REVIEW ARTICLE Modified PCR methods for 3¢ end amplification from serial analysis of gene expression (SAGE) tags Wang-Jie Xu1, Zhao-Xia Wang1 and Zhong-Dong Qiao1,2 College of Life Science and Technology, Bio-X Research Center, Key Laboratory of Developmental Genetics and Neuropsychiatric Diseases (Ministry of Education), Shanghai Jiao Tong University, China Shanghai Institute of Medical Genetics, Shanghai Jiao Tong University, China Keywords 3¢ longer fragment cDNA; generation of longer cDNA fragments from SAGE tags for gene identification (GLGI); high-throughput; methods; mRNA; rapid RT-PCR analysis of unknown SAGE tags (RAST-PCR); reverse SAGE (rSAGE); serial analysis of gene expression (SAGE); tag; two-step analysis of unknown SAGE tags (TSAT-PCR) Correspondence Z Qiao, College of Life Science and Technology, Shanghai Jiao Tong University, 800 Dongchuan Road, 200240 Shanghai, China Fax:+86 21 5474 7330 Tel: +86 21 3420 4925 E-mail: zdqiao@sjtu.edu.cn Serial analysis of gene expression (SAGE) is a powerful technique to study gene expression at the genome level However, a disadvantage of the shortness of SAGE tags is that it prevents further study of SAGE library data, thus limiting extensive application of the SAGE method in gene expression studies However, this problem can be solved by extension of the SAGE tags to 3¢ cDNAs Therefore, several methods based on PCR have been developed to generate a 3¢ longer fragment cDNA corresponding to a SAGE tag The list of modified methods is extensive, and includes rapid RT-PCR analysis of unknown SAGE tags (RAST-PCR), generation of longer cDNA fragments from SAGE tags for gene identification (GLGI), a high-throughput GLGI procedure, reverse SAGE (rSAGE), two-step analysis of unknown SAGE tags (TSAT-PCR), etc These procedures are constantly being updated because they have characteristics and advantages that can be shared Development of these methods has promoted the widespread use of the SAGE technique, and has accelerated the speed of studies of large-scale gene expression (Received 11 January 2009, revised 11 February 2009, accepted 24 February 2009) doi:10.1111/j.1742-4658.2009.06981.x Introduction The challenge of the so-called ‘post-genomic’ era will be extracting biological information on a large scale from the available sequence data [1] Such studies will include annotation from genes to genome [2] and large-scale gene expression screens [3] A set of highthroughput techniques is required to complete the work Ever since it was proposed by Velculescu et al [4], the SAGE method has been used for transcription analysis in many species, with collection of a large number of 14-base SAGE tags [5–12] By analyzing a short sequence tag representing a transcript, SAGE significantly decreases the overall scale of the sequencing analysis, and makes it possible to analyze nearly all of the expressed transcripts from the genome, a capability that is unmatched by any other currently available method [13] Application of the SAGE technique has provided valuable information in various biological systems [14–17] and in transcriptome characterization and genome annotation [18–21] Although SAGE is doubtless a useful and highthroughput technique for transcriptomics, it nevertheless has a disadvantage The size of the SAGE tag, 14 Abbreviations GLGI, generation of longer cDNA fragments from SAGE tags for gene identification; Ptag, tag-specific primer; RAST-PCR, rapid RT-PCR analysis of unknown SAGE tags; rSAGE, reverse SAGE; SAGE, serial analysis of gene expression; TSAT-PCR, two-step analysis of unknown SAGE tags FEBS Journal 276 (2009) 2657–2668 ª 2009 The Authors Journal compilation ê 2009 FEBS 2657 Methods for 3Â end amplification from SAGE tags W.-J Xu et al bases, is frequently too short to unequivocally identify the gene of origin [22] Numerous improvements to the original technology have been proposed [20,23–27], including the production of longer tags, which have improved the specificity of tag-to-gene mapping [7,24], and modifications designed to facilitate library construction from nanogram quantities of total RNA [23,28] The improved techniques can extend the length of tags to 21 bases and 26 bases [1,22], but the tag size still causes problems during the process of gene identification from the tag of SAGE If entered as a query in a BLAST search, many SAGE tags [14,29] and LongSAGE tags not match any known expressed sequences in databases [30,31] On the other hand, the same tag frequently matches two or more gene sequences, which confounds further analysis [32] If SAGE is applied to organisms for which no DNA database is available, it is necessary to recover a longer DNA sequence adjacent to the tag by experiment, and to further annotate this longer fragment by BLAST search, i.e it is necessary to isolate a 3¢ longer fragment or full-length cDNA from the SAGE tag for gene identification The most difficult and