ofautorepression, in which case it binds as a dimer to the inverted repeat oper-ator sequence preceding its own gene. RepA initiates plasmid replication bybinding as a monomer to a series of four adjacent iterons, which contain thesame half-repeat as found in the operator sequence. RepA contains twodomains, one of which binds specifically to the half-repeat. The other is thedimerization domain, which is involved in protein–protein interactions inthe dimeric RepA–operon complex, but which actually binds DNA in themonomeric RepA–iteron complex. Here, detailed fluorescence studies onRepA and an N-(iodoacetyl)aminoethyl-8-naphthylamine-1-sulfonic acid-labeled single-cysteine mutant of RepA (Cys160) are described. Using time-resolved fluorescence depolarization measurements, the global rotationalcorrelation times of RepA free in solution and bound to the operator and totwo distinct iteron dsDNA oligonucleotides were determined. These provideindications that, in addition to the monomeric RepA–iteron complex, astable dimeric RepA–iteron complex can also exist. Further, Fo¨rster reso-nance energy transfer between Trp94, located in the dimerization domain,and N-(iodoacetyl)aminoethyl-8-naphthylamine-1-sulfonic acid-Cys160,located on the DNA-binding domain, is observed and used to estimate thedistance between the two fluorophores. This distance may serve as an indica-tor of the orientation between both domains in the unbound protein andRepA bound to the various cognate DNA sequences. No major change indistance is observed and this is taken as evidence for little to no re-orienta-tion of both domains upon complex formation.Abbreviations(I)AEDANS, N-(iodoacetyl)aminoethyl-8-naphthylamine-1-sulfonic acid; FRET, Fo¨rster resonance energy transfer.FEBS Journal 275 (2008) 5393–5407 ª 2008 The Authors Journal compilation ª 2008 FEBS 5393Interestingly, in the latter case, the protein binds asa monomer [2–6].Free in solution, the protein is essentially dimeric,but it dissociates and binds as a monomer in the pres-ence of even a single iteron sequence [2,3]. The mecha-nism by which this occurs is unclear, but it involvesconsiderable conformational changes in RepA [3,4]judged by comparison of crystal structures of (trun-cated) RepA dimer [5] and the monomeric RepA–iteron complex that was modeled on the complexstructure of the close homolog RepE from the F plas-mid [2,7–9]. For the latter protein, the crystal struc-tures of both the monomer–iteron and dimer–operatorcomplexes are available, indicating secondary struc-tural changes in the linker connecting the dimerizationand DNA-binding domains, and rearrangement of therelative orientation of the two domains [7,9]. The con-formational change upon iteron binding may expose arecognition site for protein–protein interaction,enabling coupling of recently replicated origins fromdifferent plasmid molecules [10,11]. This so-calledhandcuffing is thought to be the mechanism for repli-cation inhibition in iteron-containing plasmids [12].Following our series of biophysical studies of RepA[3–6], we report hydrodynamic and structural studieson RepA and its complexes with operator andsingle iteron sequences. Global rotational correlationtimes were determined by fluorescence anisotropydecay experiments using the extrinsic fluorophoreN-(iodoacetyl)aminoe thyl-8-naphthylamine-1-sul fonicacid (AEDANS), specifically coupled to Cys160 in thesingle-cysteine mutant C160–RepA. The AEDANSprobe was also used as a Fo¨rster resonance energytransfer (FRET) acceptor to monitor putative interdo-main movements in RepA upon binding the variousDNA sequences. We show that, despite the extensivestructural rearrangement that is known to occur uponmonomerization and DNA binding to the iteronsequence [3–6], an appreciable change in the inter-domain organization is not actually observed. Finally,it appears that monomerization does not occur effi-ciently in very short oligonucleotides that contain fewbases more than the iteron sequence, and RepA bindsas a dimer instead.ResultsLabeling and characterization of C160–RepAC160–RepA is a double-mutant of His6-tagged wild-type RepA [4] in which two wild-type Cys residues(C29 and C106) have been changed to Ser. The singleremaining Cys160 is located on the C-terminal DNA-binding domain of RepA, also called the WH2domain, which specifically recognizes the operator anditeron sequences [1,2]. Most C160–RepA is expressedin inclusion bodies, and the His6-tagged protein waspurified from solubilized inclusion bodies using Ni(II)-affinity chromatography under denaturing conditions.As shown previously [3,4], the His6-tag does not inter-fere with protein function or structure, and it was notremoved after purification. Refolding of C160–RepA isby rapid 20-fold dilution in buffer (0.15 m (NH4)2SO4,15 mm Na-acetate, 0.03 mm EDTA, 3% glycerol,pH 6.0). Almost all the protein is recovered and ispresent as a single, soluble species. Refolded C160–RepA is dimeric, as judged by size-exclusion chromato-graphy, where it elutes at exactly the same volume aswild-type RepA (not shown).Labeling of the single Cys of native C160–RepAwith IAEDANS gives very low yields (< 5%). Theyield can be improved significantly (to 50%) by per-forming the labeling reaction under conditions wherethe protein is unfolded, i.e. in the presence of 5.6 mguanidinium hydrochloride. Presumably, this poorreactivity is related to the low solubility of the nativeprotein (up to 10–20 lm). Under denaturing condi-tions, RepA can easily be concentrated 10- to 100-fold,thus favoring the bimolecular labeling reaction