Differential recognition of heat shock elements by members of the heat shock transcription factor family Noritaka Yamamoto1, Yukiko Takemori1, Mayumi Sakurai2, Kazuhisa Sugiyama2 and Hiroshi Sakurai1 Department of Clinical Laboratory Science, Kanazawa University Graduate School of Medical Science, Japan Department of Ophthalmology and Visual Science, Kanazawa University Graduate School of Medical Science, Japan Keywords crystallin; heat shock element; heat shock protein; heat shock response; heat shock transcription factor Correspondence H Sakurai, Department of Clinical Laboratory Science, Kanazawa University Graduate School of Medical Science, 5-11-80 Kodatsuno, Kanazawa, Ishikawa 920-0942, Japan Fax: +81 76 234 4369 Tel: +81 76 265 2588 E-mail: sakurai@kenroku.kanazawa-u.ac.jp (Received November 2008, revised 14 January 2009, accepted 21 January 2009) doi:10.1111/j.1742-4658.2009.06923.x Heat shock transcription factor (HSF), an evolutionarily conserved stress response regulator, forms trimers and binds to heat shock element (HSE), comprising at least three continuous inverted repeats of the sequence 5¢-nGAAn-3¢ The single HSF of yeast is also able to bind discontinuously arranged nGAAn units We investigated interactions between three human HSFs and various HSE types in vitro, in yeast cells, and in HeLa cells Human HSF1, a stress-activated regulator, preferentially bound to continuous HSEs rather than discontinuous HSEs, and heat shock of HeLa cells caused expression of reporter genes containing continuous HSEs HSF2, whose function is implicated in neuronal specification and spermatogenesis, exhibited a slightly higher binding affinity to discontinuous HSEs than did HSF1 HSF4, a protein required for ocular lens development, efficiently recognized discontinuous HSEs in a trimerization-dependent manner Among four human c-crystallin genes encoding structural proteins of the lens, heat-induced HSF1 preferred HSEs on the cA-crystallin and cB-crystallin promoters, whereas HSF4 preferred HSE on the cC-crystallin promoter These results suggest that the HSE architecture is an important determinant of which HSF members regulate genes in diverse cellular processes Heat shock transcription factor (HSF), a protein that is evolutionarily conserved from yeast to humans, is a major regulator of heat shock protein (HSP) expression Many HSPs function as molecular chaperones that aid the folding of damaged proteins, and increased accumulation of HSPs is essential for survival of cells exposed to protein-damaging stresses, including heat shock The structure of HSF comprises a conserved DNA-binding domain (DBD), which binds to the bp sequence nGAAn, and two hydrophobic repeat (HR) regions (HR-A and HR-B), which are necessary for homotrimer formation Trimeric HSF recognizes a heat shock element (HSE) comprising at least three inverted repeats of the bp unit [1,2] Biochemical and genetic evidence indicates that HSF regulates the expression of genes encoding proteins involved not only in stress resistance but also in cell maintenance and developmental processes [3–5] Saccharomyces cerevisiae HSF (yHSF) is encoded by a single gene and is essential for cell viability even under normal physiological conditions yHSF target genes encode proteins that function in protein folding, protein degradation, detoxification, energy generation, Abbreviations DBD, DNA-binding domain; EGS, ethylene glycol bis-(succinimidylsuccinate); hHSF, human heat shock transcription factor; HR, hydrophobic repeat; HSE, heat shock element; HSF, heat shock transcription factor; HSP, heat shock protein; mHSF, mouse heat shock transcription factor; SD, standard deviation; yHSF, Saccharomyces cerevisiae heat shock transcription factor 1962 FEBS Journal 276 (2009) 1962–1974 ª 2009 The Authors Journal compilation ª 2009 FEBS N Yamamoto et al carbohydrate metabolism, and maintenance of cell integrity [6–8] yHSF binds to and regulates gene expression via HSEs comprising variously arranged nGAAn units: a continuous perfect-type HSE, consisting of consecutive inverted repeats of the nGAAn unit (nTTCnnGAAnnTTCn); and a discontinuous gap-type or step-type HSE, which contains one insertion [nTTCnnGAAn(5 bp)nGAAn] or two insertions [nTTCn(5 bp)nTTCn(5 bp)nTTCn], respectively, between the nGAAn units [9,10] Schizosaccharomyces pombe HSF is also able to recognize these various HSE types [10] In mammalian cells, three related HSF proteins, HSF1, HSF2, and HSF4, are involved in different, but in some cases similar, biological functions HSF1 is ubiquitously expressed and functions as a key regulator for stress-induced transcription of HSP genes and for acquisition of thermotolerance [1,2,11] Analysis of HSF1 knockout mice