key step in isolation of the full-length cDNA is generation of the 3¢ longer fragment cDNA from the SAGE tag Thus, several strategies have been developed: rapid RT-PCR analysis of unknown SAGE tags (RAST-PCR) [33], generation of longer cDNA fragments from SAGE tags for gene identification (GLGI) [34], a high-throughput GLGI procedure [32], the two-step analysis of unknown SAGE tags (TSAT-PCR) [36], and modified reverse SAGE (rSAGE) [35], etc These methods have differing characteristics and advantages Rapid RT-PCR analysis of unknown SAGE tags Rapid RT-PCR analysis of unknown SAGE tags (RAST-PCR) was developed in 1999 by van den Berg et al [33] In brief, an oligo(dT)24 primer with a 5¢ M13 tail [5¢-CTAGTTGTAAAACGACGGC CAG(T)24-3¢] replaced a conventional oligo(dT) primer for synthesizing first-strand cDNA to serve as PCR template For PCR, the tag-specific primer was used as the sense primer, and consisted of the 14-base tag nucleotides and 5¢ inosine nucleotides to increase the annealing temperature of the primers (5¢-IIIII-CATGtag sequence-3¢) In addition, a 20-base primer (20bM13) corresponding to the 5¢ tail of the oligo(dT) primer (5¢-AGTTGTAAAACGACGGCCAG-3¢) was used as the antisense primer However, using the M13 sequence connected to the oligo(dT) as the antisense primer for PCR will 2658 generate multiple fragments with different sizes or a smear caused by inclusion of various lengths of poly(dA) ⁄ (dT) sequences [34] The reason for this is that oligo(dT) primers anneal randomly along the poly(A) sequences found in mRNA templates during the process of cDNA synthesis Generation of longer cDNA fragments from SAGE tags for gene identification (GLGI) To avoid the disadvantage mentioned above in the RAST-PCR method, Chen et al proposed a new method called generation of longer cDNA fragments from SAGE tags for gene identification (GLGI) [34] The improvement in GLGI is that an anchored oligo(dT) primer is used as the antisense primer in PCR, replacing the M13 sequence in the RAST-PCR method Figure shows the general strategy Briefly, in the first PCR cycle, sense primers containing the SAGE tags will anneal to specific cDNA templates and extension will proceed from these primers In the second cycle, extension will occur only from the anchored oligo(dT) primer that annealed at the 5¢ end of the poly(dA) sequences with the anchored nucleotide, and all other anchored primers annealed along the poly(dA) sequences will not be extended because the anchor nucleotide of primers is not paired with the template In the following cycles, only the cDNA templates containing the SAGE tag sequence will undergo exponential amplification Thus, only copies of the same size will be generated The GLGI method has been widely applied to exploit many kinds of SAGE data for characterization of the eukaryotic transcriptome [7,12,18,36,37], and has even been used to analyze data obtained by massively parallel signature sequencing [38] As the antisense primer in GLGI is an oligo(dT), rigorous PCR conditions, Pfu DNA polymerase, Mg2+ concentration, number of PCR cycles and the annealing temperature, must be optimized for each SAGE tag [39] In a typical SAGE project, hundreds or even thousands of SAGE tags need to be analyzed Therefore, the method is very labor-intensive to analyze all SAGE tags, and does not facilitate large-scale analyses High-throughput GLGI The original GLGI technique was subsequently developed into a high-throughput procedure for simultaneous conversion of a large number of SAGE tags into corresponding 3¢ cDNAs Figure shows a schematic of the high-throughput GLGI procedure FEBS Journal 276 (2009) 2657–2668 ª 2009 The Authors Journal compilation ª 2009 FEBS W.-J Xu et al Methods for 3¢ end amplification from SAGE tags A B Fig Schematic for GLGI (A) In this process, first-strand cDNA synthesized by oligo(dT) is used for PCR In the first cycle, the template with the SAGE tag binding site is annealed to the sense primer and extended to the end of the template In the second cycle, extension occurs only from the anchored oligo(dT) primer that has annealed and paired correctly at the start of poly(dA) sequences Exponential amplification occurs only for the template with the SAGE tag-binding site (B) The result of GLGI is conversion of 14 nucleotides of SAGE tag to a hundred bases of 3¢ cDNA fragment This figure is reproduced from [34] Fig Schematic of the high-throughput GLGI procedure This figure is reproduced from [32] with permission FEBS Journal 276 (2009) 2657–2668 ª 2009 The Authors Journal compilation ª 2009 FEBS 2659 Methods for 3¢ end amplification from SAGE tags A W.