Báo cáo khoa học: Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition pptx

13 589 0
  • Loading ...
    Loading ...
    Loading ...

Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống

Tài liệu liên quan

Thông tin tài liệu

Ngày đăng: 07/03/2014, 02:20

Effect of flanking bases on quadruplex stabilityand Watson–Crick duplex competitionAmit Arora, Divya R. Nair and Souvik MaitiProteomics and Structural Biology Unit, Institute of Genomics and Integrative Biology, Council for Scientific and Industrial Research (CSIR),Mall Road, Delhi, IndiaG-quadruplexes are unique secondary structuresformed by inter- or intramolecular association of guan-ine-rich nucleic acid sequences in the presence of metalions [1–10]. A genome-wide search showed that asmany as 376 000 potential quadruplexes could exist inthe functionally important regions of genes [11]. Thebiological significance of G-quadruplexes is furtherhighlighted by their presence in the promoter regionsof the c-myc [12–15], c-kit [16], k-ras [17] and Rb [18]genes, the immunoglobin switch region [19], insulinregulatory sequences [20], the fragile X gene [21], thecystatin B promoter [22], the Hif-1a promoter [23] andthe proximal promoter of the VEGF gene [24]. Thepossible existence and roles of G-quadruplexes in vivohave been corroborated by the detection of proteinsthat bind specifically to G-quadruplexes and proteinsthat have biological activities, such as helicases andnucleases, that are specific for G-quadruplexes [25].In the cellular environment, G-rich sequences areflanked by other bases and are present with theircomplementary strands, leading to a dynamic equilib-rium between quadruplex and duplex structures [26].Depending on the cellular requirements, this equi-librium favors either quadruplex or Watson–Crickduplex formation for execution of their respectivebiological functions. Studies have been performed toelucidate the role of various factors in guiding thedirection of the equilibrium [27–37]. Previous studieshave mostly assessed the significance of changes in theintracellular environment in terms of pH, the presenceof cations, temperature and molecular crowding onthe quadruplex to duplex transition. It has beenKeywordsc-kit; equilibrium; flank length; quadruplex;Watson–Crick duplexCorrespondenceS. Maiti, Proteomics and Structural BiologyUnit, Institute of Genomics and IntegrativeBiology, CSIR, Mall Road, Delhi 110 007,IndiaFax: +91 11 2766 7471Tel: +91 11 2766 6156E-mail: souvik@igib.res.in(Received 8 February 2009, revised 5 April2009, accepted 1 May 2009)doi:10.1111/j.1742-4658.2009.07082.xGuanine-rich DNA sequences have the ability to fold into four-strandedstructures called G-quadruplexes, and are considered as promising antican-cer targets. Although the G-quadruplex structure is composed of quartetsand interspersed loops, in the genome it is also flanked on each side bynumerous bases. The effect of loop length and composition on quadruplexconformation and stability has been well investigated in the past, but theeffect of flanking bases on quadruplex stability and Watson–Crick duplexcompetition has not been addressed. We have studied in detail the effect offlanking bases on quadruplex stability and on duplex formation by theG-quadruplex in the presence of complementary strands using the quadru-plex-forming sequence located in the promoter region of the c- kit onco-gene. The results obtained from CD, thermal difference spectrum and UVmelting demonstrated the effect of flanking bases on quadruplex structureand stability. With the increase in flank length, the increase in the morefavorable DHvHis accompanied by a striking increase in the unfavorableDSvH, which resulted in a decrease in the overall DGvHof quadruplexformation. Furthermore, CD, fluorescence and isothermal titration calori-metry studies demonstrated that the propensity to attain quadruplex struc-ture decreases with increasing flank length.AbbreviationsITC, isothermal titration calorimetry; LNA, locked nucleic acid; TDS, thermal difference spectrum.3628 FEBS Journal 276 (2009) 3628–3640 ª 2009 The Authors Journal compilation ª 2009 FEBSdemonstrated that molecular crowding agents such asosmolytes significantly affect this transition, as livingcells are crowded with various biomolecules [38,39]. Itis apparent that the composition of the base sequencesin the loops between the G-quartets, the loop lengthand the base sequences flanking the quadruplex mayalso affect the transition between quadruplex andduplex in the natural environment of biological sys-tems. Recently, Kumar et al. [40] demonstrated therole of a locked nucleic acid (LNA) modified comple-mentary strand in the quadruplex ⁄ Watson–Crickduplex equilibrium. The study indicated that LNAmodifications in the complementary strand shift theequilibrium toward the duplex state. Moreover, it hasalso been shown that an increase in loop length favorsduplex formation and competes out the quadruplex[41]. However, to obtain a greater insight into thedynamics of the equilibrium between the folded motifand the duplex form, the G-rich sequences must alsobe considered within the genomic framework. Previousstudies have focused on quadruplex sequences in isola-tion, but the cellular environment is significantly dif-ferent. In the genome, these unique sequences areflanked by other sequences that might influence thestability of these folded motifs and their ability tocompete with the duplex form in the presence of theircomplementary strands. It thus seems logical to studythe influence of flanking regions on the existence ofquadruplexes, their stability and quadruplex ⁄ duplexcompetition in the presence of the complementarystrand.As the quadruplex-forming