indicates the involvement of HSF1 in extraembryonic development, carcinogenesis, and circadian control [12–14] HSF2 is widely expressed, and binds constitutively to the promoters of HSP genes to modulate their expression [15] During development, HSF2 is important for neuronal specification and spermatogenesis [16–18] Expression of HSF4 is restricted to the brain and lung, and is required for ocular lens development and fiber cell differentiation [19–22] There are two HSF4 isoforms, a and b HSF4b possesses a relatively weak activation domain and activates transcription, whereas this region is absent in HSF4a, which functions as a repressor [23–25] HSF1, HSF2 and HSF4 share significantly conserved DBDs, but they exhibit slightly different specificities for HSE binding in vitro [19,26,27] When human HSF (hHSF)1 is expressed in yHSFdeficient S cerevisiae cells, it fails to substitute for the cell viability function of yHSF, because its trimer formation is inhibited at normal growth temperatures [28] Mutant forms of hHSF1 that can trimerize in the absence of stress are able to substitute for yHSF cell viability function [10,28] In these cells, however, hHSF1 derivatives are defective in binding and activating transcription via discontinuous gap-type and steptype HSEs, indicating that hHSF1 recognizes HSEs in a different way from yHSF [10] In this study, we analyzed in vitro binding of hHSF1, hHSF2 and hHSF4 to various HSE types and characterized S cerevisiae and HeLa cells expressing hHSFs Our results show that the members of the hHSF family differentially recognize HSEs, and suggest that the regulated expression of different hHSF target genes is dependent upon the architecture of the HSE HSE-type specific recognition by human HSFs Results Human HSF1, HSF2 and HSF4 exhibit differential binding specificities for various HSE types in vitro Interactions between hHSFs and various HSE types were investigated using electrophoretic mobility shift assays with in vitro-synthesized polypeptides and oligonucleotide probes (Fig 1A) Protein–DNA complexes were formed when binding reactions were carried out using hHSF1-programmed transcription ⁄ translation mixtures, but not in control reaction mixtures that A B Fig Binding of hHSFs to various HSE types in vitro (A) Nucleotide sequences of four model HSEs The GAA and inverted TTC sequences are indicated in bold upper-case letters with arrows These HSE oligonucleotides were used as DNA probes for electrophoretic mobility shift assays and as cis-acting sequences for HSE– SV40p–LUC reporters (B) Electrophoretic mobility shift assay of hHSFs Typical results obtained using in vitro-synthesized hHSF1 (3.6 ng), hHSF2 (0.9 ng) and hHSF4 (3.6 ng) polypeptides are shown The reaction mixture programmed with vacant vector DNA was used as a control (C) The binding reaction was carried out at 37 or 43 °C for 20 with 32P-labeled oligonucleotides HSE4Ptt (4P), HSE3P (3P), HSEgap (G), HSEstep (S), or STRE (N) STRE oligonucleotide (TCGACACCCCTTATCTAGAGACCCCTTACCTCGA) was used as a nonspecific binding control Samples were subjected to gel electrophoresis and phosphorimaging Open and closed arrowheads indicate the positions of DNA fragments bound by one and two hHSF trimers, respectively The binding affinities relative to HSE3P are shown below each lane The experiments were performed at least three times, and yielded similar results FEBS Journal 276 (2009) 1962–1974 ª 2009 The Authors Journal compilation ª 2009 FEBS 1963 HSE-type specific recognition by human HSFs N Yamamoto et al were programmed with an empty vector (Fig 1B) Human HSF1 was able to bind to HSE4Ptt and HSE3P oligonucleotides containing four and three continuous, inverted nGAAn repeats, respectively hHSF1–HSE4Ptt migrated more slowly than hHSF1–HSE3P, and the amount of hHSF1–HSE4Ptt was 1.5-fold higher than that of hHSF1–HSE3P Previously, it was shown that 4Ptt-type HSE is bound by two trimers of Drosophila or Saccharomyces HSFs in a cooperative manner [29,30] This suggests that the slower migration of hHSF1– HSE4Ptt is a result of cooperative interaction of two hHSF1 trimers (Fig S1) Incubation of hHSF1 with gap-type (HSEgap) or step-type (HSEstep) HSE oligonucleotides resulted in complex formation, but the amounts were threefold and 20-fold lower, respectively, than that of hHSF1–HSE3P This demonstrates that hHSF1 preferentially binds to continuous HSEs Note that the interaction of hHSF1 with HSEs was stimulated without changing HSE specificity when the binding reaction was carried out at 43 °C rather than 37 °C (Fig 1B), as reported for binding of mouse HSF (mHSF)1 to an HSE containing four continuous, inverted nGAAn repeats [31] When hHSF2 polypeptide was incubated with perfecttype