-J Xu et al B mRNA 5′ Anneal first strand Primer to mRNA NBAAAAAAA-3′ NVTTTTTTT GGG CCC cDNA first strand synthesis GGG CCC NBAAAAAAA NVTTTTTTT 16 16 Modified oligo (dT) 5′-cap oligo 5′ GGG CCC PLF mRNA Tag-specific primer NBAAAAAAA-3′ NVTTTTTTT 16 GGATCC 16 The 1st PCR Modified oligo (dT) GGATCC GGG CCC NBAAAAAAA NVTTTTTTT 16 NBAAAAAAA NVTTTTTTT cDNAs synthesis UP-I NBAAAAAAA NVTTTTTTT 16 The 2nd PCR PLR UP-II GGATCC GGG CCC NBAAAAAAA NVTTTTTTT cDNA library NBAAAAAAA NVTTTTTTT 16 16 UP-II Fig Detailed mechanism of amplification of whole cDNAs and the TSAT-PCR technique (A) Amplification of full-length cDNAs (B) Procedure for the nested PCR reactions This figure is reproduced from [39] Fig Schematic of the rSAGE method Some steps are the same as those in the SAGE protocol This figure is reproduced from [35] with permission 2660 FEBS Journal 276 (2009) 2657–2668 ª 2009 The Authors Journal compilation ª 2009 FEBS W.-J Xu et al (see the protocol in Scheme in the Appendix for more details) Compared with the original GLGI technique, the high-throughput GLGI procedure has several new features [32]: (a) 3¢ cDNAs after the last CATG rather than full-length cDNAs are used as the templates for GLGI amplification, decreasing the complexity of the templates and thus reducing possible nonspecific amplification; (b) the 3¢ cDNAs are enriched by PCR to provide sufficient templates for high-throughput GLGI analysis; (c) a single antisense primer (5¢-ACTATCTAGAGCGGCCGCTT-3¢) is used for the GLGI reaction, instead of the three anchored oligo(dT) primers (dT11A, G, C) in the original GLGI technique; (d) platinum DNA polymerase rather than Pfu DNA polymerase is used for GLGI amplification; and (e) direct precipitation of GLGI-amplified products and cloning into vectors without gel purification prevents the potential loss of amplified products These changes will enhance the capabilities of the revised GLGI procedure, and the modified process is highly specific, low-cost and highly efficient [32] However, the high-throughput GLGI procedure still involves many steps, and is thus very time-consuming Moreover, clones may contaminate each other due to incautious manipulation when all experiments are simultaneously performed in a 96-well plate Two-step analysis of unknown SAGE tags (TSAT-PCR) Given the disadvantages of the above techniques, Xu et al proposed two-step analysis of unknown SAGE tags (TSAT-PCR) based on the nested PCR and RACE technology The TSAT-PCR process can be divided into two steps First, full-length cDNAs are amplified by PCR using RACE technology [40–42] Then the amplified cDNAs are used as templates for TSAT-PCR to obtain the 3¢ cDNA fragments by two-step nested PCR As shown in Fig 3, TSAT-PCR has the following key features First, it uses a modified lock-docking oligo(dT) primer, with two degenerate nucleotide positions at the 3¢-end, as a reverse primer to synthesize the first-strand cDNA, which eliminates the 3¢ heterogeneity inherent in conventional oligo(dT) priming [14], thereby increasing the specificity in the subsequent PCR Second, amplification of full-length cDNAs, especially low-abundance cDNAs, provides sufficient templates not only for the subsequent PCR but also for 5¢-RACE, 3¢-RACE and northern blotting, etc Finally, the two-step nested PCR principle can easily produce 3¢-end cDNA tag-specific frag- Methods for 3¢ end amplification from SAGE tags ments from the SAGE tags (see the protocol in Scheme in the Appendix for more details) The greatest advantage of TSAT-PCR is that it can easily obtain specific PCR products covering the sequences of SAGE tags from those transcripts, especially low-abundance transcripts However, like the other methods, this method cannot completely avoid nonspecific amplifications because short SAGE tags can decrease the annealing temperature of PCR Modified reverse SAGE (rSAGE) The rSAGE method was first developed in the Kinzler ⁄ Vogelstein laboratories [43,44] by using the SAGE protocol as a reference to isolate cDNA fragments corresponding to novel SAGE tags that not match EST databases using a PCR-based method Subsequently, Richards et al amended the method and proposed a modified reverse SAGE [35] Many steps of rSAGE are similar, even identical, to those of SAGE, and many reagents are shared by these two protocols Figure shows the detailed process (see protocol in Scheme in the Appendix for more details) As shown in Fig 4, steps 1–5 are shared by the SAGE protocol, while the following two PCRs are the essence of rSAGE The first PCR enriches the 3¢ end cDNA fragments as the templates for the second PCR using primer ⁄ M13F Then specific products are amplified using primer Ptag ⁄ M13F Primer Ptag has the 14-base tag sequence plus and additional 7–10 bases at the 5¢ ends of linker 2A, resulting in a primer with a high melting temperature > 60 °C Unlike the methods described above, this primer (Ptag) eliminates most nonspecific fragments resulting from use of a short SAGE tag Nevertheless, the rSAGE method also has its deficiencies, and step (linker ligation) of the rSAGE protocol cannot avoid self-ligation of the cDNA, which will lead to smearing in the subsequent PCR amplification In addition, the rSAGE method requires more initial total RNA and poly(A)+, because of the loss of RNA at each step [36] Conclusions In summary, despite many shortcomings, the methods discussed above have various advantages As a result of their development, 3¢ or 5¢ longer cDNA fragments can be extended from SAGE tags Thus, more cDNA sequences information about novel SAGE tags, e.g transcriptional start sites [45–47], polyadenylation sites [20], homology analysis, etc may be obtained Thus, full-length gene sequences can be isolated easily from novel SAGE tags Development of these methods has FEBS Journal 276 (2009) 2657–2668 ª 2009 The Authors Journal compilation ª 2009 FEBS 2661 Methods for 3¢ end amplification from SAGE tags W.