greatlyunder the conditions of $ 15-fold excess IAEDANS.The CD spectrum of unlabeled or AEDANS-labeledC160–RepA is indistinguishable from that of wild-typeRepA at 5 °C (Fig. 1A), indicating that the secondarystructure is not affected by the mutation or byAEDANS labeling. Thermal denaturation analysis ofthe protein variants suggests a lower stability of themutant (Fig. 1B). The C160–RepA variants show alower melting temperature than wild-type RepA (60versus 67 °C for wild-type RepA), and the thermaltransition of unlabeled C160–RepA has a substantiallylower slope (reduced co-operativity) than wild-typeRepA and the labeled variant. However, room temper-ature is well below the melting transition, and as theexperiments described here have been performed at orbelow this temperature, it can safely be assumed thatthe mutant protein is fully folded. This is supported bythe observation that the fluorescence emission spec-trum of the unique Trp residue (W94), a sensitive indi-cator of the folding state of the dimerization domainof RepA [4], is unchanged in the mutant withrespect to that of wild-type RepA (Fig. 1C). Finally,AEDANS C160–RepA and wild-type RepA showidentical binding to the operator sequence (Fig. 1D),confirming that mutation and labeling do not affectthe function, and by implication therefore also thestructure, of RepA.Fluorescence studies of RepA R. E. M. Diederix et al.5394 FEBS Journal 275 (2008) 5393–5407 ª 2008 The Authors Journal compilation ª 2008 FEBSFigure 2A shows the emission spectrum of AEDANSC160–RepA excited at 295 and 375 nm, respectively.When excited at 295 nm, fluorescence contributionsfrom both AEDANS and W94 are visible. Figure 2Bshows the excitation spectrum of the acceptor(kem= 480 nm). There is a clear contribution fromW94 visible as a shoulder at 280–290 nm, which isassignable to FRET from W94 to C160-AEDANS.ABFig. 2. (A) Fluorescence emission spectra of AEDANS-labeledC160–RepA, excited at 295 nm (solid line) and 375 nm (dashedline). The spectra are normalized with respect to the emissionintensity at 484 nm. (B) Excitation spectrum of AEDANS C160–RepA, measured at 480 nm. The arrow indicates the contribution ofTrp fluorescence. The spectra were recorded at 23.5 °C, in 0.15M(NH4)2SO4,15mM NH4-acetate, 0.03 mM EDTA, 3% glycerol;pH 6.0. [RepA] was $ 2 lM.A B C D Fig. 1. (A) Near- and far-UV CD spectra of wild-type RepA (solidline) and C160–RepA both unlabeled (dashed line) and AEDANS-labeled (dash-dots). The spectra were recorded at 5 °C with$ 3.5 lM wild-type and unlabeled C160–RepA, and 7 lM AEDANSC160–RepA. The buffer spectrum is subtracted and the spectrahave been transformed to mean residual ellipticity units. (B) Ther-mal denaturation curves for wild-type RepA (solid lines) and C160–RepA unlabeled (dashed line) and AEDANS-labeled (dash-dots). Thetemperature dependence of the ellipticity at 220 nm is shown, nor-malized to help compare the different proteins. (C) Fluorescenceemission spectra (kex= 295 nm) of wild-type RepA (solid line),C160–RepA both unlabeled (dashed line) and AEDANS labeled(dash-dots), recorded at 23.5 °C with $ 2 lM protein and withintensities normalized with respect to their emission maximum at327 nm. (D) Binding of wild-type RepA () and AEDANS C160–RepA (s) to 10 nm Alexa568-labeled 1IR, monitored by Alexa568fluorescence anisotropy (kex= 535 nm, kem= 605 nm). Data forboth proteins were fitted (see Eqns 3 and 5) together (solid line) toa 2 : 1 RepA : 1IR binding equilibrium using the quadratic equation.This yielded Kd=5±2nm, compatible with previous reports [3].Experiments were carried out in 0.15M (NH4)2SO4,15mM NH4-acetate, 0.03 mM EDTA, 3% glycerol; pH 6.0.R. E. M. Diederix et al. Fluorescence studies of RepAFEBS Journal 275 (2008) 5393–5407 ª 2008 The Authors Journal compilation ª 2008 FEBS 5395Binding of C160–RepA to operator and iteronsequences followed by AEDANS fluorescenceThe fluorescence of AEDANS–C160 was studied as afunction of DNA concentration for the operator andtwo distinct iteron sequences (described in Table 1).RepA binding to 1IR and 1DR has been studied indetail previously [3,6]. When increasing amounts of1IR, 1DR or 1DR-short are added to AEDANSC160–RepA, no effect is seen on the shape or intensityof the ‘pure’ AEDANS fluorescence, i.e. the emissionspectrum excited at 375 nm (not shown). There is,however, a clear increase in the fluorescence anisotropyfor each of the sequences (Fig. 3D–F), indicating adecrease in the rotational mobility of AEDANS C160–RepA. The anisotropy increase is slightly different foreach of the three sequences, and relates to an increasedglobal rotational correlation time for the AEDANSprobe caused by C160–RepA binding to DNA (seebelow). Addition of DNA also induces a change in theshape of the excitation spectra. This is caused by adecrease in the Trp contribution to AEDANS fluores-cence, as illustrated by the difference spectra betweenfree and bound RepA, which are typical of Trp(Fig. 3A–C).The increase in directly excited AEDANS anisotropymatches very well with the decrease in W94 contribu-tion to AEDANS fluorescence for each of the threeTable 1. Sequence of the oligonucleotides used in this study. IR (operator, half sites in bold), 1DR (single iteron underlined, with the halfsite also present in the operator in bold, purported DnaA box dashed underlined), 1DR-short (single iteron underlined, with the half site alsopresent in the operator in bold).Name Length (bp) Sequence1IR 39 GAACAAGGACAGGGCATTGACTTGTCCCTGTCCCTTAAT1DR 45 ATACCCGGGTTTAAAGGGGACAGATTCAGGCTGTTATCCACACCC1DR-short 30 