HSEs, the electrophoretic mobility and the amount of hHSF2–HSE4Ptt were almost the same as those of hHSF2–HSE3P (Fig 1B), indicating that a single hHSF2 trimer binds to HSE4Ptt Gap-type and steptype HSEs were recognized by hHSF2, although the binding affinity for HSEstep was threefold lower than that for HSE3P The amount of hHSF2 polypeptide used in the assay was fourfold lower than that of hHSF1 polypeptide, and the addition of fourfold more hHSF2 polypeptide to the reaction mixture caused an increase in the amount of hHSF2–HSE complexes without changing HSE specificity (Fig S1) Although it is unknown whether all polypeptides synthesized are active for binding, hHSF2 appears to have a higher binding affinity for at least discontinuous HSEs than does hHSF1 Human HSF4 was observed to bind as a single trimer to 4Ptt-type HSE, as judged from the amount and mobility of the complex (Fig 1B) Notably, the amount of complex formed with hHSF4 and HSEgap or HSEstep was more than 70% that of hHSF4– HSE3P Therefore, like yHSF, hHSF4 possesses the ability to bind to various HSE types comprising different configurations of nGAAn units Phenotypes of S cerevisiae cells expressing hHSF2 and hHSF4 We constructed S cerevisiae cells expressing hHSF2 and hHSF4, and analyzed their phenotypes In agree1964 ment with previous reports [23,28], yeast cells harboring hHSF2 and hHSF4 on low-copy-number (YCp) or high-copy-number (YEp) plasmid grew at temperatures below 35 and 33 °C, respectively (Fig 2A) The amounts of hHSF4 in cells harboring YCp-hHSF4 or YEp-hHSF4 (0.01–0.1 ng hHSF4Ỉlg)1 protein) were markedly lower than those of hHSF2 in cells harboring YCp-hHSF2 or YEp-hHSF2 (1–2 ng hHSF2Ỉlg)1 protein), for unknown reasons (Fig 2B) Using RT-PCR, we analyzed the mRNA levels of yHSF target genes containing 4P-type HSE (HSP42, HSP78, and KAR2), 3P-type HSE (APA1, HSP10, and SSA2), gap-type HSE (CPR6, CUP1, and HSP82), step-type HSE (FSH1, SGT2, and SSA3), and atypical HSE consisting of directly repeating nGAAn units and several irregular nGAAn units (DR-type; AHP1 and TIP1) [10] When yHSF cells grown at 28 °C were heat-shocked at 39 °C, the mRNA levels of target genes were significantly increased (Fig 2C) In yeast cells expressing hHSF2, the heat-induced transcription of all target genes analyzed was appropriately regulated, with the exception of transcriptional activation via step-type HSEs, which was slightly lower in hHSF2-expressing cells than in yHSF-expressing cells hHSF4 was also able to compensate for yHSF in the regulation of target gene expression; however, mRNA levels were slightly reduced in hHSF4 cells as compared to yHSF cells The low mRNA levels may be due to the relatively weak transcriptional activity [19,23] and ⁄ or the low-level expression of hHSF4 (Fig 2B) Unlike trimerizationprone hHSF1 derivatives, which fail to activate transcription of genes containing gap-type, step-type or DR-type HSEs in yeast cells [10], hHSF2 and hHSF4 activate transcription of various target genes, and thus support cell viability at elevated temperatures Heat-induced expression of reporter genes containing various HSE types in HeLa cells The transcriptional activity of various HSE types in mammalian cells was analyzed using reporter genes containing HSE oligonucleotides positioned upstream of the SV40 promoter–luciferase gene fusion (HSE– SV40p–LUC) In HeLa cells, insertion of HSEs in the reporter gene did not significantly affect the basal expression level under normal culture conditions (Fig 3A) This suggests that endogenous hHSFs are not involved in the expression, although it is possible that they bind to HSEs of reporter genes without affecting the expression When cells were heat-shocked at 43 °C for h and allowed to recover at 37 °C for h, expression of the reporter gene containing 4Ptt-type FEBS Journal 276 (2009) 1962–1974 ª 2009 The Authors Journal compilation ª 2009 FEBS N Yamamoto et al A HSE-type specific recognition by human HSFs hHSF2 YEp YCp hHSF4 YCp YEp yHSF 28 oC 33 oC 35 oC 37 oC B hHSF2 YCp 39 o C (min) 70 15 hHSF4 YEp YCp 15 15 YEp 15 NS 50 C hHSF2 yHSF YCp YEp hHSF4 YCp YEp 39 o C (min) 15 45 15 45 15 45 15 45 15 45 4P HSP42 Fig Characterization of yeast cells expressing hHSF2 and hHSF4 (A) Growth of hHSF cells Cells of strains HS170T (YCpyHSF), YYT49 (YCp-hHSF2), YYT42 (YEp-hHSF2), YYT50 (YCphHSF4) and YYT17 (YEp-hHSF4) were streaked onto YPD medium and incubated at the indicated temperatures for days (B) Immunoblot analysis of hHSF proteins Cells were grown in YPD medium at 28 °C and heat-shocked at 39 °C for the indicated times Extracts of cells expressing hHSF2 (2 lg of protein) or hHSF4 (20 lg of protein) and recombinant hHSF proteins (not shown) were subjected