-J Xu et al extended the widespread use of high-throughput SAGE techniques, and hence accelerated the annotation from tags to genes and genes to genome 12 Acknowledgements This work was supported by the Shanghai Leading Academic Discipline Project (B205) and the National Key Basic Research Program (2009CB941704) 13 References 14 Wahl MB, Heinzmann U & Imai K (2005) LongSAGE analysis significantly improves genome annotation: identifications of novel genes and alternative transcripts in the mouse Bioinformatics 21, 1393–1400 Stein L (2001) Genome annotation: from sequence to biology Nat Rev Genet 2, 493–503 Kanehisa M & Bork P (2003) Bioinformatics in the post-sequence era Nat Genet 33, S305–S310 Velculescu VE, Zhang L, Vogelstein B & Kinzler KW (1995) Serial analysis of gene expression Science 270, 484–487 Velculescu VE, Zhang L, Zhou W, Vogelstein J, Basrai MA, Bassett DE Jr, Hieter P, Vogelstein B & Kinzler KW (1997) Characterization of the yeast transcriptome Cell 88, 243–251 Yamashita T, Hashimoto S, Kaneko S, Nagai S, Toyoda N, Suzuki T, Kobayashi K & Matsushima K (2000) Comprehensive gene expression profile of a normal human liver Biochem Biophys Res Commun 269, 110–116 Matsumura H, Reich S, Ito A, Saitoh H, Kamoun S, Winter P, Kahl G, Reuter M, Kruger DH & Terauchi R (2003) Gene expression analysis of plant host–pathogen interactions by SuperSAGE Proc Natl Acad Sci USA 100, 15718–15723 Boon WM, Beissbarth T, Hyde L, Smyth G, Gunnersen J, Denton DA, Scott H & Tan SS (2004) A comparative analysis of transcribed genes in the mouse hypothalamus and neocortex reveals chromosomal clustering Proc Natl Acad Sci USA 101, 14942–14977 Halaschek-Wiener J, Khattra JS, McKay S, Pouzyrev A, Stott JM, Yang GS, Holt RA, Jones SJ, Marra MA, Brooks-Wilson AR et al (2005) Analysis of long-lived C elegans daf-2 mutants using serial analysis of gene expression Genome Res 15, 603–615 10 Ryu EJ, Angelastro JM & Greene LA (2005) Analysis of gene expression changes in a cellular model of Parkinson disease Neurobiol Dis 18, 54–75 11 Zhao YX, Li QL, Yao CJ, Wang ZX, Zhou Y, Wang YJ, Liu LM, Wang YF, Wang LY & Qiao ZD (2006) Characterization and quantification of mRNA transcripts in ejaculated spermatozoa of fertile men by serial 2662 15 16 17 18 19 20 21 22 23 analysis of gene expression Human Reprod 21, 1583– 1590 Li QL, Zhao YX, Ni B, Yao CJ, Zhou Y, Xu WJ, Wang ZX & Qiao ZD (2008) Comparison of the expression profiles of promastigotes and axenic amastigotes in Leishmania donovani using serial analysis of gene expression Parasitol Res 103, 821–828 Velculescu VE, Madden SL, Zhang L, Lash AE, Yu J, Rago C, Lal A, Wang CJ, Beaudry GA, Ciriello KM et al (1999) Analysis of human transcriptomes Nat Genet 23, 387–388 Zhang L, Zhou W, Velculescu VE, Kern SE, Hruban RH, Hamilton SR, Vogelstein B & Kinzler KW (1997) Gene expression profiles in normal and cancer cells Science 276, 1268–1272 Madden SL, Galella EA, Zhu J, Bertelsen AH & Beaudry GA (1997) SAGE transcript profiles for p53-dependent growth regulation Oncogene 15, 1079–1085 Hibi K, Liu Q, Beaudry GA, Madden SL, Westra WH, Wehage SL, Yang SC, Heitmiller RF, Bertelsen AH, Sidransky D et al (1998) Serial analysis of gene expression in non-small cell lung cancer Cancer Res 58, 5690– 5694 Hashimoto S, Suzuki T, Dong HY, Nagai S, Yamazaki N & Matsushima K (1999) Serial analysis of gene expression in human monocyte-derived dendritic cells Blood 94, 845–852 Peters BA, Croix BS, Sjoblom T, Cummins JM, Silliă man N, Ptak J, Saha S, Kinzler KW, Christos Hatzis C & Velculescu VE (2007) Large-scale identification of novel transcripts in the human genome Genome Res 17, 287–292 ´ Rivals E, Boureux A, Lejeune M, Ottones F, Perez OP, Tarhio J, Pierrat F, Ruffle F, Commes T & Marti J (2007) Transcriptome annotation using tandem SAGE tags Nucleic Acids Res 35, e108, doi:10.1093/nar/ gkm495 Wei CL, Ng P, Chiu KP, Wong CH, Ang CC, Lipovich L, Liu ET & Ruan Y (2004) 5¢ Long serial analysis of gene expression (LongSAGE) and 3¢ LongSAGE for transcriptome characterization and genome annotation Proc Natl Acad Sci USA 101, 11701–11706 Khattra J, Delaney AD, Zhao Y, Siddiqui A, Asano J, McDonald H, Pandoh P, Dhalla N, Prabhu AL, Ma K et al (2007) Large-scale production of SAGE libraries from microdissected tissues, flow-sorted cells, and cell lines Genome Res 17, 108–116 Matsumura H, Reuter M, Kruger DH, Winter P, Kahl ă G & Terauchi R (2008) SuperSAGE Methods Mol Biol 387, 55–70 Peters DG, Kassam AB, Yonas H, O’Hare EH, Ferrell RE & Brufsky AM (1999) Comprehensive transcript analysis in small quantities of mRNA by SAGE-lite Nucleic Acids Res 27, e39 FEBS Journal 276 (2009) 2657–2668 ª 2009 The Authors Journal compilation ª 2009 FEBS W.