region does not occurin isolation, and instead is flanked by othersequences, it is imperative to analyze the effect ofthese neighboring sequences on quadruplex stabilityand on the duplexquadruplex equilibrium. In thecurrent study, we have explored the influence offlanking sequences in the quadruplex-forming regionof the c-kit proto-oncogene promoter [16]. Conforma-tional analysis of preformed quadruplexes with flanklengths from 0 to 12 was performed using CD andthermal difference spectrum (TDS). Thermal denatur-ation ⁄ renaturation profiles using UV-visible spectro-scopy were obtained in order to create a completethermodynamic profile for formation of quadruplexeswith different flank lengths. Binding parameters andthe thermodynamic profile of preformed quadruplexesin the presence of the complementary strand wereevaluated by fluorescence and isothermal titration cal-orimetry (ITC) studies. The data obtained in thisstudy highlight the influence of flanking bases onquadruplex stability and structural competitionbetween the G-quadruplex and the duplex.Results and DiscussionTo be able to assign a biologically relevant role toquadruplexes, they must be considered in the genomiccontext and natural cellular environment. We haveaddressed this question in this study because of itswider implication on the practicality of using G-quad-ruplexes as therapeutic targets. The telomeric quadru-plex has been well investigated and characterizedin terms of its structural and functional relevance[2,5,42–44]. However, this quadruplex, formed by the3¢ overhang of the telomere, lacks a complementarystrand and hence does not suffer competition with theWatson–Crick duplex. In addition to the telomericquadruplex, the G-quadruplex present in the promoterregion of the c-myc proto-oncogene has also been wellcharacterized in terms of its structure and function[12–15,45]. However, this quadruplex adopts multipleconformations that make structural ⁄ biophysical inves-tigations difficult [45]. Recently, quadruplex formationhas been reported in the promoter region of the c- kitproto-oncogene (87 bp upstream of the transcriptionstart site) [16]. The solution structure of this quadru-plex is also well characterized [46–49], and it has alsobeen investigated as an attractive therapeutic target[50]. This has generated interest with respect to furtherbiophysical and structural characterization of c-kitquadruplex. However, to design effective drugs againstquadruplex targets, it is essential to study the role ofvarious factors affecting quadruplex stability and influ-encing the equilibrium between quadruplex and duplexformation. Therefore, we have used the c-kit quadru-plex sequence (5¢-GGGAGGGCGCTGGGAGGAGGG-3¢) as the model sequence for our study (Fig. 1).To analyze the effect of flanking bases on quadruplexFig. 1. Schematic representation of the 21-mer G-rich sequencelocated )87 bp upstream of the transcription start site of the c-kitgene. The sequences shown to the left of )108 and to the right of)87 are the flanking sequences.A. Arora et al. Effect of flanking bases on quadruplex stability and Watson–Crick duplex competitionFEBS Journal 276 (2009) 3628–3640 ª 2009 The Authors Journal compilation ª 2009 FEBS 3629stability and quadruplexduplex transition, we usedfour sequences with 4, 6, 8 or 12 bases on either sideof the 21-base naturally occurring c-kit quadruplex-forming sequence (Table 1).The structural topology of the c-kit quadruplexsequences (c-kitG0, c-kitG4, c- kitG6, c-kitG8 andc-kitG12) was characterized as parallel or anti-parallelusing CD in the presence of 100 mm KCl, although CDonly provides an indication of the presence of anysecondary structure rather than a confirmation.Figure 2 (black squares) shows the CD spectra obtainedfor the various sequences. We observed a positive bandat around 262 nm and a negative band near 240 nm,suggesting the presence of a quadruplex signaturecharacteristic of the parallel conformation [51] in theG-rich sequences c-kitG0, c-kitG4 and c-kitG6(Fig. 2A–C, black squares). This observation is in agree-ment with a reported NMR study on the structuralconformation of the c-kit quadruplex [48]. For c-kitG8,two positive peaks at 265 and 286 nm and a negativepeak at 240 nm were observed (Fig. 2D, black squares).Moreover, unlike the G-rich sequences c-kitG0, c-kitG4and c-kitG6, a broad positive CD signal ranging from250 to 290 nm and a negative peak at 233 nm wereobserved in the CD spectrum of c-kitG12 (Fig. 2E,black squares). Thus, the CD spectra of c-kitG8 andc-kitG12 showed the presence of secondary structuresother than quadruplex.TDS complement CD as a tool for the structuralcharacterization of nucleic acids in solution. TDS pro-vide a simple, inexpensive and rapid method to obtainstructural insight into nucleic acid structures, and maybe used for both DNA and RNA from short oligomersto polynucleotides [52]. Figure 3 shows TDS forc-kitG0, c-kitG4, c-kitG6, c-kitG8 and c-kitG12 seq-uences. The TDS for c-kitG0, c-kitG4, c-kitG6 showedtwo positive maxima at 245 and 270 nm, a shoulder at255 nm, and a negative minimum at 295 nm, thusexhibiting the presence of quadruplex structure. How-ever, the TDS for c-kitG8 and c-kitG12 sequencesshowed loss of both the positive peak at 245 nm andthe negative peak at 295 nm that are characteristic ofG-quadruplex structure. The presence of a positivepeak at 270 nm in the TDS of the c-kitG8 and c-kitG12sequences indicated the presence of a Watson–Crickduplex-like structure as shown in Fig. 3. The TDS datapresented here are in agreement with previouslyreported TDS data for G-quadruplexes and GC-richduplexes [52]. The TDS analysis thus supports the exis-tence of G-quartets in c-kitG0, c-kitG4 