GCCCGGGTTTAAAGGGGACAGATTCAGGCCA D B E C F Fig. 3. Excitation spectra (kem= 480 nm) ofAEDANS C160–RepA with increasing con-centrations of 1IR, 1DR and 1DR-short (A, Band C, respectively), causing changes in thedirection of the arrows. The spectra areinner filter corrected and normalized to theintensity at 340 nm. Difference spectrabetween free and DNA-bound RepA areshown as dashed lines. RepA was 1.25 lMand 0, 0.2, 0.4, 0.6 and 1 lM 1IR (A), 0, 0.4,1.2, 2.4 and 4 lM 1DR (B), and 0, 0.8, 1.8,3.2 and 6 lM 1DR-short (C). (D) Fluores-cence intensity (kex= 280 nm,kem= 480 nm), corrected and normalized asin (A) (), and AEDANS fluorescence anisot-ropy (kex= 375 nm, kem= 480 nm) ofAEDANS C160–RepA as a function of [1IR](s). Data were fit using the quadratic bind-ing equation (see Eqns 3–4). (E) and (F) as(D), except they refer to titrations with 1DRand 1DR-short, respectively. Experimentswere performed at 23.5 °C, in 0.15M(NH4)2SO4,15mM NH4-acetate, 0.03 mMEDTA, 3% glycerol, pH 6.0.Fluorescence studies of RepA R. E. M. Diederix et al.5396 FEBS Journal 275 (2008) 5393–5407 ª 2008 The Authors Journal compilation ª 2008 FEBStested oligonucleotides (Fig. 3D–F). The change in flu-orescence and anisotropy were fit simultaneously foreach titration. In the fits, the protein concentrationwas left free, to serve as an indicator of stoichiometry.In the case of 1IR, the fit resulted in a binding stoichi-ometry of 2 : 1, i.e. dimer binding. The reactant con-centrations were too high to obtain relevantinformation on the binding affinity. For binding to1DR, the best fit yielded a binding stoichiometry of$ 1 : 1, i.e. monomer binding, with a Kdbetween 0.2and 0.6 lm. With 1DR-short, a reliable estimate forthe stoichiometry of binding could not be made.Assuming binding as monomer or as dimer, respec-tively, the dissociation constants obtained were2.1 ± 0.2 and 2.9 ± 0.2 lm, without an apparent dif-ference in goodness of fit. However, in a separateexperiment involving inter-monomeric homoFRET(see below) the binding stoichiometry was confirmed asdimeric RepA to the 1IR and IDR-short sequences,and monomeric RepA to 1DR. The binding affinityunder these conditions is thus 2.9 lm.FRET between Trp94 and the AEDANSAs mentioned above, DNA binding induces an appar-ent decrease in FRET efficiency between W94 andAEDANS–C160. Along with this decrease, there isalso a considerable degree of quenching of W94 fluo-rescence. This residue has a relatively high quantumyield for Trp [13] that is strongly quenched upon bind-ing to its cognate DNA sequences (see Table 2). Thisquenching is unrelated to FRET, as it also occurs withunlabeled RepA. Furthermore, it does not decrease thelifetime of W94 fluorescence significantly (see Table S1),indicating that it is static in nature. We do not havean unequivocal interpretation of the origin of the staticquenching. However, judging from the binding stoichi-ometry together with the shape of the binding curves(Fig. 3), it is safe to conclude that the quenching doesnot affect the RepA–DNA binding equilibria, and thusthat dark state(s) of W94 are present in the RepA–DNA complexes. Because the fraction of non-fluores-cent donor molecules does not contribute to theTrp fi AEDANS energy transfer process, a correc-tion of the FRET efficiencies for the presence of non-fluorescent W94 is required (see Eqn 1, Experimentalprocedures). After doing so, it appears that the differ-ence in FRET efficiency between free RepA and itsDNA complexes is actually relatively minor (seeTable 2). Accordingly, the resulting distance calculatedbetween W94 and AEDANS–C160 does not displaylarge variations between the different species.However, there are a number of caveats that shouldbe taken into account. First, there are several tyrosineresidues in RepA. As the fluorescence was excited at280 nm, there is the possibility that some of the fivetyrosines present in the W94-containing N-terminaldomain of RepA also contribute to the experimentalFRET efficiency, by Tyr fi Trp energy transfer. Asthe distance between W94 and the nearest Tyr residueis $ 15 A˚[5], this contribution is negligible, however.This conclusion is well supported by the apparent lackof contribution of Tyr to the excitation spectrum ofacceptor AEDANS indicated in the excitation differ-ence spectra seen in Fig. 3A–C. Second, the Fo¨rsterand donor-acceptor distances determined here, relateto the R0value determined assuming hj2i =2⁄ 3,R0(2/3) (see Experimental procedures). This value wascalculated to be 25 ± 1 A˚. The value of hj2i is notknown exactly, leading to additional uncertainty. Themaximum and minimum limits of the value of hj2i forthe W94 ⁄ AEDANS–C160 couple in RepA were esti-mated as described previously [14,15], from the depo-larization factors determined from time-resolvedfluorescence anisotropy recorded for wild-type RepAW94 and AEDANS C160–RepA (see below, andTable S1). It appears that the factor hj2i for RepA–DNA complexes would have a value between 0.06 and3.51, which in turn yields an uncertainty in the abso-lute distance between 0.7 and 1.3 times the value ofR(2/3), presented in Table 2.Nevertheless, the R(2/3) value in the complex with1DR is in excellent agreement with the distance mea-sured between the Cbatoms of both residues in thestructural model of RepA [2] based on the monomer–iteron complex structure of the homologous RepE pro-tein [7]. W94 and C160 are each located on one of theTable 2. Fluorescence and FRET parameters of the W94–AEDANS–C160 pair and resulting average inter-probe distances, infree RepA and RepA bound to various cognate DNA sequences.FRET