-J Xu et al 24 Saha S, Sparks AB, Rago C, Akmaev V, Wang CJ, Vogelstein B, Kinzler KW & Velculescu VE (2002) Using the transcriptome to annotate the genome Nat Biotechnol 20, 508–512 25 Gowda M, Jantasuriyarat C, Dean RA & Wang GL (2004) Robust-LongSAGE (RL-SAGE): a substantially improved LongSAGE method for gene discovery and transcriptome analysis Plant Physiol 134, 890–897 26 Heidenblut AM, Luttges J, Buchholz M, Heinitz C, ă Emmersen J, Nielsen KL, Schreiter P, Souquet M, Nowacki S, Herbrand U et al (2004) aRNA-longSAGE: a new approach to generate SAGE libraries from microdissected cells Nucleic Acids Res 32, e131 27 Kodzius R, Kojima M, Nishiyori H, Nakamura M, Fukuda S, Tagami M, Sasaki D, Imamura K, Kai C, Harbers M et al (2006) CAGE: cap analysis of gene expression Nat Methods 3, 211–222 28 Neilson L, Andalibi A, Kang D, Coutifaris C, Strauss JF III, Stanton JA & Green DP (2000) Molecular phenotype of the human oocyte by PCR-SAGE Genomics 63, 13–24 29 Lee S, Chen J, Zhou G & Wang SM (2001) Generation of high quality and quantity of tag ⁄ ditag for SAGE analysis BioTechniques 31, 348–354 30 Wahl M, Shukunami C, Heinzmann U, Hamajima K, Hiraki Y & Imai K (2004) Transcriptome analysis of early chondrogenesis in ATDC5 cells induced by bone morphogenetic protein Genomics 83, 45–58 31 Siddiqui AS, Khattra J, Delaney AD, Zhao Y, Astell C, Asano J, Babakaiff R, Barber S, Beland J, Bohacec S et al (2005) Large-scale digital gene-expression profiles from precisely defined developing C57BL ⁄ 6J mouse tissues and cells Proc Natl Acad Sci USA 102, 18485– 18490 32 Chen J, Lee S, Zhou G & Wang SM (2002) Highthroughput GLGI procedure for converting a large number of serial analysis of gene expression tag sequences into 3¢ complementary DNAs Genes Chromosomes Cancer 33, 252–261 33 van den Berg A, van der Leij J & Poppema S (1999) Serial analysis of gene expression: rapid RT-PCR analysis of unknown SAGE tags Nucleic Acids Res 27, e17 34 Chen JJ, Rowley JD & Wang SM (2000) Generation of longer cDNA fragments from serial analysis of gene expression tags for gene identification Proc Natl Acad Sci USA 97, 349–353 35 Richards M, Tan SP, Chan WK & Bongso A (2006) Reverse serial analysis of gene expression (SAGE) characterization of orphan SAGE tags from human Methods for 3¢ end amplification from SAGE tags 36 37 38 39 40 41 42 43 44 45 46 47 embryonic stem cells identifies the presence of novel transcripts and antisense transcription of key pluripotency genes Stem Cells 24, 1162–1173 Vanpoucke G, Orr B, Grace OC, Chan R, Ashley GR, Williams K, Franco OE, Hayward SW & Thomson AA (2007) Transcriptional profiling of inductive mesenchyme to identify molecules involved in prostate development and disease Genome Biol 8, R213 Wu SM, Baxendale V, Chen Y, Pang AL, Stitely T, Munson PJ, Leung MY, Ravindranath N, Dym M, Rennert OM et al (2004) Analysis of mouse germ-cell transcriptome at different stages of spermatogenesis by SAGE: biological significance Genomics 84, 971–981 Silva AP, Chen J, Carraro DM, Wang SM & Camargo AA (2004) Generation of longer 3¢ cDNA fragments from massively parallel signature sequencing tags Nucleic Acids Res 32, e94, doi:10.1093/nar/gnh095 Xu WJ, Li QL, Yao CJ, Wang ZX, Zhao YX & Qiao ZD (2008) Semi-nested PCR analysis of unknown tags on serial analysis of gene expression FEBS J 275, 5422–5428 Schaefer BC (1995) Revolutions in rapid amplification of cDNAends: new strategies for polymerase chain reaction cloning of full-length cDNA ends Anal Biochem 227, 255–273 Frohman MA (1993) Rapid amplification of complementary DNA ends for generation of full-length complementary DNAs: thermal RACE Meth Enzymol 218, 340–356 Das M, Harvey I, Chu LL, Sinha M & Pelletier J (2001) Full-length cDNAs: more than just reaching the ends Physiol Genomics 6, 57–80 Polyak K, Xia Y, Zweier JL, Kinzler KW & Vogelstein B (1997) A model for p53-induced apoptosis Nature 389, 300–305 Yu J, Zhang L, Hwang PM, Rago C, Kinzler KW & Vogelstein B (1999) Identification and classification of p53-regulated genes Proc Natl Acad Sci USA 96, 14517–14522 Hashimoto S, Suzuki Y, Kasai Y, Morohoshi K, Yamada T, Sese J, Morishita S, Sugano S & Matsushima K (2004) 5¢-End SAGE for the analysis of transcriptional start sites Nat Biotechnol 22, 1146– 1149 Kasai Y, Hashimoto S, Yamada T, Sese J, Sugano S, Matsushima K & Morishita S (2005) 5¢SAGE: 5¢-end serial analysis of gene expression database Nucleic Acids Res 33, D550–D552 Harbers M & Carninci P (2005) Tag-based approaches for transcriptome research and genome annotation Nat Methods 2, 495–502 FEBS Journal 276 (2009) 2657–2668 ª 2009 The Authors Journal compilation ê 2009 FEBS 2663 Methods for 3Â end amplification from SAGE tags W.