Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition Amit Arora, Divya R. Nair and Souvik Maiti Proteomics and Structural Biology Unit, Institute of Genomics and Integrative Biology, Council for Scientific and Industrial Research (CSIR), Mall Road, Delhi, India G-quadruplexes are unique secondary structures formed by inter- or intramolecular association of guan- ine-rich nucleic acid sequences in the presence of metal ions [1–10]. A genome-wide search showed that as many as 376 000 potential quadruplexes could exist in the functionally important regions of genes [11]. The biological significance of G-quadruplexes is further highlighted by their presence in the promoter regions of the c-myc [12–15], c-kit [16], k-ras [17] and Rb [18] genes, the immunoglobin switch region [19], insulin regulatory sequences [20], the fragile X gene [21], the cystatin B promoter [22], the Hif-1a promoter [23] and the proximal promoter of the VEGF gene [24]. The possible existence and roles of G-quadruplexes in vivo have been corroborated by the detection of proteins that bind specifically to G-quadruplexes and proteins that have biological activities, such as helicases and nucleases, that are specific for G-quadruplexes [25]. In the cellular environment, G-rich sequences are flanked by other bases and are present with their complementary strands, leading to a dynamic equilib- rium between quadruplex and duplex structures [26]. Depending on the cellular requirements, this equi- librium favors either quadruplex or Watson–Crick duplex formation for execution of their respective biological functions. Studies have been performed to elucidate the role of various factors in guiding the direction of the equilibrium [27–37]. Previous studies have mostly assessed the significance of changes in the intracellular environment in terms of pH, the presence of cations, temperature and molecular crowding on the quadruplex to duplex transition. It has been Keywords c-kit; equilibrium; flank length; quadruplex; Watson–Crick duplex Correspondence S. Maiti, Proteomics and Structural Biology Unit, Institute of Genomics and Integrative Biology, CSIR, Mall Road, Delhi 110 007, India Fax: +91 11 2766 7471 Tel: +91 11 2766 6156 E-mail: souvik@igib.res.in (Received 8 February 2009, revised 5 April 2009, accepted 1 May 2009) doi:10.1111/j.1742-4658.2009.07082.x Guanine-rich DNA sequences have the ability to fold into four-stranded structures called G-quadruplexes, and are considered as promising antican- cer targets. Although the G-quadruplex structure is composed of quartets and interspersed loops, in the genome it is also flanked on each side by numerous bases. The effect of loop length and composition on quadruplex conformation and stability has been well investigated in the past, but the effect of flanking bases on quadruplex stability and Watson–Crick duplex competition has not been addressed. We have studied in detail the effect of flanking bases on quadruplex stability and on duplex formation by the G-quadruplex in the presence of complementary strands using the quadru- plex-forming sequence located in the promoter region of the c- kit onco- gene. The results obtained from CD, thermal difference spectrum and UV melting demonstrated the effect of flanking bases on quadruplex structure and stability. With the increase in flank length, the increase in the more favorable DH vH is accompanied by a striking increase in the unfavorable DS vH , which resulted in a decrease in the overall DG vH of quadruplex formation. Furthermore, CD, fluorescence and isothermal titration calori- metry studies demonstrated that the propensity to attain quadruplex struc- ture decreases with increasing flank length. Abbreviations ITC, isothermal titration calorimetry; LNA, locked nucleic acid; TDS, thermal difference spectrum. 3628 FEBS Journal 276 (2009) 3628–3640 ª 2009 The Authors Journal compilation ª 2009 FEBS demonstrated that molecular crowding agents such as osmolytes significantly affect this transition, as living cells are crowded with various biomolecules [38,39]. It is apparent that the composition of the base sequences in the loops between the G-quartets, the loop length and the base sequences flanking the quadruplex may also affect the transition between quadruplex and duplex in the natural environment of biological sys- tems. Recently, Kumar et al. [40] demonstrated the role of a locked nucleic acid (LNA) modified comple- mentary strand in the quadruplex ⁄ Watson–Crick duplex equilibrium. The study indicated that LNA modifications in the complementary strand shift the equilibrium toward the duplex state. Moreover, it has also been shown that an increase in loop length favors duplex formation and competes out the quadruplex [41]. However, to obtain a greater insight into the dynamics of the equilibrium between the folded motif and the duplex form, the G-rich sequences must also be considered within the genomic framework. Previous studies have focused on quadruplex sequences in isola- tion, but the cellular environment is significantly dif- ferent. In the genome, these unique sequences are flanked by other sequences that might influence the stability of these folded motifs and their ability to compete with the duplex form in the presence of their complementary strands. It thus seems logical to study the influence of flanking regions on the existence of quadruplexes, their stability and quadruplex ⁄ duplex competition in the presence of the complementary strand. As the quadruplex-forming region does not occur in isolation, and instead is flanked by other sequences, it is imperative to analyze the effect of these neighboring sequences on quadruplex stability and on the duplex ⁄ quadruplex equilibrium. In the current