and c-kitG6and the absence of Hoogsteen-bonded G-quartets inc-kitG8 and c-kitG12. The presence of non-Hoogsteen-bonded multiple structures in c-kitG8 and c-kitG12 asshown by TDS prompted us to perform UV melting ofc-kitG0, c-kitG4, c-kitG6, c-kitG8 and c-kitG12sequences at 260 nm in 100 mm KCl (Fig. S1). Thec-kitG8 and c-kitG12 sequences showed considerablehyperchromic effects in the range 10–12%, whilec-kitG0, c-kitG4 and c-kitG6 showed only 2–6% hyper-chromicity at 260 nm. The presence of 10–12% ofhyperchromicity at 260 nm for c-kitG8 and c-kitG12also resulted from disruption of Watson–Crick basepairing in the secondary structure (Fig. S1). mFOLDanalysis [53] also indicated the presence of stem-loopstructures with Watson–Crick base pairing in the stemregion in c-kitG8 and c-kitG12, and thus supported theabsence of Hoogsteen-bonded G-quartets (Fig. S2).Together, these data clearly indicate that the G-richc-kit sequence with 8 and 12 flanking bases can adopt aWatson–Crick duplex-like ‘stem-loop’ structure, andthus lose the ability to form prominent quadruplexstructure, unlike the c-kitG0, c-kitG4 and c-kitG6sequences. Figure S2 shows the topology of the parallelG-quadruplex formation for c-kitG0, c-kitG4 andTable 1. Quadruplexes with various flank lengths and their respective complementary strand sequences used in this study. G0 and C0 arethe core c-kit quadruplex-forming sequence and its complementary strand sequence, respectively. G4–G12 and C4–C12 indicate the numberof basesand 3¢ to the core c-kit quadruplex-forming sequences and their respective complementary strand sequences.Oligo name Oligonucleotide sequence (5¢-to3¢)Number offlanking basesc-kitG0 GGGAGGGCGCTGGGAGGAGGG 0c-kitC0 CCCTCCTCCCAGCGCCCTCCC 0c-kitG4 CAGAGGGAGGGCGCTGGGAGGAGGGGCTG 4c-kitC4 CAGCCCCTCCTCCCAGCGCCCTCCCTCTG 4c-kitG6 CGCAGAGGGAGGGCGCTGGGAGGAGGGGCTGCT 6c-kitC6 AGCAGCCCCTCCTCCCAGCGCCCTCCCTCTGCG 6c-kitG8 CGCGCAGAGGGAGGGCGCTGGGAGGAGGGGCTGCTGC 8c-kitC8 GCAGCAGCCCCTCCTCCCAGCGCCCTCCCTCTGCGCG 8c-kitG12 CCGGCGCGCAGAGGGAGGGCGCTGGGAGGAGGGGCTGCTGCTCGC 12c-kitC12 GCGAGCAGCAGCCCCTCCTCCCAGCGCCCTCCCTCTGCGCGCCGG 12Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition A. Arora et al.3630 FEBS Journal 276 (2009) 3628–3640 ª 2009 The Authors Journal compilation ª 2009 FEBSc-kitG6 and predicted secondary structures for c-kitG8and c-kitG12. We wish to highlight that the c-kitG8sequence can adopt a Watson–Crick duplex-like ‘stem-loop’ structure together with G-quadruplex structurein KCl buffer. The contribution of two differentsecondary structure populations is quite evident fromthe CD spectrum (Fig. 2) and the hypochromic (Fig. 4)and hyperchromic transitions (Fig. S1) obtained fromUV melting at 295 and 260 nm, respectively.Our next aim was to determine the effect ofincreasing the flank length on the thermodynamicstability of formation of secondary structures. Wehave used a spectroscopic method to obtain thermaldenaturation ⁄ renaturation profiles to detect G-quartetformation [54]. The thermal denaturation ⁄ renaturationprofiles for c-kitG0, c-kitG4 and c-kitG6 were charac-terized by a clear and reversible transition, such thatmelting and annealing curves were super-imposable(Fig. 4A–C). For c-kitG8, the melting and annealingcurves showed considerable hysteresis (Fig. 4D), andc-kitG12 showed no clear transition at 295 nm, sug-gesting the absence of stable G-quartets (Fig. 4E).The Tmvalues for the c-kitG0, c-kitG4 and c-kitG6sequences were calculated as shown in Table 2. Themidpoints of the melting transition (Tmelt) and theannealing transition (Tanneal) were also calculated forA B C D EFig. 2. CD spectra of preformed quadru-plexes with various flank lengths in theabsence (black squares) and presence(white squares) of equimolar concentrationsof corresponding complementary strands for(A) c-kitG0, (B) c-kitG4, (C) c-kitG6, (D)c-kitG8 and (E) c-kitG12 in 10 mM sodiumcacodylate buffer with 100 mM KCl, pH 7.0,at 25 °C.A. Arora et al. Effect of flanking bases on quadruplex stability and Watson–Crick duplex competitionFEBS Journal 276 (2009) 3628–3640 ª 2009 The Authors Journal compilation ª 2009 FEBS 3631c-kitG8, and are also shown in Table 2. The Tmval-ues for c-kitG0, c-kitG4 and c-kitG6 were 60, 55 and51 °C, respectively. The Tmeltand Tannealvalues forc-kitG8 were 50 and 47 °C, respectively, and wereaccompanied by considerable hysteresis. No melt-ing ⁄ annealing transition was observed for thec-kitG12 sequence at 295 nm. This observation sug-gested that increasing the flank length led to adecrease in the Tmvalue that reflects the reduced ther-mal stability (Table 2). The various thermodynamicparameters are summarized in Table 2. The thermody-namic parameters DGvH, DHvHand DSvHwere notdetermined for c-kitG8 and c-kitG12 due to the hys-teresis in c-kitG8 and the lack of a clear transition at295 nm for c-kitG12. DHvHincreases with the increasein flank length from 0 to 6 bases. This increase in theenthalpy change (DHvH) may be due to the increasein the base-stacking interaction among the flankingbases. A striking observation was the high increase inthe unfavorable negative entropy change DSvH, whichresulted in a decrease in the overall free energychange (DGvH). The decrease in entropy upon increasein flank length arises due to the intra-residue stackinginteraction in the flank bases. Furthermore, we alsoperformed concentration-dependent melting of all thesequences to deduce the molecularity of the structures.The sequences formed intramolecular structures assuggested by the concentration-independent thermalstability (Tm) (data not shown). Overall, the resultsindicated that quadruplex formation becomes lessfavorable with the increase in flank length on eachside of the core c-kit quadruplex sequence (Table 2).Fig. 3. Thermal difference spectrum of c-kitG0 (black squares),c-kitG4 (open squares), c-kitG6 (open circles), c-kitG8 (opentriangles) and c-kitG12 (open diamonds) resulting from subtractionof the spectrum obtained at 25 °C from that obtained at 90 °Cin10 mM sodium caodylate buffer with 100 mM KCl, pH 7.0.ABCDEFig. 