-J Xu et al Appendix Scheme – high-throughput GLGI procedure Step cDNA synthesis with 5¢ biotinylated, 3¢anchored oligo(dT) primers Prepare total RNA using Trizol RNA isolation reagent (Invitrogen, Carlsbad, CA, USA), and isolate mRNA from total RNA using oligo(dT)25 Dynabeads (Dynal, Oslo, Norway) Synthesize poly(dA ⁄ dT) cDNAs using 5¢ biotinylated, 3¢anchored oligo(dT) primers Step NlaIII digestion Digest double-stranded cDNAs NlaIII [see SAGE protocol (www.sagenet.org/protocol) for more details] Step Binding of biotinylated cDNA to magnetic beads Isolate 3¢ cDNAs using streptavidin beads (Dynal) (see SAGE protocol) Step Linker ligation Ligate SAGE linker A or B to the 3¢ cDNAs bound to the streptavidin beads (see SAGE protocol) After ligation, wash beads four times with x B+W [10 mm Tris-HCl (pH 7.5), mm EDTA, m NaCl; store at room temperature], transfer the last wash mixture to clean microfuge tubes Proceed immediately to the next step Step 3¢ cDNA amplification Make several dilutions of the ligation product Usually lL of ⁄ 50 and ⁄ 300 dilutions are recommended as templates for PCR Perform PCR using the SAGE sense primer and the universal antisense primer with platinum Taq polymerase (Life Technologies, Gaithersburg, MD) and an annealing temperature of 55 °C Purify and resuspend the amplified templates in Tris-EDTA (TE) buffer, pH 8.0 for GLGI amplification Step Prepare GLGI master mixture and all tag-specific primers Prepare GLGI master mixture (described below) containing the GLGI antisense primer and the amplified cDNA templates (step above), and DNA polymerase Synthesize tag-specific primers in a 96-well plate (Integrated DNA Technologies, Coralville, IA), with each tag-specific primer included in a single well Adjust the concentration of primers to 50 ngỈlL)1 using TE Step GLGI amplification Transfer the GLGI master mixture by aliquots into a 96-well PCR plate (Applied Biosystems, Foster City, CA), and then add 1.4 lL each tag-specific primer (70 ng) to each well Precipitate the amplified products directly in the PCR plate by addition to each well of 100 lL of precipitation mixture I (described below) Seal the plate vortex, and keep them at room temperature for 15 Centrifuge at 4000 g for 35 at °C, then remove the supernatants Add 150 lL of 70% ethanol per well, and centrifuge again at 4000 g for 15 to wash the DNA pellets Remove the supernatants Dry the pellets in air, and dissolve in lL H2O Step Cloning GLGI products Clone GLGI-amplified cDNAs in a 96-well plate into vector for sequencing Step Amplifying GLGI clones Use direct-colony PCR to amplify GLGI clones, and screen four colonies if there are ‡ 50 copies tag, or six colonies if < 50 copies of tag Transfer the PCR master mixtures as aliquots into 96-well PCR plates at 25 lL per well Move the 2664 FEBS Journal 276 (2009) 2657–2668 ª 2009 The Authors Journal compilation ª 2009 FEBS W.-J Xu et al Methods for 3¢ end amplification from SAGE tags colonies directly from plates to wells using sterile pipette tips Precipitate the PCR products by addition of 75 lL of precipitation mixture II (described below) per well Seal, vortex, and keep the plate at room temperature for Centrifuge the plate at 4000 g for 35 at °C, and remove the supernatants Add 150 lL of 70% ethanol per well to wash the DNA pellets Centrifuge the plate at 4000 g for 25 at °C, and remove the supernatants Dry the pellets in air and dissolve in 10 lL H2O Step 10 Sequencing GLGI clones Perform the sequencing reaction in a total volume of lL (including lL master sequencing mixtures (described below) and lL DNA template) for each reaction Precipitate the sequencing products by addition of 75 lL of precipitation mixture III (described below) per well Seal, vortex, and keep the plate at room temperature for 2–5 Centrifuge the plate at 4000 g for 35 at °C, and remove the supernatant Add 150 lL of 70% ethanol per well to wash the DNA pellets Centrifuge the plate at 4000 g for 15 at °C, and remove the supernatants Dry the pellets in air and dissolve in lL of sequencing loading dye (Applied Biosystems) Load the sequencing products (0.7–1 lL) onto a 5–6% sequencing gel with 96 lanes, and determine the sequences using an ABI377 sequencer (Applied Biosystems) Step 11 Verify the tag sequence Once the complete sequence of the PCR product has been obtained, check the tag to see whether its location is right after the last CATG site before the polyA signal in the PCR product, if possible, before further analysis Match the sequences to the GenBank database using BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) to determine