to immunoblot analysis with antibodies against hHSF2 and hHSF4 The positions of molecular mass markers are shown on the left in kilodaltons NS denotes nonspecific band The experiments were performed at least twice, and yielded similar results Cell extracts (1 lg of protein) of YYY49 and YYT42 contained approximately and ng of hHSF2, and those of YYT50 and YYT17 contained approximately 0.01 and 0.1 ng of hHSF4, as judged by the intensity of each band (C) mRNA levels in heatshocked hHSF cells Cells were grown in YPD medium at 28 °C and heat-shocked at 39 °C for the indicated times Total RNA prepared from the cells was subjected to RT-PCR analysis The genes targeted by yHSF are classified according to the structure of their HSEs: 4P, 3P, Gap, Step and DR (directly repeating nGAAn units and several irregular nGAAn units) types The experiments were performed at least three times and yielded similar results HSP78 KAR2 3P APA1 HSP10 SSA2 Gap CPR6 CUP1 HSP82 Step FSH1 SGT2 SSA3 DR AHP1 TIP1 control ACT1 HSE (HSE4Ptt–SV40p–LUC) was induced by more than 15-fold (Fig 3A) After heat shock, expression directed by 3P-type HSE was modestly induced ( 5-fold), but discontinuous gap-type and step-type HSEs failed to mediate the induction This suggests that heat-induced hHSF1 preferentially activates transcription of genes containing continuous HSEs Expression of HSE–SV40p–LUC reporter genes by hHSF–VP16 fusion proteins The activation potential of hHSF2 is significantly lower than that of hHSF1 [32], and hHSF4 is not appreciably expressed in HeLa cells [19] To explore HSE architecture-specific functions, the herpes simplex virus VP16 activation domain was fused to the C-ter- mini of hHSF1, hHSF2, and hHSF4, and the resulting hHSF–VP16 constructs were introduced into HeLa cells Fusion of the VP16 activation domain did not significantly affect the HSE specificity of hHSFs, as judged by electrophoretic mobility shift assay of in vitro-synthesized polypeptides (Fig S2) As shown by immunoblot analysis with an antibody against VP16, these fusion proteins were expressed in HeLa cells; however, the amount of hHSF2–VP16 was much lower than that of hHSF1–VP16 or of hHSF4–VP16, even when cells were transfected with 10-fold more hHSF2–VP16 expression construct (Fig 3B) It has been shown in HeLa cells that transfected hHSF1 forms oligomers and binds to HSEs at physiological temperatures [33] Consistent with the results of heat shock response, hHSF1–VP16 activated constitutive expression of SV40p–LUC reporters containing continuous HSEs, but the levels of activation for reporters containing discontinuous HSEs were less than twofold (Fig 3C) The reporter gene expression in the presence of hHSF2–VP16 was similar in pattern to that observed in the presence of hHSF1–VP16, except that HSEgap–SV40p–LUC expression was activated threefold In contrast, hHSF4–VP16 was a potent activator of reporter genes containing gap-type and step-type HSEs The HSE type-specific differences in transcription of these reporters were consistent with the in vitro binding affinity of each hHSF and HSE type, suggesting that hHSF1, hHSF2 and hHSF4 differentially recognize various HSEs in mammalian cells FEBS Journal 276 (2009) 1962–1974 ª 2009 The Authors Journal compilation ª 2009 FEBS 1965 * * hHSF4-VP16 B Heat shock Control None 4Ptt 3P Gap Step hHSF2-VP16 A N Yamamoto et al hHSF1-VP16 HSE-type specific recognition by human HSFs 83 2.5 10 20 Fold activation C hHSF2-VP16 hHSF1-VP16 None 4Ptt 3P Gap Step * NS 62 hHSF4-VP16 * * * * * * * * 10 20 10 20 10 20 Fold activation Fig Expression of artificial reporter genes containing various HSE types in HeLa cells (A) Heat shock-induced expression Cells were transfected with DNA mixtures containing 100 ng of SV40p–LUC plasmid (none) or HSE–SV40p–LUC plasmids (4Ptt, 3P, Gap, and Step) For heat shock experiment, cells were incubated at 43 °C for h, and culture was continued at 37 °C for h Luciferase activity (fold activation) was expressed relative to that of SV40p–LUC plasmid-transfected cells (control, left panel) or to that of cells grown at 37 °C (heat shock, right panel) Each bar represents the mean ± standard deviation (SD) for at least five experiments Asterisks indicate significant differences (P < 0.01) as compared with SV40p–LUC control as determined by Student’s t-test (B) Immunoblot analysis of hHSF–VP16 fusion proteins Cells were transfected with DNA mixtures containing 100 ng of reporter plasmid (lane –) and hHSF1–VP16 (10 ng), hHSF2–VP16 (100 ng) or hHSF4–VP16 (10 ng) expression constructs Extracts prepared from cells grown at 37 °C were subjected to immunoblotting using an antibody against VP16 The positions of molecular mass markers are shown on the left in