efficiency was determined using Eqn (1), and assumingeW 94280 nmeAEDANS340 nm= 1 and eAEDANS280 nmeAEDANS340 nm= 0.17 (see Experimentalprocedures). The apparent quantum yield of W94 (FW94) was deter-mined both for wild-type RepA and unlabeled C160–RepA. Thedegree of quenching, i.e. the ratio of FW94in free and DNA-boundRepA was used to determine the fraction of fluorescent donor(d+in Eqn 1).SpeciesFW94(± 0.02)d+(± 0.08)FRET efficiency(± 0.15)R(2/3)(A˚)(± 7)bfree RepA 0.29 1.00 0.7 22+ 1IR 0.14 0.48 0.8 20+ 1DR 0.21 0.72 0.6 23+ 1DR-short 0.16a0.55a0.8a20aValues based on extrapolations from binding curves and as suchnot experimentally confirmed.bUsing R0(2/3) = 25 ± 1 A˚.R. E. M. Diederix et al. Fluorescence studies of RepAFEBS Journal 275 (2008) 5393–5407 ª 2008 The Authors Journal compilation ª 2008 FEBS 5397two different domains of RepA, and therefore changesin distance between both residues can be interpreted interms of domain movements. Because no relevantchange is observed, it can be concluded that no signifi-cant reorientation takes place between the two domainsof RepA upon binding to the operator or iteron DNAor as a result of the monomerization of RepA thataccompanies binding to 1DR. We can not currentlyexclude a rotation centered about C160, as this will alsonot affect the distance between both residues. Also,note that, in theory, inter-monomeric FRET may occurin the case of RepA dimers. This is unlikely however,considering the distance between both W94 residues($ 20 A˚) and that both DNA binding domains con-taining the AEDANS probes are located roughly onopposing ends of the dimerization domains [5].Time-resolved fluorescence depolarization androtational correlation times of RepA and its DNAcomplexesTime-resolved depolarization measurements were per-formed to obtain information on global and localdynamics of the AEDANS and W94 probes in freeand DNA-bound RepA. The decay of the total fluores-cence intensity was recorded, as well as the decays ofits vertically and horizontally polarized components.The anisotropy decay of the fluorophore can bedescribed in terms of its slow and fast components, i.e.of global and local re-orientational motions, respec-tively. This was carried out for both W94 in wild-typeRepA and AEDANS-labeled C160–RepA. AEDANShas a much longer fluorescence lifetime than Trp,allowing a much greater level of confidence in thedetermination of correlation times pertaining to theglobal rotational motion. Nevertheless, the global rota-tional information obtained from Trp fluorescenceanisotropy decays (see Fig. S1 and Table S1) shows atrend in agreement with the data from the AEDANSexperiments. Furthermore, despite the relatively poorphoton-counting statistics, the local dynamics of W94have been characterized from the Trp decays. InFig. 4, anisotropy decays (kem= 480 nm) are shownfor the different AEDANS C160–RepA species,together with best fits assuming a bi-exponentialfunction for r(t) (see Experimental procedures). TheA B C D Fig. 4. Anisotropy decays R(t)(kex= 375 nm, kem= 480 nm) of AEDANSC160–RepA free in solution (A) and boundto 1IR (B), 1DR (C) and 1DR-short (D).Experiments were performed at 23.5 °Cin0.15M (NH4)2SO4,15mM NH4-acetate,0.03 mM EDTA, 3% glycerol, pH 6.0. Experi-mental data (s) were reconstructed fromthe fluorescence decays that were polarizedparallel and perpendicular to the polarizationplane of the excitation beam, after subtract-ing their respective dark counts. Fits to thedata are shown as solid gray lines. AEDANSC160–RepA was $ 2 lM in each experimentand with 2.5 lM 1IR, 8 lM 1DR and 12 lM1DR-short, respectively. Weighted residualsfor the fits between experimental and calcu-lated R(t) are shown below the curves.Fluorescence studies of RepA R. E. M. Diederix et al.5398 FEBS Journal 275 (2008) 5393–5407 ª 2008 The Authors Journal compilation ª 2008 FEBSanalogous decays with kem= 530 nm, with corre-sponding best fits and tabulated parameters, are sup-plied in Fig. S2 and Table S1.The AEDANS data confirm the presence of discretecomplexes under the conditions of the experiment,and that binding is complete, in agreement with thebinding curves (Fig. 3), except for the case of thecomplex with 1DR-short, which under these condi-tions should contain $ 20% free RepA. As expected,the global rotational correlation time, /2, increasesupon binding of RepA to its cognate DNA. Apartfrom the RepA–1DR-short complex, the observed val-ues easily fall within the range reasonably expectedfrom molecules of this size and shape (Table 3). Theexpected values for free RepA and the dimeric RepA–1IR complex were calculated on basis of hydro-dynamic shapes and volumes corresponding to prior[3] sedimentation velocity measurements as shown inFig. 5. Both can be characterized as rigid elongatedshapes. For the monomer RepA–1DR complex, thestructure modeled on the homologous mRepE–DNAcrystal structure [7] was used directly to calculate theexpected global rotational correlation time. The calcu-lated values for the RepA–1DR-short complex pertainto a monomer, i.e. the modeled structure as above,but with a truncated oligonucleotide having 30 bpinstead of the 45 bp of 1DR. This purported complexof monomeric RepA with 1DR-short is not shown,but it is easily imagined that this complex is quitespherical and that it should have a relatively shortglobal rotational correlation time. This is clearly notwhat is observed. Note that because the orientation ofthe AEDANS probe in the complex is not known, weprovide a range of calculated values, i.e. the minimumand maximum of the correlation times