whether the sequences generated from SAGE tags match known sequences, mismatch, or match unknown sequences in GenBank Reagents and primers GLGI master mixture (28.6 lL per reaction): lL 10 ·PCR buffer, 1.2 lL MgCl2 (50 mm), 0.6 lL dNTPs (10 mm), 1.4 lL universal antisense primer (50 ngỈlL)1), lL (0.5–5 ng) amplified cDNA templates (step above), 0.3 lL platinum Taq DNA polymerase (5 lL)1), and ddH2O up to a total volume of 28.6 lL Precipitation mixture I: lL of glycogen (20 mgỈmL)1; Roche, Indianapolis, IN), 15 lL of 7.5 m NH4Ac, and 84 lL of 100% ethanol Precipitation mixture II: 22 lL of H2O, 15 lL of m NaClO4, and 38 lL of 2-propanol Precipitation mixture III: 64 lL of a 100% ethanol ⁄ m NaAc mixture (25 : 1), lL of glycogen (20 mgỈmL)1; Roche), and 10 lL of H2O Master sequencing mixtures: 0.7 lL of Big-Dye premixture (Applied Biosystems), 1.5 lL of dilution buffer (400 mm Tris ⁄ HCl at pH 9.0 and 10 mm MgCl2), 0.3 lL of 100 ngỈlL)1 sequencing primer (M13 forward primer or M13 reverse primer), and 1.5 lL of H2O 5¢ Biotinylated, 3¢anchored oligo(dT) primers: 5¢biotin-ATCTAGAGCGGCCGC-T16 VN-3¢, where N = A, C, G or T, and V = A, G or C Linker A: 5¢-TTTGGATTTGCTGGTGCAGTACAACTAGGCTTAATAGGGACATG-3¢ and 5¢-pTCCCT ATTAA GCCTAGTTGTACTGCACCAGCAAATCC-amino modified C7 -3¢ Linker B: 5¢-TTTCTGCTCGAATTCAAGCTTCTAACGATGTACGGGGACATG-3¢ and 5¢-pTCCCCGTACATCGT TAGAAGCTTGAATTCGAGCAG-amino modified C7 -3¢ SAGE sense primer: 5¢-GGATTTGCTGGTGCAGTACA-3¢ for linker A or 5¢-CTGCTCGAATTCAAGCTTCT-3¢ for linker B Universal antisense primer: 5¢-ACTATCTAGAGCGGCCGCTT-3¢ Tag-specific primer: 5¢-GGATCCCATGXXXXXXXXXX-3¢, where GGATCC is the BamHI site, and CATG(X)10 is the tag FEBS Journal 276 (2009) 2657–2668 ª 2009 The Authors Journal compilation ª 2009 FEBS 2665 Methods for 3¢ end amplification from SAGE tags W.-J Xu et al Scheme – protocol for TSAT-PCR Step Full-length double-stranded cDNA synthesis with modified lock-docking oligo(dT) and 5¢-cap oligonucleotide primer Prepare total RNA using Trizol RNA isolation reagent (Invitrogen) Synthesize double-stranded cDNAs using the modified oligo(dT) primer and the 5¢-cap oligonucleotide primer and PrimeScript reverse transcriptase (TaKaRa, Dalian, China) according to the manufacturers’ instructions Step Amplification of the full-length cDNAs Use lL of the RT-PCR reaction liquor as template to enrich the full-length cDNAs by PCR using primers PLF and PLR and Takara Ex Taq Hot Start Step PCR amplification with tag-specific primer (Ptag) and UP-I Make several dilutions of the amplified full-length cDNAs above: lL of a ⁄ 1000 dilution is recommended for PCR with tag-specific primer (Ptag) and UP-I, but this may differ by a factor of 10 in different experiments Step PCR amplification with tag-specific primer (Ptag) and UP-II Dilute the resulting PCR product (step 3) to ⁄ 500–1 ⁄ 2500 using sterile H2O, and use a lL aliquot of a 1/1000 dilution as template for the subsequent PCR with tag-specific primer (Ptag) and UP-II Step PCR product isolation and sequencing After visualizing specific PCR product on an agarose gel, excise and purify individual bands, and cloned into T-vectors Step Verification of tag sequence Once the complete sequence of the PCR product has been obtained, check the tag to see whether its location is right after the last CATG site before the polyA signal in the PCR product, if possible, before further analysis Primers Modified oligo(dT) primer: 5¢-CCAGACACTATGCTCATACGACGCAG(T)16VN-3¢, where N = A, C, G or T, and V = A, G or C 5¢-cap oligonucleotide primer: 5¢-AAGCAGTGGTATCAACGCAGAGTACGCGGG-3¢ PLF: 5¢-AAGCAGTGGTATCAACGCAGAGT-3¢ PLR: 5¢-CCAGACACTATGCTCATACGACG-3¢ Tag-specific primer: 5¢-GGATCCCATGXXXXXXXXXX-3¢, where GGATCC is the BamHI site, and CATG(X)10 is the tag UP-I: 5¢-CCAGACACTATGCTCATA-3¢ UP-II: 5¢-CACTATGCTCATACGACGCAGT-3¢ Scheme – modified reverse SAGE (rSAGE) method Step cDNA synthesis with modified oligo(dT) primer Prepare total RNA and polyA+ (approximately 2–5 lg is needed for good representation) as described in the SAGE protocol (www.sagenet.org/protocol) 1st strand cDNA using a Superscript choice system for cDNA synthesis kit (GibcoBRL catalog number 18090019) primed using gel-purified RT primer oligo, and save one-tenth of the volume for electrophoresis Follow the SAGE protocol (www.sagenet.org/protocol) instructions for 2nd strand synthesis Precipitate the 2666 FEBS Journal 276 (2009) 2657–2668 ª 2009 The Authors Journal compilation ª 2009 FEBS W.