kilodaltons NS denotes nonspecific band The experiments were performed at least twice, and yielded similar results (C) Constitutive expression in cells cotransfected with hHSF–VP16 plasmids Transfection was carried out described for (B) Luciferase activity (fold activation) was expressed relative to that of cells transfected with the reporter plasmid alone Each bar represents the mean ± SD for at least five experiments Asterisks indicate significant differences (P < 0.01) as compared with SV40p–LUC control as determined by Student’s t-test Efficient trimerization of hHSF4–VP16 is necessary for activation via discontinuous HSEs To locate the HSF4 region responsible for transcriptional regulation via discontinuous HSEs, we analyzed the transcriptional activity of various hHSF4–VP16 derivatives (Fig 4A,B) Human HSF4 contains a DBD at the N-terminus, HR-A and HR-B in the central region, and a relatively weak activation domain at the C-terminus [19] Deletion of the C-terminal half of hHSF4 (hHSF4-n355–VP16 and hHSF4-n217–VP16) did not significantly affect transcriptional activity or HSE specificity, with the exception of a slight decrease of HSE3P–SV40p–LUC expression by hHSF4-n355– VP16 hHSF4–VP16 lacking HR-B (hHSF4-n178– VP16) exhibited transcriptional activation via 3P-type HSE, but failed to so via gap-type or step-type HSEs An extended deletion construct leading to partial removal of HR-A (hHSF4-n159–VP16) was abundantly expressed but failed to activate transcription The roles of HR-A and HR-B were examined by introducing amino acid substitutions In hHSF4L140P–VP16 and hHSF4-I186P–VP16, a helix-destabi1966 lizing residue (proline) was substituted for a hydrophobic residue (leucine or isoleucine) in HR-A and HR-B, respectively To analyze oligomer formation of these hHSF4–VP16 derivatives, polypeptides synthesized in vitro were subjected to chemical crosslinking with ethylene glycol bis-(succinimidylsuccinate) (EGS) (Fig 4C) The band of approximately 220 kDa, which corresponds to the size of a trimer, was detected by treatment of wild-type hHSF4–VP16 with EGS The L140P and I186P substitutions appeared to inhibit trimer formation, and most of the polypeptides migrated at the position of a monomer (75 kDa) When an electrophoretic mobility shift assay was conducted (Fig 4D), the substitution derivatives and 3P-type HSE formed complexes exhibiting mobilities similar to that of wild-type hHSF4–VP16 trimer–HSE3P complex [this may be somewhat surprising; however, the complex formation might be supported by DBD–DBD and DBD–HSE3P interactions (see Discussion)] However, they exhibited reduced binding affinities for gap-type and step-type HSEs In HeLa cells, the L140P and I186P substitutions in hHSF4–VP16 inhibited transcriptional activation via gap-type and step-type HSEs, FEBS Journal 276 (2009) 1962–1974 ª 2009 The Authors Journal compilation ª 2009 FEBS * n355 217 VP16 I186P n159 355 VP16 B WT n178 493 VP16 n217 HR-A/B n355 DBD WT A HSE-type specific recognition by human HSFs L140P N Yamamoto et al 175 83 n217 NS 62 178 VP16 n178 159 VP16 ** * n159 493 VP16 L140P 493 VP16 3P Gap Step ** I186P 47.5 32.5 ** 25 * 10 20 Fold activation C D WT EGS (mM) L140P I186P 1.0 3.0 1.0 3.0 1.0 3.0 WT L140P I186P 3P G S 3P G S 3P G S 240 140 100 70 Fig Expression of reporter genes by hHSF4–VP16 derivatives in HeLa cells (A) Expression in cells cotransfected with hHSF4–VP16 derivatives Structures of hHSF4–VP16 derivatives are shown on the left The DBD and two HRs (HR-A ⁄ B) are shown Numbers indicate amino acid positions Vertical bars show the positions of amino acid substitutions Cells were transfected with DNA mixtures containing 100 ng of reporter plasmid and 10 ng of the indicated hHSF4–VP16 derivatives Luciferase activity (fold activation) was expressed relative to that of cells transfected with the reporter plasmid alone Each bar represents the mean ± SD for at least four experiments Asterisks indicate significant differences (P < 0.01) as compared with hHSF4–VP16 control as determined by Student’s t-test (B) Immunoblot analysis of hHSF4– VP16 derivatives Extracts were prepared from cells transfected as described for (A), and were subjected to immunoblot analysis Positions of molecular mass markers are shown on the left in kilodaltons NS denotes nonspecific band The experiments were performed at least twice, and yielded similar results (C) Chemical crosslinking analysis of hHSF4–VP16 derivatives In vitro-synthesized polypeptides (4.0 ng) were incubated without or with 1.0 and 3.0 mM EGS, and were subjected to immunoblot analysis Positions of molecular mass markers are shown on the left in kilodaltons Open and closed circles indicate the positions of hHSF4–VP16 monomers and