correspondingto the complex (see Experimental procedures). Never-theless, even given this significant uncertainty, themeasured value of the complex with 1DR-short clearlyexceeds the maximum value that was calculated for ahypothetical complex involving RepA monomer.Bycontrast, a correlation time around 100 ns fits wellwith a complex involving dimeric RepA and a 30 bpoligonucleotide. It should further be noted that thepresence of 20% free RepA in the case of the 1DR-short complex will lead to a slight underestimation ofthe rotational correlation time. There appears to belinear correlation between oligonucleotide size (zerofor free RepA) and experimental correlation time forthe complexes involving dimeric RepA (Table 3). Onlythe complex between 1DR and RepA does not fit thisTable 3. Fluorescence lifetimes, time-resolved and steady-state anisotropy parameters for AEDANS–C160 in free RepA and RepA bound tovarious cognate DNA sequences.aSamplehrssi± 0.002hsic(ns)± 0.4b1± 0.05/1(ns)±3b2±0.05/2(ns)±10/2calc (ns)(max–min)Free RepA 0.209 13.1 0.234 4.5 0.766 56 (42–89)d+ 1IR 0.239b12.2 0.156 2.7 0.844 109 (61–131)d+ 1DR 0.237b13.4 0.160 4.2 0.840 97 (43–138)d+ 1DR-short 0.238b13.5 0.150 7.3 0.850 98 (35–59)eaEstimated errors at the 67% confidence level [30].bSteady-state anisotropy from fits to the data in Fig. 3.ckex= 375 nm, kem= 480 nm;r0(from the fits) = 0.31 ± 0.015); T = 23.5 °C.dMinimum and maximum calculated rotational correlation times assuming a prolate ellipsoidshape, and using shape factors from frictional ratios previously [3] determined using sedimentation velocity experiments.eMinimum andmaximum calculated rotational correlation times calculated using theHYDROPRO program [17] using as input homology models of the RepA–1DR and 1DR-short complexes, respectively, based on the crystal structure [7] of monomeric RepE in complex with iteron DNA.Fig. 5. Prolate ellipsoids equivalent to (non-hydrated) free RepA(upper) and RepA–1IR complex (lower), with axial ratio and volumescorresponding to frictional ratios determined from prior sedimenta-tion velocity analysis (3) and molecular mass (23) respectively. Themodeled structure of monomeric RepA–1DR is shown in two orien-tations (center). For clarity, the purported structure of RepA mono-mer with 1DR-short is not shown. The length of 1DR-short onlyallows for five nucleotides (half a helical turn) to protrude fromeither end of the protein–DNA interface.R. E. M. Diederix et al. Fluorescence studies of RepAFEBS Journal 275 (2008) 5393–5407 ª 2008 The Authors Journal compilation ª 2008 FEBS 5399correlation, in line with the fact that it is the onlycomplex involving monomeric RepA.Finally, we note that the range of global rotationalcorrelation times calculated for the dimer–operatorcomplex of the F plasmid RepE protein, which ishighly homologous to RepA and of which the crystalstructure is known [9], is shorter (57–83 nucleotides)than observed here for the RepA–1IR complex. Thiscould mean that there are significant differencesbetween the RepE– and RepA–operator complexes,which are possibly related to the different spacingbetween the half repeats in both operator DNAsequences [9].Oligomerization state of free and complexedRepA determined by homoFRETIn order to understand the oligomerization state ofRepA in the different DNA complexes better, homo-FRET experiments were carried out. Herein, use ismade of C160–RepA specifically labeled with Atto532.In a double-labeled sample, FRET is expected to occurbetween the two Atto532 moieties whenever the inter-probe distance is not greater than $ 1.5 times theFo¨rster distance. The calculated R0(2/3) = 55 A˚forAtto532–Atto532 homoFRET, and thus energy trans-fer is expected to occur in double-labeled RepAdimers. Thus, no FRET is expected when RepA ismonomeric, or in single-labeled Atto532–RepA dimers.HomoFRET between the fluorophores is detectedthrough depolarization of their emission, but note thatthis occurs only if they do not happen to be alignedmore-or-less parallel to each other in the dimer.C160–RepA samples labeled with 60% Atto532 (i.e.with 43% of Atto532 residing on double-labeled RepAdimers) show clearly different excitation anisotropyspectra from C160–RepA samples labeled with only10% Atto532, i.e. with very little double-labeled RepAdimers (< 5%). This is shown in Fig. 6A, where thereis an evident decrease in anisotropy for the samplecontaining the double-labeled C160–RepA dimers,which is less pronounced at longer excitation wave-lengths (red-edge excitation). The enhanced fluores-cence depolarization in the double-labeled dimers withrespect to the single-labeled samples is a clear indica-tion of homoFRET in the double-labeled samples [16].The increase in steady-state anisotropy observed upondecreasing the degree of Atto532-labeling from 60% to10% is also observed when excess 1DR is added to60% labeled Atto532 C160–RepA, but not upon theaddition of excess 1IR and 1DR-short (Fig. 6B). Thismeans that addition of 1DR abolishes the homoFRET,by inducing RepA monomerization. In fact, the addi-tion of 1IR and 1DR-short causes a small decrease inanisotropy which may be related to enhanced homo-FRET caused by slight rearrangement of the mono-mers in the RepA dimers or by minor aggregation.Thus, RepA is dimeric free in solution and whenbound to its operator sequence, but also when boundto 1DR-short. In the presence of excess 1DR, mono-merization of RepA takes place.DiscussionOne of the striking properties of RepA is that it is ableto recognize two types of DNA sequence, either theoperator – with inverted repeats – or the iteron, inwhich the same 6 bp sequence half-site found in theoperator is specifically recognized. Upon binding tothe operator, RepA remains dimeric; it thus retains itssymmetry matching the inverted repeats of the oligo-nucleotide. When this symmetry is absent, i.e. for theA B Fig. 6. (A) Excitation anisotropy spectra of Atto532–C160 RepAlabeled to different degrees (solid line: 60% label, dashed line:10%). [RepA] is 0.5 lM in either case, and conditions are 0.5 M(NH4)2SO4,50mM NH4-acetate pH 6.0, 30 lM EDTA, 10% glycerol,T =6°C. (B) Average changes in steady state fluorescence anisot-ropy between 60% Atto532–C160 RepA and, from left to right,10% Atto532–C160 RepA, 60% Atto532–C160 RepA in the pres-ence of 2 lM 1IR, 1–4 lM 1DR-long and 8–16 lM 1DR-short. Condi-tions: 0.15M (NH4)2SO4,15mM NH4-acetate pH 6.0, 10 lM EDTA,3% glycerol, T =6°C. In the experiments with DNA,[RepA] = 15 nm.Fluorescence studies of RepA R. E. M. Diederix et al.5400 FEBS Journal 275 (2008) 5393–5407 ª 2008 The Authors Journal compilation ª 2008 FEBSiteron sequence, RepA binds as a monomer instead ofa dimer.When operator or iteron DNA is added to AE-DANS C160–RepA, discrete complexes are formed(Fig. 3), characterized by higher AEDANS fluores-cence anisotropy values and decreased apparent Trp-AEDANS FRET (see below). RepA binds operatorDNA (1IR) with a clear stoichiometry of 2 : 1, i.e. theprotein binds as a dimer. With the iteron sequence1DR, which includes an additional stretch of bases(see Table 1), a stoichiometry of 1 : 1 is found, i.e.monomer binding. When the number of bases flankingthe iteron sequence is considerably shorter, as with1DR-short, the binding affinity is significantlydecreased (2.9 lm), and nears that of non-specificDNA [6]. Still, a discrete complex is formed in thiscase, as corroborated by fluorescence anisotropy decaymeasurements.Fluorescence anisotropy decay analysis is a potentmethod to obtain information on the local and globaldynamics of species in solution. Here, it is used tocharacterize the discrete species discussed above. Forfree RepA and RepA in complex with 1IR or 1DR,experiments were performed with AEDANS. The anal-ysis, summarized in Table 3, yields global rotationalcorrelation times for free RepA and the complex with1IR corresponding to species involving dimeric RepA,as expected. In the case of the complex with 1DR, afair correlation is also found between the experimentaland calculated global rotational correlation times. Forthe latter, the hydropro program was employed,which is able to extract hydrodynamic parametersusing the protein’s atomic co-ordinates [17]. A homo-logy model based on the RepE–iteron structure wasused as input. Note that the bending angle of the 1DRas observed by EMSA (52°) is significantly larger thanin the crystal structure (20°) which was used for thehomology model [6,7]. Furthermore, the crystal stru-cture has a much shorter DNA oligonucleotide thanthe 1DR sequence: the latter is $ 3–4 times longerthan the protein itself and may thus form a source ofsignificant flexibility, difficult to account for in modelbuilding.However, using the same structure as a basis toconstruct a potential complex between 1DR-short andmonomeric RepA is not realistic. The observed globalrotational correlation time for the RepA–1DR-shortcomplex cannot conceivably be justified assuming acomplex similar to the RepE–iteron complex. How-ever, the purported dimeric RepA–1DR-short complexfits very well into the linear correlation between oligo-nucleotide size and experimental correlation time forthe complexes involving dimeric RepA. The complexbetween 1DR and RepA does not fit this correlation,in line with the fact that it involves monomeric RepA.It is thus tempting to assume that dimeric RepA isactually involved in binding the 1DR-short sequence,despite the fact that it contains the full 22 bp iteron.This last conclusion is corroborated by the observa-tion that inter-monomeric homoFRET is observablewith 1DR-short, but not 1DR (Fig. 6). That dimer-binding to iterons is, in principle, possible has previ-ously been shown by us. According to EMSAs carriedout under crowded conditions, a fraction of RepAdimers was observed to bind to the 1DR sequence [6].This fraction is obviously much larger in the case of1DR-short, and the extra bases on the longer, mono-mer-binding, oligonucleotide 1DR seem to play a rolein aiding monomerization. The presence of basesdownstream of the iteron sequence has also previouslybeen shown to promote binding of Rep to pSC101[18].The related replication initiator protein p from R6Kplasmid is a well-documented case where not onlymonomers, but also dimers, are known to bind to theiteron [19]. Interestingly, dimers of p protein occupy amuch shorter stretch of the iteron sequence than domonomers; whereas almost the entire 22 bp iteronsequence is occupied by the p monomers, only half ofthis – notably including the specific 6 bp recognitionsequence (repeat) – is occupied when dimeric p proteinis bound [19]. This may occur here as well. As there isonly one half of the inverted repeat of the operatorsequence present in 1DR-short, it is likely that onlyone of two WH2 DNA-binding domains in RepAdimers is involved in binding. This also makes senseenergetically, the RepA dimer binds operator DNAwith Kd= 0.7 nm i.e. DG = )21.2 kJÆmol)1[6]. Sub-tracting from this a penalty of $ 7.8 kJÆmol)1for theDNA bending [20] induced by dimer binding (61°), afree energy of ()21.2 to 7.8) ⁄ 2=)14.5 kJÆmol)1isexpected for binding of a single DNA-binding domainwithout the need to force