-J Xu et al Methods for 3¢ end amplification from SAGE tags resulting cDNA, resuspend it in 22 lL LoTE [3 mm Tris-HCl (pH 7.5), 0.2 mm EDTA (pH 7.5) in dH2O; store at °C] and save lL for electrophoresis according to the SAGE protocol (www.sagenet.org/protocol) instructions Analyze the saved 1st and 2nd strand cDNA products together with a kb ladder on a 1.2% agarose gel stained with ethidium bromide for h Proceed if the expected pattern is observed Step NlaIII digestion See SAGE protocol Step Binding of biotinylated cDNA to magnetic beads See SAGE protocol Step Linker ligation See SAGE protocol Only linkers A1 and A2 are used in rSAGE They are used at one-fifth of the amount used in SAGE the SAGE protocol (www.sagenet.org/protocol) The same linker prepared for SAGE can be used if it is less than months old Otherwise, linker A1 and A2 should be treated with T4 Ligase and tested for self-ligation as described in the SAGE protocol Divide the beads intoclean microfuge tubes and proceed After ligation, wash beads four times with · B+W, transfer the last wash mixture into clean microfuge tubes Proceed immediately to the next step Step AscI digestion to release the 3¢ cDNA fragments from the beads Resuspend the beads and add AscI components into tubes After digestion, collect supernatant carefully using a magnet Extract once with PC8 [480 mL phenol (heat to 65 °C), 320 mL 0.5 m Tris-HCl (pH 8.0), 640 mL chloroform; add in sequence, shake, and place at °C; after 2–3 h shake again; after another 2–3 h, aspirate aqueous layer; aliquot and store at )20 °C] and high-concentration ethanol precipitate (see SAGE protocol), and resuspend DNA in 25 lL LoTE The ligation is the primary rSAGE library Step Generation of amplified rSAGE library by PCR using primers rSAGEF1 and rSAGER1 Make several dilutions of the ligation product: lL of ⁄ 50 and ⁄ 300 dilutions is recommended for PCR, but can differ by a factor of 10 due to variations in yield Analyze 10 lL of the PCR product on a 4–20% Novex gel (Invitrogen, Carlsbad, CA, USA) along with kb ladder A strong smear (predominantly in the 100–700 bp range) should be visible after staining with ethidium bromide The PCR products of these dilutions are the amplified rSAGE library Step SAGE tag-specific primer Design a gene-specific forward primer in such a way that the bold letters [14 bases or 15 bases if an additional base can be determined by sage 2000 version 4.5 software (http://www.sagenet.org)] are included, plus an additional 7–10 bases 5¢ of linker 2A Hence, the resulting primer has a melting temperature of approximately 60 °C [calculated as · the number of G ⁄ C bases + · the number of A ⁄ T bases], i.e 5¢-AAGCAGTGGTATCAACGCAGAGTCATGXXXXXXXXXXX3¢, where GGATCC is the BamHI site, and CATG(X)10 is the tag Step PCR amplification with tag-specific primer (TSP) At this stage, try to separate amplifications using various TSP ⁄ rSAGER1 primer pairs to obtain specific PCR products for each of the novel tags using lL of ⁄ 50 and ⁄ 300 dilutions of amplified rSAGE library as template Hot-start and touchdown PCR are highly recommended PCR conditions may require further optimization in terms of cycle number, template dilutions (amplified rSAGE) and temperature FEBS Journal 276 (2009) 2657–2668 ª 2009 The Authors Journal compilation ª 2009 FEBS 2667 Methods for 3¢ end amplification from SAGE tags W.-J Xu et al Step PCR product isolation and sequencing After visualizing specific PCR product on an agarose gel, excise and purify individual bands Sequencing of purified PCR product can be performed by the standard dideoxynucleotide termination method either manually or by an automatic sequencer Step 10 Verify the tag sequence Once the complete sequence of the PCR product has been obtained, check the tag to see whether its location is right after the last CATG site before the polyA signal in the PCR product, if possible, before further analysis If the presence of the tag is confirmed, the additional nucleotide sequence obtained, usually hundreds of base pair long, can assist BLAST searches If it is still not possible to match it to known sequence or ESTs, a novel gene might have been obtained The purified PCR product can be used as probe for northern blot analysis or library screening The additional sequence can also help to design primers for 5¢ RACE to isolate full-length cDNA if the mRNA is small Primers and linkers RT primer: 5¢-(biotin)ATTGGCGCGCCGCGAGCACTGAGTCAATACGA(T)30VN-3¢ rSAGER1: 5¢-GCGAGCACTGAGTCAATACGA-3¢ rSAGEF1: 5¢-AAGCAGTGGTATCAACGCAGAGT-3¢ TSP (tag-specific primer): See step Linker A1: 5¢-AAGCAGTGGTATCAACGCAGAGTCATG-3¢ Linker A2: 5¢-ACTCTGCGTTGATACCACTGCTT-amino-modified C7 -3¢ 2668 FEBS Journal 276 (2009) 2657–2668 ª 2009 The Authors Journal compilation ª 2009 FEBS ... nested PCR principle can easily produce 3¢- end cDNA tag-specific frag- Methods for 3¢ end amplification from SAGE tags ments from the SAGE tags (see the protocol in Scheme in the Appendix for more... (1999) Serial analysis of gene expression: rapid RT -PCR analysis of unknown SAGE tags Nucleic Acids Res 27, e17 34 Chen JJ, Rowley JD & Wang SM (2000) Generation of longer cDNA fragments from serial. .. serial analysis of gene expression tags for gene identification Proc Natl Acad Sci USA 97, 349–353 35 Richards M, Tan SP, Chan WK & Bongso A (2006) Reverse serial analysis of gene expression (SAGE)