trimers, respectively The experiments were performed at least twice, and yielded similar results (D) Electrophoretic mobility shift assay of hHSF4–VP16 derivatives Typical results using in vitro-synthesized polypeptides (4.0 ng) are shown as described for Fig 1B Open arrowheads indicate the positions of DNA fragments bound by a single hHSF4–VP16 trimer The experiments were performed at least three times, and yielded similar results but not via 3P-type HSE (Fig 4A) These results show that trimerization facilitated by HR-A ⁄ B is obligatory for binding of hHSF4 to discontinuous HSEs Differential expression of c-crystallin promoter– luciferase reporter genes by heat-induced hHSF1 and hHSF4–VP16 We next analyzed expression of the luciferase gene driven by promoters of the human c-crystallin genes, whose mouse orthologs are transcriptionally regulated by HSF1 and HSF4 [21,22] As shown in Fig 5A, the HSE of the cA-crystallin (CRYGA) promoter contains six GAA-like sequences, at positions 1, 2, 3, 4, 6, and CRYGA–LUC expression was induced eightfold by heat shock, and cotransfection of hHSF4–VP16 caused a fivefold increase in expression The cB-crystallin (CRYGB) HSE is similar to the CRYGA HSE in sequence and configuration of GAA-like sequences CRYGB–LUC expression was induced by heat shock and by hHSF4–VP16 cotransfection In electrophoretic mobility shift assays, DNA fragments containing the CRYGA and CRYGB HSEs were bound by hHSF1 and hHSF4–VP16 (Fig 5B) The cC-crystallin (CRYGC) promoter contains two HSEs: a distal 3P-like HSE, and a proximal HSE comprising six GAA-like sequences (p1, p2, p3, p5, p6, and p7) (Fig 5A) Unlike the expression observed for CRYGA–LUC and CRYGB–LUC, CRYGC–LUC expression was induced only threefold by heat shock, whereas cotransfection of hHSF4–VP16 caused a 14-fold increase in expression Human HSF1 bound to the proximal but not FEBS Journal 276 (2009) 1962–1974 ª 2009 The Authors Journal compilation ª 2009 FEBS 1967 HSE-type specific recognition by human HSFs N Yamamoto et al A B C Fig Expression of c-crystallin promoter-luciferase reporter genes in HeLa cells (A) Expression by heat-induced hHSF1 and by cotransfected hHSF4–VP16 Structures of the c-crystallin promoter–luciferase reporter genes are shown on the left Bars represent the crystallin genes, and open boxes indicate the HSEs The cC-crystallin promoter contains two HSEs, one at a distal (dHSE) position and one at a proximal (pHSE) position Numbers indicate nucleotide positions relative to the translation initiation site HSE sequences are shown in which the GAA and inverted TTC sequences are indicated by bold upper-case letters with numbers The nucleotides alterations are shown below the HSEs For heat shock experiments, cells were transfected with DNA mixtures containing 200 ng of the indicated reporter plasmid, and luciferase activity (fold activation) was determined as described for Fig 3A For cotransfection experiments, cells were transfected with DNA mixtures containing 200 ng of the indicated reporter plasmid and 10 ng of hHSF4–VP16 expression construct Luciferase activity (fold activation) was determined as described for Fig 3C Each bar represents the mean ± SD for at least four experiments Asterisks indicate significant differences (P < 0.01) as compared with wild-type control as determined by Student’s t-test (B) Electrophoretic mobility shift assay of hHSF1 and hHSF4–VP16 Typical results obtained using in vitro-synthesized hHSF1 (4.8 ng) and hHSF4–VP16 (3.0 ng) are shown as described for Fig 1B Probe fragments were prepared by PCR with primers flanking the putative HSEs of CRYGA ()217 to )157), CRYGB ()228 to )168), CRYGC (distal, )367 to )307; proximal, )234 to )174), and CRYGD ()247 to )187) The binding reaction was carried out at 37 °C (hHSF4–VP16) or 43 °C (hHSF1) for 20 Brackets indicate protein–DNA complexes (C) Electrophoretic mobility shift assay of hHSF1 The gel was electrophoresed longer than the gels of (B) to resolve DNA fragments bound by one (open arrowhead) and two (closed arrowhead) hHSF1 trimers 1968 FEBS Journal 276 (2009) 1962–1974 ª 2009 The Authors Journal compilation ª 2009 FEBS N Yamamoto et al distal HSE, and hHSF4–VP16 bound to both HSEs (Fig 5B) The cD-crystallin (CRYGD) promoter contains an HSE-like sequence comprising four GAA-like sequences, and CRYGD–LUC expression was induced twofold by heat shock (Fig 5A) However, hHSF1 may not be involved in the heat shock response, because it failed to bind the putative HSE under our assay conditions (Fig 5B) The putative HSE was only weakly bound by hHSF4–VP16, but hHSF4–VP16 cotransfection did not affect the expression of CRYGD–LUC (Fig 5A,B) These results show that heat shock-induced hHSF1 prefers cA-crystallin