study, we have explored the influence of flanking sequences in the quadruplex-forming region of the c-kit proto-oncogene promoter [16]. Conforma- tional analysis of preformed quadruplexes with flank lengths from 0 to 12 was performed using CD and thermal difference spectrum (TDS). Thermal denatur- ation ⁄ renaturation profiles using UV-visible spectro- scopy were obtained in order to create a complete thermodynamic profile for formation of quadruplexes with different flank lengths. Binding parameters and the thermodynamic profile of preformed quadruplexes in the presence of the complementary strand were evaluated by fluorescence and isothermal titration cal- orimetry (ITC) studies. The data obtained in this study highlight the influence of flanking bases on quadruplex stability and structural competition between the G-quadruplex and the duplex. Results and Discussion To be able to assign a biologically relevant role to quadruplexes, they must be considered in the genomic context and natural cellular environment. We have addressed this question in this study because of its wider implication on the practicality of using G-quad- ruplexes as therapeutic targets. The telomeric quadru- plex has been well investigated and characterized in terms of its structural and functional relevance [2,5,42–44]. However, this quadruplex, formed by the 3¢ overhang of the telomere, lacks a complementary strand and hence does not suffer competition with the Watson–Crick duplex. In addition to the telomeric quadruplex, the G-quadruplex present in the promoter region of the c-myc proto-oncogene has also been well characterized in terms of its structure and function [12–15,45]. However, this quadruplex adopts multiple conformations that make structural ⁄ biophysical inves- tigations difficult [45]. Recently, quadruplex formation has been reported in the promoter region of the c- kit proto-oncogene (87 bp upstream of the transcription start site) [16]. The solution structure of this quadru- plex is also well characterized [46–49], and it has also been investigated as an attractive therapeutic target [50]. This has generated interest with respect to further biophysical and structural characterization of c-kit quadruplex. However, to design effective drugs against quadruplex targets, it is essential to study the role of various factors affecting quadruplex stability and influ- encing the equilibrium between quadruplex and duplex formation. Therefore, we have used the c-kit quadru- plex sequence (5¢-GGGAGGGCGCTGGGAGGAG GG-3¢) as the model sequence for our study (Fig. 1). To analyze the effect of flanking bases on quadruplex Fig. 1. Schematic representation of the 21-mer G-rich sequence located )87 bp upstream of the transcription start site of the c-kit gene. The sequences shown to the left of )108 and to the right of )87 are the flanking sequences. A. Arora et al. Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition FEBS Journal 276 (2009) 3628–3640 ª 2009 The Authors Journal compilation ª 2009 FEBS 3629 stability and quadruplex ⁄ duplex transition, we used four sequences with 4, 6, 8 or 12 bases on either side of the 21-base naturally occurring c-kit quadruplex- forming sequence (Table 1). The structural topology of the c-kit quadruplex sequences (c-kitG0, c-kitG4, c- kitG6, c-kitG8 and c-kitG12) was characterized as parallel or anti-parallel using CD in the presence of 100 mm KCl, although CD only provides an indication of the presence of any secondary structure rather than a confirmation. Figure 2 (black squares) shows the CD spectra obtained for the various sequences. We observed a positive band at around 262 nm and a negative band near 240 nm, suggesting the presence of a quadruplex signature characteristic of the parallel conformation [51] in the G-rich sequences c-kitG0, c-kitG4 and c-kitG6 (Fig. 2A–C, black squares). This observation is in agree- ment with a reported NMR study on the structural conformation of the c-kit quadruplex [48]. For c-kitG8, two positive peaks at 265 and 286 nm and a negative peak at 240 nm were observed (Fig. 2D, black squares). Moreover, unlike the G-rich sequences c-kitG0, c-kitG4 and c-kitG6, a broad positive CD signal ranging from 250 to 290 nm and a negative peak at 233 nm were observed in the CD spectrum of c-kitG12 (Fig. 2E, black squares). Thus, the CD spectra of c-kitG8 and c-kitG12 showed the presence of secondary structures other than quadruplex. TDS complement CD as a tool for the structural characterization of nucleic acids in solution. TDS pro- vide a simple, inexpensive and rapid method to obtain structural insight into nucleic acid structures, and may be used for both DNA and RNA from short oligomers to polynucleotides [52]. Figure 3 shows TDS for c-kitG0, c-kitG4, c-kitG6, c-kitG8 and c-kitG12 seq- uences. The TDS for c-kitG0, c-kitG4, c-kitG6 showed two positive maxima at 245 and 270 nm, a shoulder at 255 nm, and a negative minimum at 295 nm, thus exhibiting the presence of quadruplex structure. How- ever, the TDS for c-kitG8 and c-kitG12 sequences showed loss of both the positive peak at 245 nm and the negative peak at 295 nm that are characteristic of G-quadruplex structure. The presence of a positive peak at 270 nm in the TDS of the c-kitG8 and c-kitG12 sequences indicated the presence of a Watson–Crick duplex-like structure as shown in Fig. 3. The TDS data presented here are in agreement with previously reported TDS data for G-quadruplexes and GC-rich duplexes [52]. The TDS analysis thus supports the exis- tence of G-quartets in c-kitG0, c-kitG4 and c- kitG6 and the absence of Hoogsteen-bonded G-quartets in c-kitG8 and c-kitG12. The presence of non-Hoogsteen- bonded multiple structures in c-kitG8 and c-kitG12 as shown by TDS