DNA bending. This trans-lates to Kd= 1.3 lm, which is reasonably close to thevalue of 2.9 lm observed here for 1DR-short.It is clear that in vitro, the effect of decreased lengthof the iteron flanking sequence is to weaken the iteron-binding affinity of monomeric RepA so that, at high[RepA], dimer binding occurs. In vivo, this effect maybe comparable in the sense that monomer-bindingaffinity is attenuated by the length or identity of theflanking sequence. It is well established that Rep pro-tein dimers do not act as initiators in plasmid replica-tion [21]. A positive effect on monomer-bindingaffinity thus provides a way of selecting againstdimer binding, favoring monomer binding and thusR. E. M. Diederix et al. Fluorescence studies of RepAFEBS Journal 275 (2008) 5393–5407 ª 2008 The Authors Journal compilation ª 2008 FEBS 5401initiation. It should be mentioned that the four iteronsin pPS10 are contiguous, thus limiting the degree towhich the flanking sequences may contribute to bind-ing. In other replicons, however, there are spacersequences between the iterons, which in addition mayhave some sequence variability [22]. It would be inter-esting to see whether our findings for RepA can beextrapolated to other Rep proteins.An attractive feature of using AEDANS as anextrinsic label is that, besides its use to analyze theglobal rotational correlation times of macromole-cules, it is useful as a FRET acceptor for intrinsicTrp residues. RepA fortunately has only one Trp,making this use of the AEDANS probe more mean-ingful and helping interpretation of the FRET interms of distances between the two fluorophores.Moreover, W94 and C160 are located on the dimer-ization and DNA-binding domains of RepA, respec-tively, allowing us to interpret any observed changesin FRET in terms of relative movements betweenthe two domains.It emerges that the average estimated distancebetween the C160–AEDANS and W94 is $ 22 A˚inthe free RepA dimer, and this distance decreases by afew angstroms upon binding either the 1IR, or 1DR-short oligonucleotides and increases slightly uponmonomerization and binding to 1DR (see Table 2).The average distance observed in the complex with1DR is in very good agreement with the value mea-sured between the Cbatoms of residues W94 and C160in the homology model of RepA, supporting the esti-mated value. It is interesting that within the error, thedistance between the AEDANS and indole moietiesapparently does not change significantly betweenunbound RepA and RepA bound to either 1IR (as adimer with both DNA-binding domains involved inbinding), or 1DR-short (as a dimer, but presumablywith only one domain involved), or indeed whenbound as a monomer to 1DR. This suggests that bind-ing to both inverted half-repeats, as in the operatorsequence, does not trigger large conformational rear-rangements with respect to the free dimeric protein orto the dimer purportedly bound via one DNA-bindingdomain (1DR-short). Although significant structuralrearrangements of RepA occur upon monomerization[3–5], these do not appear to grossly alter the relativeorientation of the two domains with respect to eachother. Naturally, it should be noted that manifold rela-tive orientations of the two domains may exist, satisfy-ing the observed distance, but which are stillsignificantly different. We are currently workingtowards a more comprehensive understanding of inter-domain orientations using FRET.Experimental proceduresCloning, expression and purification of wild-typeRepA and C160–RepAIn all cases, the concentration of protein is expressed inmonomer units. What is referred to as wild-type RepA is theHis6-tagged variant of RepA, which was expressed andpurified as described previously [4]. This protein is indistin-guishable from that without His-tag, except that it has ahigher solubility [3,4]. It was therefore used without sub-sequent removal of the tag. C160–RepA also has theHis6-tag and is a single-cysteine variant of wild-type RepAin which two of the three wild-type Cys residues (C29, C106)have been successively replaced by Ser using the PCR-basedQuickChange Kit (Stratagene, Cedar Creek, CA, USA).Mutations were verified by sequencing. C160–RepA wasexpressed as wild-type RepA [4] but almost all C160–RepAwas present in the form of insoluble aggregates. The proteinwas isolated by solubilization of the inclusion bodies andpurification by Ni(II)-affinity chromatography under dena-turing conditions, similarly as described previously [4]. Thisresults in pure protein, exhibiting a single band onSDS ⁄ PAGE. After purification, the protein was reduced byaddition of 2 mm 2-mercaptoethanol and exchanged tounfolding buffer (5.6 m guanidinium hydrochloride, 0.56 m(NH4)2SO4, 0.2 m NH4-acetate, 0.2 mm EDTA, 1.2%Chaps, pH 6.0). Immediate refolding is achieved by fast20-fold dilution in 0.15 m (NH4)2SO4,15mm NH4-acetate,0.03 mm EDTA, 3% glycerol, pH 6.0. A small amount ofprecipitate generated by the refolding procedure was spundown at 14 000 g for 20 min. The latter buffer was used bothfor storage ()80 °C) and experiments.Protein labelingC160–RepA was labeled with IAEDANS (MolecularProbes, Leiden, The Netherlands) under denaturing condi-tions, as follows. C160–RepA was concentrated to$ 150 lm in unfolding buffer by ultrafiltration (10 kDacut-off). A small amount of 1 m Tris ⁄ HCl (pH 8.5) wasadded to increase the pH to 7.2, and Tris(2-carboxyethyl)phosphine to keep the single Cys reduced (1 mm). The endvolume was 1.6 mL. IAEDANS was dissolved (40 mm) inunfolding buffer and quickly mixed with the reduced pro-tein to a final concentration of 2 mm. The reaction wasallowed to proceed for 2 h at room temperature, and then12.3 mg of glutathione was added to quench the reaction.The reaction mixture was exchanged for fresh unfoldingbuffer by extensive ultrafiltration. The labeling efficiencywas close to 50%, as judged from UV ⁄ Vis spectroscopy.AEDANS C160–RepA was refolded in the same way asunlabeled RepA. Similarly, C160–RepA was labeled withmaleimide Atto532 (Atto-Tec, Siegen, Germany), with 60%labeling efficiency. Here, the degree of labeling in the foldedFluorescence studies of RepA R. E. M. Diederix et al.5402 FEBS Journal 275 (2008) 5393–5407 ª 2008 The Authors Journal compilation ª 2008 FEBS[...]