and cB-crystallin promoters, whereas hHSF4–VP16 prefers the cC-crystallin promoter HSF–HSE interactions were analyzed by introducing base alterations in the HSEs of reporter genes (Fig 5A) In CRYGA–LUC derivatives, the m1 reporter gene contained a 3P-like HSE (units 2, 3, and 4), a gap-like HSE (units 3, 4, and 6), and a step-like HSE (units 2, 4, and 6); the m2 reporter gene contained a gap-like HSE (units 3, 4, and 6); the m3 reporter contained a step-like HSE (units 2, 4, and 6); the m4 reporter gene lacked any apparent HSE; and the m6 reporter contained a 3P-like HSE (units 2, 3, and 4) The m1 and m6 reporter gene alterations significantly, but not completely, inhibited heat shock-induced expression, although these reporters contained a 3P-like HSE This result could be explained by a model in which wild-type CRYGA promoter is bound by two hHSF1 trimers; one trimer binding to units 1, 2, and 3, and the other binding to units and Consistently, hHSF1–wild-type complex migrated more slowly than hHSF1–m1 complex or hHSF1–m6 complex in electrophoretic mobility shift assays (Fig 5C) Expression of m2 and m3 reporters was reduced to the level of the m4 reporter, suggesting that gap-like and step-like HSEs of these reporters are nonfunctional for binding by hHSF1 (Fig 5A) In hHSF4–VP16 cotransfection experiments, unit of the CRYGA HSE was dispensable for activation (m1), although alterations of other units, including unit 6, caused significant inhibition of activation (m2, m3, m4, and m6) Similar results were obtained in electrophoretic mobility shift assays (Fig 5B) The observation that hHSF4–VP16 did not bind stably to sequences containing either 3P-like, gap-like or step-like HSEs might be explained by the divergence of GAA-like sequences from the canonical GAA sequence An alteration of either the distal or proximal HSE of CRYGC–LUC caused inhibition of hHSF4–VP16induced expression, suggesting that both HSEs are involved in hHSF4–VP16 binding (mdHSE and mp3,6) (Fig 5A) Notably, changing GAC to GAA in unit HSE-type specific recognition by human HSFs resulted in robust activation by hHSF4–VP16, without changing the magnitude of the heat shock response (cp3) The mutational analysis of the CRYGA and CRYGC HSEs suggests that the nucleotide sequences and configuration of nGAAn-like units are important for interaction with hHSF1 and hHSF4 Discussion In this study, we demonstrate that hHSF1, hHSF2 and hHSF4 differentially recognize HSEs comprising diversely arranged nGAAn units in vitro, in yeast cells, and in HeLa cells All three hHSFs bind to HSEs with continuous, inverted repeats of nGAAn In addition, hHSF4 exhibits a relatively higher affinity for discontinuous HSEs containing gaps between nGAAn units Trimerization facilitated by the HR-A ⁄ B is obligatory for hHSF4 recognition of discontinuous HSEs In addition to these results obtained with synthetic, model HSEs, hHSF4 exhibited a different specificity from heat shock-induced hHSF1 in interactions with the human c-crystallin promoters These results show that the configuration of nGAAn units in the promoter is important in determining which hHSF members are involved in the regulation of the gene Footprint analysis of the hHSF4–HSE interaction has shown that hHSF4 binding on the HSP70 promoter corresponds to a region that is identical to that observed with mHSF1 but is distinct from that observed with mHSF2 [19] It has been reported that, similar to hHSF1, hHSF4 expressed in yeast cells strongly activates transcription of SSA3, but only slightly activates transcription of CUP1 [23] Recently, Fujimoto et al [34] have shown that mHSF4 is required for induction of a set of genes in response to heat shock, in part by facilitating mHSF1 binding Although these results implied a similarity between hHSF1 and hHSF4 in HSE binding specificity, our data show that hHSF4 exhibits a binding specificity clearly distinguishable from that of hHSF1 and hHSF2, and is able to recognize discontinuously positioned nGAAn units We suggest that genes containing discontinuous HSEs are preferred targets for hHSF4 but not for hHSF1 or hHSF2 Consistently, Fujimoto et al [34] identified genomic regions that are occupied by only mHSF4, and showed that the HSF4 binding consensus sequence is more ambiguous than that of HSF1 and HSF2 Two hHSF4 isoforms, hHSF4a and hHSF4b, share the same DBD and HR-A ⁄ B, but function as a repressor and activator, respectively [23–25] Phosphorylation of HSF4b by extracellular signalrelated kinase leads to increased ability of hHSF4b to bind DNA [35] Therefore, genes containing discontin- FEBS Journal 276 (2009) 1962–1974 ª 2009 The Authors Journal compilation ª 2009 FEBS 1969 HSE-type specific recognition by