prompted us to perform UV melting of c-kitG0, c-kitG4, c-kitG6, c-kitG8 and c-kitG12 sequences at 260 nm in 100 mm KCl (Fig. S1). The c-kitG8 and c-kitG12 sequences showed considerable hyperchromic effects in the range 10–12%, while c-kitG0, c-kitG4 and c-kitG6 showed only 2–6% hyper- chromicity at 260 nm. The presence of 10–12% of hyperchromicity at 260 nm for c-kitG8 and c-kitG12 also resulted from disruption of Watson–Crick base pairing in the secondary structure (Fig. S1). mFOLD analysis [53] also indicated the presence of stem-loop structures with Watson–Crick base pairing in the stem region in c-kitG8 and c-kitG12, and thus supported the absence of Hoogsteen-bonded G-quartets (Fig. S2). Together, these data clearly indicate that the G-rich c-kit sequence with 8 and 12 flanking bases can adopt a Watson–Crick duplex-like ‘stem-loop’ structure, and thus lose the ability to form prominent quadruplex structure, unlike the c-kitG0, c-kitG4 and c-kitG6 sequences. Figure S2 shows the topology of the parallel G-quadruplex formation for c-kitG0, c-kitG4 and Table 1. Quadruplexes with various flank lengths and their respective complementary strand sequences used in this study. G0 and C0 are the core c-kit quadruplex-forming sequence and its complementary strand sequence, respectively. G4–G12 and C4–C12 indicate the number of bases 5¢ and 3¢ to the core c-kit quadruplex-forming sequences and their respective complementary strand sequences. Oligo name Oligonucleotide sequence (5¢-to3¢) Number of flanking bases c-kitG0 GGGAGGGCGCTGGGAGGAGGG 0 c-kitC0 CCCTCCTCCCAGCGCCCTCCC 0 c-kitG4 CAGAGGGAGGGCGCTGGGAGGAGGGGCTG 4 c-kitC4 CAGCCCCTCCTCCCAGCGCCCTCCCTCTG 4 c-kitG6 CGCAGAGGGAGGGCGCTGGGAGGAGGGGCTGCT 6 c-kitC6 AGCAGCCCCTCCTCCCAGCGCCCTCCCTCTGCG 6 c-kitG8 CGCGCAGAGGGAGGGCGCTGGGAGGAGGGGCTGCTGC 8 c-kitC8 GCAGCAGCCCCTCCTCCCAGCGCCCTCCCTCTGCGCG 8 c-kitG12 CCGGCGCGCAGAGGGAGGGCGCTGGGAGGAGGGGCTGCTGCTCGC 12 c-kitC12 GCGAGCAGCAGCCCCTCCTCCCAGCGCCCTCCCTCTGCGCGCCGG 12 Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition A. Arora et al. 3630 FEBS Journal 276 (2009) 3628–3640 ª 2009 The Authors Journal compilation ª 2009 FEBS c-kitG6 and predicted secondary structures for c-kitG8 and c-kitG12. We wish to highlight that the c-kitG8 sequence can adopt a Watson–Crick duplex-like ‘stem- loop’ structure together with G-quadruplex structure in KCl buffer. The contribution of two different secondary structure populations is quite evident from the CD spectrum (Fig. 2) and the hypochromic (Fig. 4) and hyperchromic transitions (Fig. S1) obtained from UV melting at 295 and 260 nm, respectively. Our next aim was to determine the effect of increasing the flank length on the thermodynamic stability of formation of secondary structures. We have used a spectroscopic method to obtain thermal denaturation ⁄ renaturation profiles to detect G-quartet formation [54]. The thermal denaturation ⁄ renaturation profiles for c-kitG0, c-kitG4 and c-kitG6 were charac- terized by a clear and reversible transition, such that melting and annealing curves were super-imposable (Fig. 4A–C). For c-kitG8, the melting and annealing curves showed considerable hysteresis (Fig. 4D), and c-kitG12 showed no clear transition at 295 nm, sug- gesting the absence of stable G-quartets (Fig. 4E). The T m values for the c-kitG0, c-kitG4 and c-kitG6 sequences were calculated as shown in Table 2. The midpoints of the melting transition (T melt ) and the annealing transition (T anneal ) were also calculated for A B C D E Fig. 2. CD spectra of preformed quadru- plexes with various flank lengths in the absence (black squares) and presence (white squares) of equimolar concentrations of corresponding complementary strands for (A) c-kitG0, (B) c-kitG4, (C) c-kitG6, (D) c-kitG8 and (E) c-kitG12 in 10 m M sodium cacodylate buffer with 100 m M KCl, pH 7.0, at 25 °C. A. Arora et al. Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition FEBS Journal 276 (2009) 3628–3640 ª 2009 The Authors Journal compilation ª 2009 FEBS 3631 c-kitG8, and are also shown in Table 2. The T m val- ues for c-kitG0, c-kitG4 and c-kitG6 were 60, 55 and 51 °C, respectively. The T melt and T anneal values for c-kitG8 were 50 and 47 °C, respectively, and were accompanied by considerable hysteresis. No melt- ing ⁄ annealing transition was observed for the c-kitG12 sequence at 295 nm. This observation sug- gested that increasing the flank length led to a decrease in the T m value that reflects the reduced ther- mal stability (Table 2). The various thermodynamic parameters are summarized in Table 2. The thermody- namic parameters DG vH , DH vH and DS vH were not determined for c-kitG8 and c-kitG12 due to the hys- teresis in c-kitG8 and the lack of a clear transition at 295 nm for c-kitG12. DH vH increases with the increase in flank length from 0 to 6 bases. This increase in the enthalpy change (DH vH ) may be due to the increase in the base-stacking interaction among the flanking bases. A striking observation was the high increase in the unfavorable negative entropy change DS vH , which resulted in a decrease in the overall free energy change (DG vH ). The decrease in entropy upon increase in flank length arises due to the intra-residue stacking interaction in the flank bases. Furthermore, we also performed concentration-dependent melting of all the sequences to deduce the molecularity of the structures. The sequences formed intramolecular structures as suggested by the concentration-independent thermal stability (T m ) (data not shown). Overall, the results indicated that quadruplex formation becomes less favorable with the increase in flank length on each side of the core c-kit quadruplex sequence (Table 2). Fig. 3. Thermal difference spectrum of c-kitG0 (black squares), c-kitG4 (open squares), c-kitG6 (open circles), c-kitG8 (open triangles) and c-kitG12 (open diamonds) resulting from subtraction of the spectrum obtained at 25 °C from that obtained at 90 °Cin 10 m M sodium caodylate buffer with 100 mM KCl, pH 7.0. A B C D E Fig. 4. UV melting (open triangles) and annealing (open diamonds) profiles of preformed c-kit quadruplex with various flank lengths: (A) c-kitG0, (B) c-kit G4, (C) c-kitG6, (D) c-kitG8 and (E) c-kitG12 in 10 m M sodium cacodylate buffer, pH 7.0, with 100 mM KCl. Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition A. Arora et al. 3632 FEBS Journal 276 (2009) 3628–3640 ª 2009 The Authors Journal compilation ª 2009 FEBS As the quadruplex-forming region does not occur in isolation, but instead is flanked by other sequences and is present together with its complementary strand, it is imperative to analyze the effect of these neighbor- ing sequences on the quadruplex ⁄ duplex equilibrium also. In order to assess the influence of flanking bases on the quadruplex ⁄ duplex equilibrium, we investigated the CD spectral changes on addition of corresponding complementary strand to preformed quadruplex in KCl buffer. The CD spectra are shown in Fig. 2 (white squares). For c-kitG0, c-kitG4 and c-kitG6, CD spec- tra recorded for equimolar concentrations of quadru- plex and its respective complementary strand showed a positive peak at 270 nm coupled with an increase in the intensity of bands at 240 nm (Fig. 2A–C, white squares). These spectral features are characteristic of the B-DNA form, and suggest the formation of duplex when complementary strands are added to a quadru- plex. However, they do not confirm complete duplex formation for equimolar mixtures of preformed quad- ruplex and its complementary strand in 100 mm KCl buffer. For the c-kitG8 ⁄ C8 system, a small positive peak at 270 nm together with a more intense positive band at 286 nm coupled with an increase in the inten- sity of the negative band at 240 nm was observed (Fig. 2D, white squares). A broad positive CD band at 286 nm together with negative CD band at 240 nm for c-kitG12 ⁄ C12 indicates that there is no change in the CD spectrum of c-kitG12 when incubated with its complementary strand (c-kitC12) in 1 : 1 ratio (Fig. 2E, white squares). These observations for c-kitG8 ⁄ C8 and c-kitG12 ⁄ C12 can be ascribed to the presence of multiple secondary structures in both the G-rich as well as in the C-rich complementary strands as discussed below. Next, to assess the competition between the quadru- plex and duplex forms under the influence of increas- ing flank lengths, fluorescence binding experiments were performed using a donor ⁄ quencher pair of 5¢-fluorescein (donor) and 3¢-dabsyl chloride (quencher). This technique was chosen because it offers the advantage of working in the nanomolar range, which is not possible with UV or CD. FRET-based studies have also been used effectively to understand quadruplex structures [37,38,55–57]. Complementary strands of respective flank lengths were used for hybridization with fluorophore-labeled sequences. We investigated the binding affinity of complementary strands to preformed quadruplexes with various flank lengths of 0–12 bases in KCl. We observed enhance- ment of fluorescence intensity on increasing the con- centration of the complementary strand, indicative of a greater extent of quadruplex opening. The normalized relative changes in fluorescence intensity were plotted against the complementary strand concentration (Fig. 5), and the binding affinities were calculated by fitting the plots using Eqn (8), as described in Experi- mental procedures. The estimated binding affinities are summarized in Table 3. The binding affinity value for the complementary strands towards the preformed G-quadruplexes with various flank lengths increased with the increase in the flank length from c-kitG0 to c-kitG6 (Table 3). The K A value obtained for c-kitG8 ⁄ C8 was same as that for c-kitG6 ⁄ C6, and was decreased for c-kitG12 ⁄ C12 (Table 3). To complement the fluorescence studies, ITC experi- ments were performed to obtain the complete thermo- dynamic profile for quadruplex hybridization to its complementary strand. The hybridization event was dependent on nearest-neighbor Watson–Crick base pairing. Figure 6 shows characteristic sigmoidal curves obtained for heat of injection for hybridization of preformed quadruplex to its complementary strand. Table 4 summarizes the thermodynamic parameters for the duplex formation obtained from ITC experiments. The heat of injection profile for duplex formation is exothermic. The magnitude of negative DH ITC reflects Table 2. Thermodynamic parameters obtained from UV experiments performed in 10 mM sodium cacodylate buffer, 100 mM KCl at pH 7.0 and 25 °C. T m is the melting temperature. DH vH is the enthalpy change and DS vH is the entropy change for G-quadruplex formation. DG vH is the free energy change for G-quadruplex formation. All parameters were calculated as described in Experimental procedures. All the parameters obtained were within 10% error. T m values differed by ± 1.0 °C. ND indicates that values were not determined for c-kitG8 and c-kitG12. Quadruplex T m (°C) DH vH (kcalÆmol )1 ) DS vH (calÆmol )1 ÆK )1 ) DG vH (kcalÆmol )1 )Melting Annealing c-kitG0 60.0 60.0 )49.0 ± 5.0 )146.0 ± 15.0 )5.5 ± 0.6 c-kitG4 55.0 55.0 )52.5 ± 5.0 )160.0 ± 16.0 )4.8 ± 0.5 c-kitG6 51.0 51.0 )57.5 ± 6.0 )178.0 ± 18.0 )4.5 ± 0.5 c-kitG8 50.0 47.0 ND ND ND c-kitG12 ND ND ND ND ND A. Arora et al. Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition FEBS Journal 276 (2009) 3628–3640 ª 2009 The Authors Journal compilation ª 2009 FEBS 3633 the binding enthalpy for duplex formation, which increased with the increase in the number of flanking bases from 0 to 6, and deviation from the increasing DH ITC trend was observed for c-kitG8 and c-kitG12, as shown in Table 4. The DH values obtained from ITC experiments were much lower than the expected value for duplex formation in all cases, i.e. )166.30 kcalÆmol )1 for c-kitG0 ⁄ C0, )232.70 kcalÆmol )1 for c-kitG4 ⁄ C4, )268.50 kcalÆmol )1 for c-kitG6 ⁄ C6, )309.40 kcalÆmol )1 for c-kitG8 ⁄ C8 and )382.20 kcalÆ mol )1 for c-kitG12 ⁄ C12, obtained using the nearest- neighbor method [58]. The enthalpy change in this process involves endothermic and exothermic contribu- tions from opening up of the preformed quadruplex and hybridization between G- and C-rich strands, respectively. The overall enthalpy change is the sum of the contribution from each process, leading to a lower DH ITC value than calculated using the nearest-neighbor method. The DS ITC for duplex formation decreased with the increase in the number of flanking bases from 0 to 6. However, there was deviation from the decreas- ing DS ITC values for c-kitG8 and c-kitG12 as shown in Table 4. A detailed inspection of Table 4 reveals that the DH ITC values as well as the DG ITC values for c-kitG8 ⁄ C8 and c-kitG12 ⁄ C12 deviate from the increas- ing trend as observed for c-kitG0 ⁄ C0, c-kitG4 ⁄ C4 and c-kitG6 ⁄ C6. As shown by TDS, UV hyperchromic tran- sition at 260 nm and mFOLD analysis, the G-rich strands of c-kitG8 and c-kitG12 can adopt intra- molecular stem-loop structure with Watson–Crick base pairing in the stem region. Likewise, the C-rich comple- mentary strand can also form such stem-loop structures. Moreover, the C-rich complementary strand also has the potential to form a secondary structure called an i-motif in all the sequences ranging from c-kitC0 to c-kitC12 at near physiological pH 7.0 [59], although these structures would be less stable, at physiological pH as compared to acidic pH, as it has been shown that intercalated hemiprotonated C:C + base pairs are stable at acidic pH [60,61,62]. To understand the structure Table 3. Binding affinities (K A ) of quadruplex with complementary strands obtained from fluorescence studies in 10 m M sodium caco- dylate buffer with 100 m M KCl, pH 7.0 at 25 °C. The quadruplex concentration used was 50 n M and the respective complementary strand concentration varied from 0 to 1 l M. The values obtained were within 10% error. Duplex K A (M )1 ) c-kitG0 ⁄ C0 4.0 ± 0.4 · 10 6 c-kitG4 ⁄ C4 8.0 ± 0.9 · 10 6 c-kitG6 ⁄ C6 3.2 ± 0.3 · 10 7 c-kitG8 ⁄ C8 3.0 ± 0.2 · 10 7 c-kitG12 ⁄ C12 2.5 ± 0.3 · 10 6 Fig. 6. ITC binding profile of equimolar mixtures of c-kitG0 (black square), c-kitG4 (open square), c-kitG6 (open circle), c-kitG8 (open triangle) and c-kitG12 (open diamond) preformed quadruplex sequences with corresponding complementary strands in 10 m M sodium caodylate buffer with 100 mM KCl, pH 7.0, at 25 °C. Fig. 5. Plots of normalized relative fluorescence emission intensity (DF, as described in the text) of quadruplex (30 n M) at 520 nm ver- sus complementary strand concentration in 10 m M sodium caody- late buffer with 100 m M KCl, pH 7.0, at 25 °C. The complementary strands used were c-kitC0 (black square), c-kitC4 (open square), c-kitC6 (open circle), c-kitC8 (open triangle) and c-kitC12 (open diamond). Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition A. Arora et al. 3634 FEBS Journal 276 (2009) 3628–3640 ª 2009 The Authors Journal compilation ª 2009 FEBS adopted by c-kit C-rich strands, we performed CD stud- ies (Fig. S3) and UV melting studies at 287 and 265 nm (Fig. S4) at both pH 6.0 and 7.0. Both CD and UV melting studies showed that the C-rich strands c-kitC0, c-kitC4 and c-kitC6 adopt i-motif structure at pH 6.0, but no such structure formation takes place at pH 7.0. Moreover, c-kitC8 and c-kitC12 did not show the i-motif structure signature; instead, the UV melting profiles at 265 nm for c-kitC8 and c-kitC12 showed $ 10% hyperchromicity, thus indicating the presence of an intramolecular stem–loop structure at both pH 6.0 and 7.0 (Fig. S4). The sum of the CD spectra for both the G- and C-rich individual strands (Fig. S5) was also found to be similar to the CD spectra of mixtures of both the strands at pH 7.0 as shown in Fig. 2. Furthermore, to understand the contribution of i-motif structures in quadruplex ⁄ Watson–Crick duplex competition, we also performed ITC titrations at pH 6.0 (Fig. S6), and data are presented in Table S1. ITC experiments at pH 6.0 showed that the binding affinity of c-kitC4 and c-kitC6 strands to their respective G-rich strands decreases almost by one order of magnitude (Fig. S6 and Table S1) compared to the affinity at pH 7.0 (Table 4), but G0 sequences remained unopened in the presence of respective complementary c-kitC0 strands (Fig. S6). However, ITC titration data for the c-kitG8 ⁄ C8 and c-kitG12 ⁄ C12 system remain unaffected and similar at both pH 6.0 and 7.0 (Fig. S6 and Table S1). This rules out the possibility of a significant contribution of i-motif structures in c-kit C-rich strands to quadruplex ⁄ Watson–Crick duplex competition at physiological pH 7.0. Together, the results obtained from CD, fluorescence and ITC titration experiments in the c-kitG8 ⁄ C8 and c-kitG12 ⁄ C12 systems demonstrate that structural com- petition is imposed by the intramolecular stem–loop structure in C-rich complementary strand, thus affecting the quadruplex ⁄ Watson–Crick duplex equilibria at both pH 7.0 and the near physiological pH of 6.0. The pres- ence of intramolecular stem–loop structures in the C-rich complementary strand leads to the existence of competition and thus hinders opening of the secondary structures in c-kitG8 and c-kitG12 G-rich sequences. These observations indicate