4. UV melting (open triangles) and annealing (open diamonds)profiles of preformed c-kit quadruplex with various flank lengths:(A) c-kitG0, (B) c-kit G4, (C) c-kitG6, (D) c-kitG8 and (E) c-kitG12 in10 mM sodium cacodylate buffer, pH 7.0, with 100 mM KCl.Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition A. Arora et al.3632 FEBS Journal 276 (2009) 3628–3640 ª 2009 The Authors Journal compilation ª 2009 FEBSAs the quadruplex-forming region does not occur inisolation, but instead is flanked by other sequencesand is present together with its complementary strand,it is imperative to analyze the effect of these neighbor-ing sequences on the quadruplexduplex equilibriumalso.In order to assess the influence of flanking bases onthe quadruplexduplex equilibrium, we investigated theCD spectral changes on addition of correspondingcomplementary strand to preformed quadruplex inKCl buffer. The CD spectra are shown in Fig. 2 (whitesquares). For c-kitG0, c-kitG4 and c-kitG6, CD spec-tra recorded for equimolar concentrations of quadru-plex and its respective complementary strand showed apositive peak at 270 nm coupled with an increase inthe intensity of bands at 240 nm (Fig. 2A–C, whitesquares). These spectral features are characteristic ofthe B-DNA form, and suggest the formation of duplexwhen complementary strands are added to a quadru-plex. However, they do not confirm complete duplexformation for equimolar mixtures of preformed quad-ruplex and its complementary strand in 100 mm KClbuffer. For the c-kitG8 ⁄ C8 system, a small positivepeak at 270 nm together with a more intense positiveband at 286 nm coupled with an increase in the inten-sity of the negative band at 240 nm was observed(Fig. 2D, white squares). A broad positive CD band at286 nm together with negative CD band at 240 nm forc-kitG12 ⁄ C12 indicates that there is no change in theCD spectrum of c-kitG12 when incubated with itscomplementary strand (c-kitC12) in 1 : 1 ratio(Fig. 2E, white squares). These observations forc-kitG8 ⁄ C8 and c-kitG12 ⁄ C12 can be ascribed to thepresence of multiple secondary structures in both theG-rich as well as in the C-rich complementary strandsas discussed below.Next, to assess the competition between the quadru-plex and duplex forms under the influence of increas-ing flank lengths, fluorescence binding experimentswere performed using a donor ⁄ quencher pair of5¢-fluorescein (donor) and 3¢-dabsyl chloride(quencher). This technique was chosen because it offersthe advantage of working in the nanomolar range,which is not possible with UV or CD. FRET-basedstudies have also been used effectively to understandquadruplex structures [37,38,55–57]. Complementarystrands of respective flank lengths were used forhybridization with fluorophore-labeled sequences. Weinvestigated the binding affinity of complementarystrands to preformed quadruplexes with various flanklengths of 0–12 bases in KCl. We observed enhance-ment of fluorescence intensity on increasing the con-centration of the complementary strand, indicative of agreater extent of quadruplex opening. The normalizedrelative changes in fluorescence intensity were plottedagainst the complementary strand concentration(Fig. 5), and the binding affinities were calculated byfitting the plots using Eqn (8), as described in Experi-mental procedures. The estimated binding affinities aresummarized in Table 3. The binding affinity value forthe complementary strands towards the preformedG-quadruplexes with various flank lengths increasedwith the increase in the flank length from c-kitG0 toc-kitG6 (Table 3). The KAvalue obtained forc-kitG8 ⁄ C8 was same as that for c-kitG6 ⁄ C6, and wasdecreased for c-kitG12 ⁄ C12 (Table 3).To complement the fluorescence studies, ITC experi-ments were performed to obtain the complete thermo-dynamic profile for quadruplex hybridization to itscomplementary strand. The hybridization event wasdependent on nearest-neighbor Watson–Crick basepairing. Figure 6 shows characteristic sigmoidal curvesobtained for heat of injection for hybridization ofpreformed quadruplex to its complementary strand.Table 4 summarizes the thermodynamic parameters forthe duplex formation obtained from ITC experiments.The heat of injection profile for duplex formation isexothermic. The magnitude of negative DHITCreflectsTable 2. Thermodynamic parameters obtained from UV experiments performed in 10 mM sodium cacodylate buffer, 100 mM KCl at pH 7.0 and25 °C. Tmis the melting temperature. DHvHis the enthalpy change and DSvHis the entropy change for G-quadruplex formation. DGvHis the freeenergy change for G-quadruplex formation. All parameters were calculated as described in Experimental procedures. All the parametersobtained were within 10% error. Tmvalues differed by ± 1.0 °C. ND indicates that values were not determined for c-kitG8 and c-kitG12.QuadruplexTm(°C)DHvH(kcalÆmol)1)DSvH(calÆmol)1ÆK)1)DGvH(kcalÆmol)1)Melting Annealingc-kitG0 60.0 60.0 )49.0 ± 5.0 )146.0 ± 15.0 )5.5 ± 0.6c-kitG4 55.0 55.0 )52.5 ± 5.0 )160.0 ± 16.0 )4.8 ± 0.5c-kitG6 51.0 51.0 )57.5 ± 6.0 )178.0 ± 18.0 )4.5 ± 0.5c-kitG8 50.0 47.0 ND ND NDc-kitG12 ND ND ND ND NDA. Arora et al. Effect of flanking bases on quadruplex stability and Watson–Crick duplex competitionFEBS Journal 276 (2009) 3628–3640 ª 2009 The Authors Journal compilation ª 2009 FEBS 3633the binding enthalpy for duplex