... 5403 Fluorescence studies of RepA R E M Diederix et al (kex = 295 nm) of free and bound unlabeled C16 0RepA and wild-type RepA, with the protein concentration constant The ratio of the apparent FW94 of bound and free RepA was then used to estimate the fraction of uorescent donor remaining upon DNA complexation (d+ in Eqn 1) For the R0 calculation we used the quantum yield determined for free C16 0RepA. .. performed with increasing amounts of DNA added to AEDANS C16 0RepA, or with increasing amounts of wild-type RepA or unlabeled C16 0RepA added to Alexa5681IR Fresh solutions were prepared for each data point, and equilibrated 10 min before measuring Binding curves were t to the quadratic expression given in Eqn (3) for the amount of RepADNA complex, with [RepA] divided by the expected stoichiometry n The amount... shape with dimensions derived from sedimentation velocity experiments [3] In the case of iteron complexes, a crystal structure of the homologous protein F plasmid RepE in complex with its cognate iteron sequence is available [7] Using this, we built an homology model of the RepA1 DR structure [2,10] and simply elongated the DNA sequence assuming rigid DNA with no additional bending, to construct the complexes... (2004) Binding modes of the initiator and inhibitor forms of the replication protein p to the c ori iteron of plasmid R6K J Biol Chem 279, 41058 41066 20 Williams LD & Maher LJ III (2000) Electrostatic mechanisms of DNA deformation Annu Rev Biophys Biomol Struct 29, 497521 21 Kruger R, Rakowski SA & Filutowicz M (2004) Particiă pating elements in the replication of iteron containing plasmids In Plasmid... changes in RepA, a plasmid replication FEBS Journal 275 (2008) 53935407 ê 2008 The Authors Journal compilation ê 2008 FEBS 5405 Fluorescence studies of RepA 4 5 6 7 8 9 10 11 12 13 14 15 R E M Diederix et al inititator, upon binding to origin DNA J Biol Chem 278, 1860618616 Giraldo R, Andreu JM & D az-Orejas R (1998) Protein domains and conformational changes in the activation of RepA, a DNA replication initiator. .. Giraldo R, Fernandez-Tornero C, Evans PR, D azOrejas R & Romero A (2003) A conformational switch between transciptional repression and replication initiation in the RepA dimerization domain Nat Struct Biol 10, 565571 D az-Lopez T, Davila-Fajardo C, Blaesing F, Lillo MP & Giraldo R (2006) Early events in the binding of the pPS10 replication protein RepA to single iteron and operator DNA sequences J Mol... Calculation of hydrodynamic properties of globular proteins from their atomic-level structure Biophys J 78, 719730 18 Fueki T, Sugiura S & Yamaguchi K (1996) Open strands to iterons promote the binding of the replication initiator protein (Rep) of pSC101 to the unit sequence of the iterons in vitro Biochim Biophys Acta 1305, 181 188 19 Kunnimalaiyaan S, Kruger R, Ross W, Rakowski SA ă & Filutowicz M (2004) Binding... excitation of the acceptor It is independent of FRET and depends only on the acceptor concentration The extinction coefcients of W94 [25] and AEDANS [26] are assumed constant as a function of labeling and or protein complexation state Because of relatively low signal intensity for 295 nm excitation caused by the poor solubility of RepA, we measured it for 280 nm excitation instead The disadvantage of this... hydropro, the limiting minimum and maximum rotational correlation times have been included in Table 3 Partial specic volumes used for protein, DNA and hydration were 0.703, 0.55 and 0.28 mLặg)1, respectively 7ị Estimates of the global rotational correlation times for free dimeric RepA, and the complexes with 1IR, 1DR and 1DR-short were calculated in one of two ways: based on the 3D structure and based... Diederix et al protein was important and varied from 60% to 10% by mixing the appropriate amounts of Atto532-labeled and unlabeled C16 0RepA before refolding Correct refolding of Atto532 C16 0RepA was conrmed by determining its binding efciency and stoichiometry to Alexa647-labeled 1IR, using FRET (not shown) DNA purication and labeling 1DR (Table 1) was prepared as described previously [36] The 1IR and 1DR-short . Fluorescence studies of the replication initiator protein RepA in complex with operator and iteron sequences and free in solution Rutger. (1996) Openstrands to iterons promote the binding of the replication initiator protein (Rep) of pSC101 to the unit sequence of the iterons in vitro. Biochim
- Xem thêm -

Xem thêm: Báo cáo khoa học: Fluorescence studies of the replication initiator protein RepA in complex with operator and iteron sequences and free in solution pdf, Báo cáo khoa học: Fluorescence studies of the replication initiator protein RepA in complex with operator and iteron sequences and free in solution pdf, Báo cáo khoa học: Fluorescence studies of the replication initiator protein RepA in complex with operator and iteron sequences and free in solution pdf