that the increase in flank length from 0 to 6 on each side of the c-kit core quadru- plex-forming sequence drives efficient invasion and bet- ter conversion of quadruplex to duplex, and competes out quadruplex in this structural competitive equilib- rium. However, this is not the case for flank lengths of 8 and 12 due to the presence of intramolecular stem–loop structures in both the G-rich and C-rich strands. The parameter that highlights the predominance of either of population (duplex or quadruplex) is the rela- tive free energy difference, DDG 25 °C , between duplex and quadruplex structures. In this study, we have obtained thermodynamic profiles of quadruplexes by UV melting experiments. However, it was difficult to obtain the thermodynamic parameters involved in duplex formation from the same sequences and their respective complementary strands by UV melting stud- ies, as this includes contributions from both duplex and quadruplex. Therefore, we obtained the thermo- dynamic profile for duplexes from ITC experiments (Table 4). The relative free energy difference, DDG 25 °C , between duplex and quadruplex structure increase from )3.3 to )5.6 kcalÆmol )1 upon an increase in flank length from 0 to 6. It is noteworthy that DDG 25 °C val- ues are reasonably negative in all cases, indicating that duplex is the predominant structure. We also observed an increase in duplex stability upon an increase in flank length (Table 4). The greater the negative magni- tude of DDG 25 °C , the higher is the predominance of duplex at equilibrium. Table 4. Thermodynamic parameters obtained from ITC experiments performed in 10 mM sodium cacodylate buffer, pH 7.0, 100 mM KCl at 25 °C. Thermodynamic parameters were obtained for complementary strand binding to the preformed quadruplexes at 25 °C. The quadru- plex concentration in the cell was 5–10 l M and the complementary strand concentration in the syringe was 100–250 lM. N is the stoichiom- etry of complementary strand binding to preformed quadruplex. DH ITC is the enthalpy change and DS ITC is the entropy change for duplex formation. DG ITC is the free energy change for duplex formation and was determined using the relationship DG = )RT ln K A , where R is the universal gas constant, T is the temperature in Kelvin (K), and K A is the binding affinity for duplex formation. All the parameters obtained were within 10% error. Duplex N K A (10 6 M )1 ) DH ITC (kcalÆmol )1 ) DS ITC (calÆmol )1 ÆK )1 ) DG ITC (kcalÆmol )1 ) c-kitG0 ⁄ C0 0.6 3.2(± 0.3) )23.0(± 2.0) )47.5(± 5.0) )8.8(± 0.9) c-kitG4 ⁄ C4 0.7 7.0(± 0.6) )47.0(± 5.0) )126.5(± 12.0) )9.3(± 0.9) c-kitG6 ⁄ C6 0.6 28(± 2.5) )92.0(± 9.0) )274.8(± 27.0) )10.1(± 1.0) c-kitG8 ⁄ C8 0.6 27(± 3.0) )94.0(± 9.2) )281.6(± 28.0) )10.1(± 1.0) c-kitG12 ⁄ C12 0.8 2.5(± 0.3) )66.0(± 6.0) )192.3(± 19.2) )8.7(± 0.9) A. Arora et al. Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition FEBS Journal 276 (2009) 3628–3640 ª 2009 The Authors Journal compilation ª 2009 FEBS 3635 Based on a search algorithm designed by Huppert and Balasubramanian [11], it has been predicted that, in principle, as many as 376 000 quadruplexes could exist in the human genome. However, our study suggests a lower likelihood of quadruplex formation at all these sites, as the presence of flanking bases on each side of the c-kit core quadruplex sequence destabilizes the quadruplex structure. Furthermore, an increase in the number of flanking bases leads to the existence of alternative structures other than quadruplexes. In the genome, these sites will have many more bases flanking them than used in our studies, casting doubt on the global presence of quadruplex structures with a general role in the bio- logical system. On the other hand, several studies have indicated the existence of quadruplexes in vivo [63] and their ability to regulate gene expression [12– 14]. Their significant role in the telomeric region has also been well established [2,5,42–44]. Further indica- tions of the presence of quadruplexes in the living system come from the fact that cells contain factors that actively cleave and unwind G4 DNA [25]. It thus seems apparent that cells may have some mech- anism(s) that favors formation of either quadruplexes or duplexes according to their biological relevance, thus suggesting the importance of the quadru- plex ⁄ duplex equilibrium in modulating biological activities. Conclusion In the present study, we have explored the effect of flanking sequences on quadruplex stability and quadru- plex ⁄ duplex competition in order to understand the likely scenario in the cell, where quadruplex sites have additional sequences at both their ends. The study shows that the presence of flanking bases affects the thermodynamic stability of the G-quadruplex. With an increase in the flank length, the increase in the more favorable negative enthalpy change (DH vH ) is accom- panied by an increase in the unfavorable negative entropy change (DS vH ), resulting in a decrease in the overall free energy change (DG vH ). The study also shows that, with the increase in the number of flanking bases, there is an increased propensity for the existence of other alternative structures that may compete with G-quadruplex formation. Our work shows that the presence of flanks destabilizes the G-quadruplex struc- ture and drives the equilibrium towards duplex forma- tion. If this is indeed the case, the probability of the existence of these structures as global regulatory motif in the genome, prima facie, appears to be context- dependent. Experimental procedures Materials Oligonucleotides were obtained from Microsynth (Balgach, Switzerland). The sequences of the oligonucleotides used in these studies are given in Table 1. c-kitG0, c-kitG4, c-kitG6, c-kitG8 