formation, whichincreased with the increase in the number of flankingbases from 0 to 6, and deviation from the increasingDHITCtrend was observed for c-kitG8 and c-kitG12,as shown in Table 4. The DH values obtained fromITC experiments were much lower than the expectedvalue for duplex formation in all cases, i.e.)166.30 kcalÆmol)1for c-kitG0 ⁄ C0, )232.70 kcalÆmol)1for c-kitG4 ⁄ C4, )268.50 kcalÆmol)1for c-kitG6 ⁄ C6,)309.40 kcalÆmol)1for c-kitG8 ⁄ C8 and )382.20 kcalÆmol)1for c-kitG12 ⁄ C12, obtained using the nearest-neighbor method [58]. The enthalpy change in thisprocess involves endothermic and exothermic contribu-tions from opening up of the preformed quadruplexand hybridization between G- and C-rich strands,respectively. The overall enthalpy change is the sum ofthe contribution from each process, leading to a lowerDHITCvalue than calculated using the nearest-neighbormethod. The DSITCfor duplex formation decreasedwith the increase in the number of flanking bases from0 to 6. However, there was deviation from the decreas-ing DSITCvalues for c-kitG8 and c-kitG12 as shown inTable 4. A detailed inspection of Table 4 reveals thatthe DHITCvalues as well as the DGITCvalues forc-kitG8 ⁄ C8 and c-kitG12 ⁄ C12 deviate from the increas-ing trend as observed for c-kitG0 ⁄ C0, c-kitG4 ⁄ C4 andc-kitG6 ⁄ C6. As shown by TDS, UV hyperchromic tran-sition at 260 nm and mFOLD analysis, the G-richstrands of c-kitG8 and c-kitG12 can adopt intra-molecular stem-loop structure with Watson–Crick basepairing in the stem region. Likewise, the C-rich comple-mentary strand can also form such stem-loop structures.Moreover, the C-rich complementary strand also hasthe potential to form a secondary structure called ani-motif in all the sequences ranging from c-kitC0 toc-kitC12 at near physiological pH 7.0 [59], althoughthese structures would be less stable, at physiologicalpH as compared to acidic pH, as it has been shown thatintercalated hemiprotonated C:C+base pairs are stableat acidic pH [60,61,62]. To understand the structureTable 3. Binding affinities (KA) of quadruplex with complementarystrands obtained from fluorescence studies in 10 mM sodium caco-dylate buffer with 100 mM KCl, pH 7.0 at 25 °C. The quadruplexconcentration used was 50 nM and the respective complementarystrand concentration varied from 0 to 1 lM. The values obtainedwere within 10% error.Duplex KA(M)1)c-kitG0 ⁄ C0 4.0 ± 0.4 · 106c-kitG4 ⁄ C4 8.0 ± 0.9 · 106c-kitG6 ⁄ C6 3.2 ± 0.3 · 107c-kitG8 ⁄ C8 3.0 ± 0.2 · 107c-kitG12 ⁄ C12 2.5 ± 0.3 · 106Fig. 6. ITC binding profile of equimolar mixtures of c-kitG0 (blacksquare), c-kitG4 (open square), c-kitG6 (open circle), c-kitG8 (opentriangle) and c-kitG12 (open diamond) preformed quadruplexsequences with corresponding complementary strands in 10 mMsodium caodylate buffer with 100 mM KCl, pH 7.0, at 25 °C.Fig. 5. Plots of normalized relative fluorescence emission intensity(DF, as described in the text) of quadruplex (30 nM) at 520 nm ver-sus complementary strand concentration in 10 mM sodium caody-late buffer with 100 mM KCl, pH 7.0, at 25 °C. The complementarystrands used were c-kitC0 (black square), c-kitC4 (open square),c-kitC6 (open circle), c-kitC8 (open triangle) and c-kitC12 (opendiamond).Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition A. Arora et al.3634 FEBS Journal 276 (2009) 3628–3640 ª 2009 The Authors Journal compilation ª 2009 FEBSadopted by c-kit C-rich strands, we performed CD stud-ies (Fig. S3) and UV melting studies at 287 and 265 nm(Fig. S4) at both pH 6.0 and 7.0. Both CD and UVmelting studies showed that the C-rich strands c-kitC0,c-kitC4 and c-kitC6 adopt i-motif structure at pH 6.0,but no such structure formation takes place at pH 7.0.Moreover, c-kitC8 and c-kitC12 did not show thei-motif structure signature; instead, the UV meltingprofiles at 265 nm for c-kitC8 and c-kitC12 showed$ 10% hyperchromicity, thus indicating the presence ofan intramolecular stem–loop structure at both pH 6.0and 7.0 (Fig. S4). The sum of the CD spectra for boththe G- and C-rich individual strands (Fig. S5) was alsofound to be similar to the CD spectra of mixtures ofboth the strands at pH 7.0 as shown in Fig. 2.Furthermore, to understand the contribution ofi-motif structures in quadruplexWatson–Crick duplexcompetition, we also performed ITC titrations at pH 6.0(Fig. S6), and data are presented in Table S1. ITCexperiments at pH 6.0 showed that the binding affinityof c-kitC4 and c-kitC6 strands to their respective G-richstrands decreases almost by one order of magnitude(Fig. S6 and Table S1) compared to the affinity at pH7.0 (Table 4), but G0 sequences remained unopened inthe presence of respective complementary c-kitC0strands (Fig. S6). However, ITC titration data for thec-kitG8 ⁄ C8 and c-kitG12 ⁄ C12 system remain unaffectedand similar at both pH 6.0 and 7.0 (Fig. S6 andTable S1). This rules out the possibility of a significantcontribution of i-motif structures in c-kit C-rich strandsto quadruplexWatson–Crick duplex competition atphysiological pH 7.0.Together, the results obtained from CD, fluorescenceand ITC titration experiments in the c-kitG8 ⁄ C8 andc-kitG12 ⁄ C12 systems demonstrate that structural com-petition is imposed by the intramolecular stem–loopstructure in C-rich complementary strand, thus affectingthe quadruplexWatson–Crick duplex equilibria at bothpH 7.0 and the near physiological pH of 6.0. The pres-ence of intramolecular stem–loop structures in theC-rich complementary strand leads to the existence ofcompetition and thus hinders opening of the secondarystructures in c-kitG8 and c-kitG12 G-rich sequences.These observations indicate that the increase in flanklength from 0 to 6 on each side of the c-kit core quadru-plex-forming sequence drives efficient invasion and bet-ter conversion of quadruplex to duplex, and competesout quadruplex in this structural competitive equilib-rium. However, this is not the case for flank lengthsof 8 and 12 due to the presence of intramolecularstem–loop structures in both the G-rich and C-richstrands.The parameter that highlights the predominance ofeither of population (duplex or quadruplex) is the rela-tive free energy difference, DDG25 °C, between duplexand quadruplex structures. In this study, we haveobtained thermodynamic profiles of quadruplexes byUV melting experiments. However, it was difficult toobtain the thermodynamic parameters involved induplex formation from the same sequences and theirrespective complementary strands by UV melting stud-ies, as this includes contributions from both duplexand quadruplex. Therefore, we obtained the thermo-dynamic profile for duplexes from ITC experiments(Table 4). The relative free energy difference, DDG25 °C,between duplex and quadruplex structure increasefrom )3.3 to )5.6 kcalÆmol)1upon an increase in flanklength from 0 to 6. It is noteworthy that DDG25 °Cval-ues are reasonably negative in all cases, indicating thatduplex is the predominant structure. We also observedan increase in duplex stability upon an increase inflank length (Table 4). The greater the negative magni-tude of DDG25 °C, the higher is the predominance ofduplex at equilibrium.Table 4. Thermodynamic parameters obtained from ITC experiments performed in 10 mM sodium cacodylate buffer, pH 7.0, 100 mM KCl at25 °C. Thermodynamic parameters were obtained for complementary strand binding to the preformed quadruplexes at 25 °C. The quadru-plex concentration in the cell was 5–10 lM and the complementary strand concentration in the syringe was 100–250 lM. N is the stoichiom-etry of complementary strand binding to preformed quadruplex. DHITCis the enthalpy change and DSITCis the entropy change for duplexformation. DGITCis the free energy change for duplex formation and was determined using the relationship DG = )RT ln KA, where R is theuniversal gas constant, T is the temperature in Kelvin (K), and KAis the binding affinity for duplex formation. All the parameters obtainedwere within 10% error.Duplex NKA(106M)1)DHITC(kcalÆmol)1)DSITC(calÆmol)1ÆK)1)DGITC(kcalÆmol)1)c-kitG0 ⁄ C0 0.6 3.2(± 0.3) )23.0(± 2.0) )47.5(± 5.0) )8.8(± 0.9)c-kitG4 ⁄ C4 0.7 7.0(± 0.6) )47.0(± 5.0) )126.5(± 12.0) )9.3(± 0.9)c-kitG6 ⁄ C6 0.6 28(± 2.5) )92.0(± 9.0) )274.8(± 27.0) )10.1(± 1.0)c-kitG8 ⁄ C8 0.6 27(± 3.0) )94.0(± 9.2) )281.6(± 28.0) )10.1(± 1.0)c-kitG12 ⁄ C12 0.8 2.5(± 0.3) )66.0(± 6.0) )192.3(± 19.2) )8.7(± 0.9)A. Arora et al. Effect of flanking bases on quadruplex stability and Watson–Crick duplex competitionFEBS Journal 276 (2009) 3628–3640 ª 2009 The Authors Journal compilation ª 2009 FEBS 3635Based on a search algorithm designed by Huppertand Balasubramanian [11], it has been predicted that,in principle, as many as 376 000 quadruplexes couldexist in the human genome. However, our studysuggests a lower likelihood of quadruplex formationat all these sites, as the presence of flanking baseson each side of the c-kit core quadruplex sequencedestabilizes the quadruplex structure. Furthermore,an increase in the number of flanking bases leads tothe existence of alternative structures other thanquadruplexes. In the genome, these sites will havemany more bases flanking them than used in ourstudies, casting doubt on the global presence ofquadruplex structures with a general role in the bio-logical system. On the other hand, several studieshave indicated the existence of quadruplexes in vivo[63] and their ability to regulate gene expression [12–14]. Their significant role in the telomeric region hasalso been well established [2,5,42–44]. Further indica-tions of the presence of quadruplexes in the livingsystem come from the fact that cells contain factorsthat actively cleave and unwind G4 DNA [25]. Itthus seems apparent that cells may have some mech-anism(s) that favors formation of either quadruplexesor duplexes according to their biological relevance,thus suggesting the importance of the quadru-plex ⁄ duplex equilibrium in modulating biologicalactivities.ConclusionIn the present study, we have explored the effect offlanking sequences on quadruplex stability and quadru-plex ⁄ duplex competition in order to understand thelikely scenario in the cell, where quadruplex sites haveadditional sequences at both their ends. The studyshows that the presence of flanking bases affects thethermodynamic stability of the G-quadruplex. With anincrease in the flank length, the increase in the morefavorable negative enthalpy change (DHvH) is accom-panied by an increase in the unfavorable negativeentropy change (DSvH), resulting in a decrease in theoverall free energy change (DGvH). The study alsoshows that, with the increase in the number of flankingbases, there is an increased propensity for the existenceof other alternative structures that may compete withG-quadruplex formation. Our work shows that thepresence of flanks destabilizes the G-quadruplex struc-ture and drives the equilibrium towards duplex forma-tion. If this is indeed the case, the probability of theexistence of these structures as global regulatory motifin the genome, prima facie, appears to be context-dependent.Experimental proceduresMaterialsOligonucleotides were obtained from Microsynth (Balgach,Switzerland). The sequences of the oligonucleotides usedin these studies are given in Table 1. c-kitG0, c-kitG4,c-kitG6, c-kitG8 and c-kitG12 represent the c-kit quadru-plex sequence with various flank lengths, and c-kitC0,c-kitC4, c-kitC6, c-kitC8 and c-kitC12 represent