and c-kitG12 represent the c-kit quadru- plex sequence with various flank lengths, and c-kitC0, c-kitC4, c-kitC6, c-kitC8 and c-kitC12 represent their respective complementary strands (Table 1). All the sequences containing core quadruplex-forming motifs with varying flank lengths used in our study were labeled using the fluorophores 5¢-fluorescein and 3¢-dabsyl chloride. The concentrations of unlabeled oligonucleotide solutions were determined based on the absorbance at 260 nm and 80 °C using molar extinction coefficients of 213, 290, 321, 354 and 419 mm )1 Æcm )1 for c-kitG0, c-kitG4, c-kitG6, c-kitG8 and c-kitG12, respectively, and 164, 234, 275, 308 and 382 mm )1 Æcm )1 for c-kitC0, c-kitC4, c-kitC6, c-kitC8 and c-kitC12, respectively. These values were calculated by extrapolation of tabulated values for the dimers and monomer bases at 25–80 °C using procedures described previously [64,65]. Concentrations of the labeled oligonu- cleotide were determined by measuring the absorbance of the attached fluorescein moiety at 496 nm using a molar extinction coefficient of 4.1 · 10 4 m )1 Æcm )1 [66]. In all studies, we used preformed quadruplexes obtained by heating solutions containing G-rich sequences in 100 mm KCl to 100 °C for 5 min and gradually cooling to room temperature at the rate of 0.2 °CÆmin )1 , and then kept for 7 days at 4 °C prior to experimentation. Circular dichroism spectroscopy CD spectra were measured using a Jasco model J-715 spec- tropolarimeter (Jasco, Tokyo, Japan) equipped with a ther- moelectrically controlled cell holder and a cuvette with a path length of 1 cm. Scans were performed over a range of 200–350 nm in 10 mm sodium cacodylate buffer (pH 7.0) with 100 mm KCl at 25 °C. Preformed G-quadruplexes with various flank lengths were incubated with equimolar concen- trations of respective flank length at 25 °C for 24 h prior to CD experiments. The spectra of preformed quadruplexes at a concentration of 7.5 lm in the absence and presence of equi- molar concentrations of the complementary strand were obtained. A buffer baseline spectrum was obtained using the same cuvette and subtracted from sample spectra. Thermal difference spectrum For each oligonucleotide sample, an UV spectrum was recorded above and below its melting temperature (T m ). The difference between the UV spectrum at high temperature Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition A. Arora et al. 3636 FEBS Journal 276 (2009) 3628–3640 ª 2009 The Authors Journal compilation ª 2009 FEBS (95 °C) and the UV spectrum at low temperature (25 °C) is defined as the TDS, and represents the spectral difference between the unfolded and the folded form. The TDS were normalized, using a value of +1 for the highest positive peak. Thermal denaturation/renaturation using UV-visible spectroscopy Oligonucleotides were dissolved in 10 mm sodium cacodylate buffer pH 7.0 with 100 mm KCl at final concentrations rang- ing from 2 to 10 lm, depending on the oligonucleotide length. Samples (1 ml) were placed in a stoppered quartz cuvette of 1 cm path length, and then thermal denatur- ation ⁄ renaturation was performed using a Cary 100 UV ⁄ vis- ible spectrophotometer (Varian, Walnut Creek, CA, USA) equipped with a Peltier effect heated cuvette holder. A tem- perature range of 25–95 °C was used to monitor the absor- bance at 295 nm at a heating ⁄ cooling rate of 0.2 °CÆmin )1 . The absorbance profiles recorded at 295 nm were analyzed using a non-linear least-squares curve-fitting method. This method involved contributions from pre- and post-transition baselines, and thermodynamic data were obtained using equations described previously [67,68]. The analysis was performed using mathematica 5.1 (Wolfram Research, Champaign, IL, USA) and origin 7.0 (Microcal Inc., Northampton, MA, USA). The following equations were used to calculate the thermodynamic data: A u ¼ b u þ m u à TðÞ ð1Þ A l ¼ b l þ m l à TðÞ ð2Þ K eq ¼ ð1 À aÞ a ð3Þ AðTÞ¼a à ðA u À A l ÞþA l ð4Þ K eq ¼ exp DG o RT  ¼ exp DH o RT þ DS o R  ð5Þ Equations 1 and 2 are linear equations where A u and A l are terms describing upper and lower baselines, respectively, b u and b l are fitted parameters for the intercepts for the upper and lower baseline, and m u and m l are the respective slopes. K eq is the equilibrium constant for the unstruc- tured ⁄ structured transition for an intramolecular system, and a is the folded fraction. A (T) is the dependent variable and is the experimentally determined absorbance at each temperature (T). Using these equations, the van’t Hoff enthalpy (DH vH ) and entropy (DS vH ) were calculated, and T m was calculated from the peak value of the first deriva- tive of the fitted curve. Tm values differed by ± 1.0 °C. The Gibbs free energy (DG vH ) was calculated at 25 °C using the equation DG vH = DH vH ) TDS vH , assuming DCp =0. Fluorescence studies A FLUOstar OPTIMA fluorescence plate reader (BMG Lab technologies, Melbourne, Australia) was used to deter- mine the binding affinities of fluorophore-labeled c-kitG0, c-kitG4, c-kitG6, c-kitG8 and c-kitG12 to their respective complementary strands (sequences given in Table 1) in the presence of 100 mm KCl. The plate reader makes it possi- ble to work on systems that suffer from thermodynamic and kinetic inertia, thus requiring prolonged incubation, and enables study of many samples at dilute concentration [38]. The experiments were performed in 384-well plates, using 480 nm excitation and 520 nm emission filters. The wells were loaded with solutions of a fixed concentration of preformed quadruplex (50 nm) and increasing concentra- tions of complementary strand (0–1 lm). Sample mixtures were incubated for 24 h at 25 °C, and the plate was read at 520 nm. For