theirrespective complementary strands (Table 1). All thesequences containing core quadruplex-forming motifs withvarying flank lengths used in our study were labeled usingthe fluorophores 5¢-fluorescein and 3¢-dabsyl chloride. Theconcentrations of unlabeled oligonucleotide solutions weredetermined based on the absorbance at 260 nm and 80 °Cusing molar extinction coefficients of 213, 290, 321, 354and 419 mm)1Æcm)1for c-kitG0, c-kitG4, c-kitG6, c-kitG8and c-kitG12, respectively, and 164, 234, 275, 308 and382 mm)1Æcm)1for c-kitC0, c-kitC4, c-kitC6, c-kitC8 andc-kitC12, respectively. These values were calculated byextrapolation of tabulated values for the dimers andmonomer bases at 25–80 °C using procedures describedpreviously [64,65]. Concentrations of the labeled oligonu-cleotide were determined by measuring the absorbance ofthe attached fluorescein moiety at 496 nm using a molarextinction coefficient of 4.1 · 104m)1Æcm)1[66]. In allstudies, we used preformed quadruplexes obtained byheating solutions containing G-rich sequences in 100 mmKCl to 100 °C for 5 min and gradually cooling to roomtemperature at the rate of 0.2 °CÆmin)1, and then kept for7 days at 4 °C prior to experimentation.Circular dichroism spectroscopyCD spectra were measured using a Jasco model J-715 spec-tropolarimeter (Jasco, Tokyo, Japan) equipped with a ther-moelectrically controlled cell holder and a cuvette with apath length of 1 cm. Scans were performed over a range of200–350 nm in 10 mm sodium cacodylate buffer (pH 7.0)with 100 mm KCl at 25 °C. Preformed G-quadruplexes withvarious flank lengths were incubated with equimolar concen-trations of respective flank length at 25 °C for 24 h prior toCD experiments. The spectra of preformed quadruplexes at aconcentration of 7.5 lm in the absence and presence of equi-molar concentrations of the complementary strand wereobtained. A buffer baseline spectrum was obtained using thesame cuvette and subtracted from sample spectra.Thermal difference spectrumFor each oligonucleotide sample, an UV spectrum wasrecorded above and below its melting temperature (Tm). Thedifference between the UV spectrum at high temperatureEffect of flanking bases on quadruplex stability and Watson–Crick duplex competition A. Arora et al.3636 FEBS Journal 276 (2009) 3628–3640 ª 2009 The Authors Journal compilation ª 2009 FEBS(95 °C) and the UV spectrum at low temperature (25 °C) isdefined as the TDS, and represents the spectral differencebetween the unfolded and the folded form. The TDS werenormalized, using a value of +1 for the highest positivepeak.Thermal denaturation/renaturation usingUV-visible spectroscopyOligonucleotides were dissolved in 10 mm sodium cacodylatebuffer pH 7.0 with 100 mm KCl at final concentrations rang-ing from 2 to 10 lm, depending on the oligonucleotidelength. Samples (1 ml) were placed in a stoppered quartzcuvette of 1 cm path length, and then thermal denatur-ation ⁄ renaturation was performed using a Cary 100 UV ⁄ vis-ible spectrophotometer (Varian, Walnut Creek, CA, USA)equipped with a Peltier effect heated cuvette holder. A tem-perature range of 25–95 °C was used to monitor the absor-bance at 295 nm at a heating ⁄ cooling rate of 0.2 °CÆmin)1.The absorbance profiles recorded at 295 nm were analyzedusing a non-linear least-squares curve-fitting method. Thismethod involved contributions from pre- and post-transitionbaselines, and thermodynamic data were obtained usingequations described previously [67,68]. The analysis wasperformed using mathematica 5.1 (Wolfram Research,Champaign, IL, USA) and origin 7.0 (Microcal Inc.,Northampton, MA, USA).The following equations were used to calculate thethermodynamic data:Au¼ buþ muà TðÞ ð1ÞAl¼ blþ mlà TðÞ ð2ÞKeq¼ð1 À aÞað3ÞAðTÞ¼aÃðAuÀ AlÞþAlð4ÞKeq¼ expDGoRT¼ expDHoRTþDSoRð5ÞEquations 1 and 2 are linear equations where Auand Alare terms describing upper and lower baselines, respectively,buand blare fitted parameters for the intercepts for theupper and lower baseline, and muand mlare the respectiveslopes. Keqis the equilibrium constant for the unstruc-tured ⁄ structured transition for an intramolecular system,and a is the folded fraction. A (T) is the dependent variableand is the experimentally determined absorbance at eachtemperature (T). Using these equations, the van’t Hoffenthalpy (DHvH) and entropy (DSvH) were calculated, andTmwas calculated from the peak value of the first deriva-tive of the fitted curve. Tm values differed by ± 1.0 °C.The Gibbs free energy (DGvH) was calculated at 25 °C usingthe equation DGvH= DHvH) TDSvH, assuming DCp =0.Fluorescence studiesA FLUOstar OPTIMA fluorescence plate reader (BMGLab technologies, Melbourne, Australia) was used to deter-mine the binding affinities of fluorophore-labeled c-kitG0,c-kitG4, c-kitG6, c-kitG8 and c-kitG12 to their respectivecomplementary strands (sequences given in Table 1) in thepresence of 100 mm KCl. The plate reader makes it possi-ble to work on systems that suffer from thermodynamicand kinetic inertia, thus requiring prolonged incubation,and enables study of many samples at dilute concentration[38]. The experiments were performed in 384-well plates,using 480 nm excitation and 520 nm emission filters. Thewells were loaded with solutions of a fixed concentration ofpreformed quadruplex (50 nm) and increasing concentra-tions of complementary strand (0–1 lm). Sample mixtureswere incubated for 24 h at 25 °C, and the plate was readat 520 nm. For analysis of data, the observed fluorescenceintensity was considered as the sum of the weighted contri-butions from folded G-quadruplex strand and extendedG-strand in the duplex form:F ¼ 1 À abðÞF0þ abFbð6Þwhere F is the observed fluorescence intensity at eachtitrant concentration, F0and Fbare the fluorescence intensi-ties of the initial and final states of titration, respectively,and abis the mole fraction of quadruplex in duplex form.Assuming 1 : 1 stoichiometry for the interaction involvingcomplementary strand binding, it can be shown that:Q½0a2bÀ Q½0þ C½þ1=KAÀÁabþ C½¼0 ð7Þwhere KAis the association constant, [Q]0is the totalG-strand concentration, and [C] is the complementarystrand concentration.From Eqns (6) and (7), it can be shown that:DF ¼ DFmax=2 Q0½ðÞQ½0þ C½þ1=KAÀÁ&ÀffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiQ½0þ C½þ1=KAÀÁ2À4 Q½0C½q'ð8Þwhere DF = F ) F0and DFmax= Fmax) F0.Isothermal titration calorimetry experimentThe ITC experiment was performed using a MicrocalVP-ITC titration calorimeter. The 300 ll syringe was filledwith 146 lm of complementary strand. Titration was per-formed by injecting 10 ll aliquots of complementary strandA. Arora et al. Effect of flanking bases on quadruplex stability and Watson–Crick duplex competitionFEBS Journal 276 (2009) 3628–3640 ª 2009 The Authors Journal compilation ª 2009 FEBS 3637[...].. .Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition into the cell containing 10 lm of preformed quadruplex at 8 min intervals at 25 °C, and complete mixing was accomplished by stirring with the syringe paddle at 300 r.p.m Titration curves were corrected for heat of dilution by injecting the complementary oligonucleotide into 10 mm sodium cacodylate buffer at pH 6.0 and. .. 2009 The Authors Journal compilation ª 2009 FEBS A Arora et al Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition 24 Sun D, Guo K, Rusche JJ & Hurley LH (2005) Facilitation of a structural transition in the polypurine ⁄ polypyrimidine tract within the proximal promoter region of the human VEGF gene by the presence of potassium and G -quadruplex- interactive agents Nucleic... Tetraplex DNA and its interacting proteins Front Biosci 12, 4336–4351 26 Kumar N & Maiti S (2004) Quadruplex to Watson– Crick duplex transition of the thrombin binding aptamer: a fluorescence resonance energy transfer study Biochem Biophys Res Commun 319, 759–767 27 Hardin CC, Watson T, Corregan M & Bailey C (1992) Cation dependent transition between the quadruplex and Watson–Crick hairpin forms of d(CGCG3GCG)... polymorphism of telomere DNA: interquadruplex and duplex quadruplex conversions probed by Raman spectroscopy Biochemistry 33, 7848–7856 29 Deng H & Braunlin WH (1995) Duplex to quadruplex equilibrium of the self-complementary oligonucleotide d(GGGGCCCC) Biopolymers 35, 677–681 30 Halder K, Mathur V, Chugh D, Verma A & Chowdhury S (2005) Quadruplex duplex competition in the nuclease hypersensitive element of. .. Balasubramanian S & Neidle S (2005) Highly prevalent putative quadruplex formation within the c-kit oncogene J Am Chem Soc 127, 10584–10589 17 Cogoi S & Xodo LE (2006) G -quadruplex formation within the promoter of the KRAS proto-oncogene and its effect on transcription Nucleic Acids Res 34, 2536–2549 18 Xu Y & Sugiyama H (2006) Formation of the G -quadruplex and i-motif structures in retinoblastoma susceptibility... of the thrombin aptamer into a G -quadruplex with Sr2+: stability, heat, and hydration J Am Chem Soc 123, 10799–10804 4 Olsen CM, Gmeiner WH & Marky LA (2006) Unfolding of G-quadruplexes: energetic, and ion and water contributions of G-quartet stacking J Phys Chem B 110, 6962–6969 5 Gomez D, Lemarteleur T, Lacroix L, Mailliet P, Mergny JL & Riou JF (2004) Telomerase downregulation induced by the G -quadruplex. .. bases on quadruplex stability and Watson–Crick duplex competition 52 Mergny JL, Li J, Lacroix L, Amrane S & Chaires JB (2005) Thermal difference spectra: a specific signature for nucleic acid structures Nucleic Acids Res 33, e138 53 Walter AE, Turner DH, Kim J, Lyttle MH, Muller P, Mathews DH & Zuker M (1994) Coaxial stacking of helixes enhances binding of oligoribonucleotides and improves predictions... element of human c-myc promoter: C to T mutation in C-rich strand enhances duplex association Biochem Biophys Res Commun 327, 49–56 31 Datta B & Armitage BA (2001) Hybridization of PNA to structured DNA targets: quadruplex invasion and the overhang effect J Am Chem Soc 123, 9612– 9619 32 Phan AT & Mergny JL (2002) Human telomeric DNA: G -quadruplex, i-motif and Watson–Crick double helix Nucleic Acids Res... quadruplex ⁄ Watson– Crick duplex equilibrium J Phys Chem B 111, 12328–12337 Kumar N, Sahoo B, Varun KA, Maiti S & Maiti S (2008) Effect of loop length variation on quadruplex Watson Crick duplex competition Nucleic Acids Res 13, 4433–4442 Phan AT, Kuryavyi V, Luu KN & Patel DJ (2007) Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution Nucleic Acids... Prevalence of quadruplexes in the human genome Nucleic Acids Res 33, 2908–2916 12 Simonsson T, Pecinka P & Kubista M (1998) DNA tetraplex formation in the control region of c-myc Nucleic Acids Res 26, 1167–1172 13 Simonsson T & Henriksson M (2002) c-myc suppression in Burkitt’s lymphoma cells Biochem Biophys Res Commun 290, 11–15 14 Jain AS, Grand CL, Bearss DJ & Hurley LH (2002) Direct evidence for a G-quadruplex . quadruplex conformation and stability has been well investigated in the past, but the effect of flanking bases on quadruplex stability and Watson–Crick duplex competition. Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition Amit Arora, Divya R. Nair and Souvik MaitiProteomics and Structural
- Xem thêm -

Xem thêm: Báo cáo khoa học: Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition pptx, Báo cáo khoa học: Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition pptx, Báo cáo khoa học: Effect of flanking bases on quadruplex stability and Watson–Crick duplex competition pptx