analysis of data, the observed fluorescence intensity was considered as the sum of the weighted contri- butions from folded G-quadruplex strand and extended G-strand in the duplex form: F ¼ 1 À a b ðÞF 0 þ a b F b ð6Þ where F is the observed fluorescence intensity at each titrant concentration, F 0 and F b are the fluorescence intensi- ties of the initial and final states of titration, respectively, and a b is the mole fraction of quadruplex in duplex form. Assuming 1 : 1 stoichiometry for the interaction involving complementary strand binding, it can be shown that: Q½ 0 a 2 b À Q½ 0 þ C½þ1 = K A ÀÁ a b þ C½¼0 ð7Þ where K A is the association constant, [Q] 0 is the total G-strand concentration, and [C] is the complementary strand concentration. From Eqns (6) and (7), it can be shown that: DF ¼ DF max = 2 Q 0 ½ðÞQ½ 0 þ C½þ1 = K A ÀÁ & À ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi Q½ 0 þ C½þ1 = K A ÀÁ 2 À4 Q½ 0 C½ q ' ð8Þ where DF = F ) F 0 and DF max = F max ) F 0 . Isothermal titration calorimetry experiment The ITC experiment was performed using a Microcal VP-ITC titration calorimeter. The 300 ll syringe was filled with 146 lm of complementary strand. Titration was per- formed by injecting 10 ll aliquots of complementary strand A. Arora et al. Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition FEBS Journal 276 (2009) 3628–3640 ª 2009 The Authors Journal compilation ª 2009 FEBS 3637 [...].. .Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition into the cell containing 10 lm of preformed quadruplex at 8 min intervals at 25 °C, and complete mixing was accomplished by stirring with the syringe paddle at 300 r.p.m Titration curves were corrected for heat of dilution by injecting the complementary oligonucleotide into 10 mm sodium cacodylate buffer at pH 6.0 and. .. 2009 The Authors Journal compilation ª 2009 FEBS A Arora et al Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition 24 Sun D, Guo K, Rusche JJ & Hurley LH (2005) Facilitation of a structural transition in the polypurine ⁄ polypyrimidine tract within the proximal promoter region of the human VEGF gene by the presence of potassium and G -quadruplex- interactive agents Nucleic... Tetraplex DNA and its interacting proteins Front Biosci 12, 4336–4351 26 Kumar N & Maiti S (2004) Quadruplex to Watson– Crick duplex transition of the thrombin binding aptamer: a fluorescence resonance energy transfer study Biochem Biophys Res Commun 319, 759–767 27 Hardin CC, Watson T, Corregan M & Bailey C (1992) Cation dependent transition between the quadruplex and Watson–Crick hairpin forms of d(CGCG3GCG)... polymorphism of telomere DNA: interquadruplex and duplex quadruplex conversions probed by Raman spectroscopy Biochemistry 33, 7848–7856 29 Deng H & Braunlin WH (1995) Duplex to quadruplex equilibrium of the self-complementary oligonucleotide d(GGGGCCCC) Biopolymers 35, 677–681 30 Halder K, Mathur V, Chugh D, Verma A & Chowdhury S (2005) Quadruplex duplex competition in the nuclease hypersensitive element of. .. Balasubramanian S & Neidle S (2005) Highly prevalent putative quadruplex formation within the c-kit oncogene J Am Chem Soc 127, 10584–10589 17 Cogoi S & Xodo LE (2006) G -quadruplex formation within the promoter of the KRAS proto-oncogene and its effect on transcription Nucleic Acids Res 34, 2536–2549 18 Xu Y & Sugiyama H (2006) Formation of the G -quadruplex and i-motif structures in retinoblastoma susceptibility... of the thrombin aptamer into a G -quadruplex with Sr2+: stability, heat, and hydration J Am Chem Soc 123, 10799–10804 4 Olsen CM, Gmeiner WH & Marky LA (2006) Unfolding of G-quadruplexes: energetic, and ion and water contributions of G-quartet stacking J Phys Chem B 110, 6962–6969 5 Gomez D, Lemarteleur T, Lacroix L, Mailliet P, Mergny JL & Riou JF (2004) Telomerase downregulation induced by the G -quadruplex. .. bases on quadruplex stability and Watson–Crick duplex competition 52 Mergny JL, Li J, Lacroix L, Amrane S & Chaires JB (2005) Thermal difference spectra: a specific signature for nucleic acid structures Nucleic Acids Res 33, e138 53 Walter AE, Turner DH, Kim J, Lyttle MH, Muller P, Mathews DH & Zuker M (1994) Coaxial stacking of helixes enhances binding of oligoribonucleotides and improves predictions... element of human c-myc promoter: C to T mutation in C-rich strand enhances duplex association Biochem Biophys Res Commun 327, 49–56 31 Datta B & Armitage BA (2001) Hybridization of PNA to structured DNA targets: quadruplex invasion and the overhang effect J Am Chem Soc 123, 9612– 9619 32 Phan AT & Mergny JL (2002) Human telomeric DNA: G -quadruplex, i-motif and Watson–Crick double helix Nucleic Acids Res... quadruplex ⁄ Watson– Crick duplex equilibrium J Phys Chem B 111, 12328–12337 Kumar N, Sahoo B, Varun KA, Maiti S & Maiti S (2008) Effect of loop length variation on quadruplex Watson Crick duplex competition Nucleic Acids Res 13, 4433–4442 Phan AT, Kuryavyi V, Luu KN & Patel DJ (2007) Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution Nucleic Acids... Prevalence of quadruplexes in the human genome Nucleic Acids Res 33, 2908–2916 12 Simonsson T, Pecinka P & Kubista M (1998) DNA tetraplex formation in the control region of c-myc Nucleic Acids Res 26, 1167–1172 13 Simonsson T & Henriksson M (2002) c-myc suppression in Burkitt’s lymphoma cells Biochem Biophys Res Commun 290, 11–15 14 Jain AS, Grand CL, Bearss DJ & Hurley LH (2002) Direct evidence for a G-quadruplex . quadruplex conformation and stability has been well investigated in the past, but the effect of flanking bases on quadruplex stability and Watson–Crick duplex competition. Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition Amit Arora, Divya R. Nair and Souvik Maiti Proteomics and Structural