human HSFs N Yamamoto et al uous HSEs are subject to positive and negative regulation by phosphorylated and unphosphorylated hHSF4 isoforms The L140P and I186P substitutions in hHSF4–VP16 inhibited binding to gap-type and step-type HSEs but not to 3P-type HSE In mammalian HSF1, HR-A ⁄ B interacts with the third HR region (HR-C) and maintains HSF1 in an inactive monomeric form under physiological conditions HR-A ⁄ B of transcriptionally active HSF1 mediates interactions among three monomers to form a trimer, thereby facilitating binding to the HSE [33,36,37] The linker region located between the DBD and HR-A ⁄ B also plays a role in oligomer formation [38] However, it remains unknown whether HR-A ⁄ B of mammalian HSFs is involved in the specificity of the HSF–HSE interaction In yHSF, HR-A ⁄ B has been shown to be necessary for interaction with promoters containing not only gap-type or step-type HSEs but also 3P-type HSE, but not with those containing four or more nGAAn units [9] Notably, the yHSF HR-A ⁄ B region can be substituted with a dimerization domain from an unrelated protein with no effect on the HSE-binding properties of the protein, which suggests that yHSF HR-A ⁄ B does not play an important role in the binding of HSEs, other than oligomerization [9,39] It has been shown that DBD–DBD interaction affects HSF trimerization and HSE binding [9,40–42] The HR-A ⁄ B-facilitated trimerization of hHSF4 was not obligatory for binding to continuous HSEs, suggesting that other, as yet unknown regions, including, potentially, the DBD, have roles in hHSF4– HSE interaction However, efficient trimerization was required for the interaction of hHSF4 with discontinuous HSEs, which indicates that this as yet unidentified region is not sufficient for binding to discontinuous HSEs By using synthetic model HSEs, we have shown that both hHSF1 and hHSF2 preferentially bind to continuous HSEs in vitro and in HeLa cells hHSF1 and hHSF2 consistently share the same target genes as judged by chromatin immunoprecipitation analysis [43] In binding to continuous HSEs, mHSF1 prefers long arrays of the nGAAn unit, whereas mHSF2 prefers short arrays [27] These differences are related to differences in the capability for cooperative interactions of trimers [26,27], which was confirmed by our electrophoretic mobility shift assay (Fig 1B) The wing region of the DBD facilitates interactions among mHSF1 trimers [41] We have shown that in vitro and in HeLa cells, hHSF2 exhibits a slightly higher binding affinity for discontinuous HSEs than observed for hHSF1, and that unlike hHSF1 [10], hHSF2 expressed in yeast cells properly regulates gene expression via 1970 atypical HSEs as well as discontinuous HSEs In this regard, it should be noted that the mouse p35 gene, a specific target of mHSF2, contains a putative HSE that diverges from the canonical HSE [17] It was recently reported that mammalian HSF1 and HSF2 form heterotrimers and that HSF2 modulates the activity of stress-induced HSF1 in a gene-specific manner [44,45] Differences in cooperativity and HSE specificity are likely to be important determinants of the interaction between HSF1–HSF2 heterotrimers and HSEs In mouse, expression of the c-crystallin gene family in the lens is regulated by various transcription factors, including HSF1 and HSF4 [21,22,46] Our analysis of the four human c-crystallin promoters has shown that heat-induced hHSF1 preferentially activates the CRYGA and CRYGB promoters, and hHSF4–VP16 activates the CRYGC promoter, whereas neither activates the CRYGD promoter Five GAA-like sequences in the CRYGA promoter may provide a site for cooperative hHSF1 binding In the CRYGC promoter, the proximal and distal HSEs were necessary for activation by hHSF4–VP16 Mice lacking HSF4 develop cataracts during the early postnatal period, probably due to decreased expression of c-crystallin and ⁄ or HSP25 [21,22] In humans, the CRYGC and CRYGD genes encode abundant lens c-crystallins [47], and CRYGC transcription is regulated by HSF4 This may be one of the reasons why missense mutations in the HSF4 gene are associated with congenital cataracts [20] Transcriptional regulation of genes by three mammalian HSFs is implicated in a variety of cellar processes, including cell maintenance and differentiation, as well as stress resistance [3–5] Which HSF members are expressed in cells is important in determining which genes are activated or repressed Although hHSF1, hHSF2 and hHSF4 contain similar DBDs and HR-A ⁄ B regions, they possess differential binding specificities for various HSE types This differential specificity may give HSFs the ability to distinguish their target genes Experimental procedures Plasmids The ORFs of hHSF1, hHSF2 and hHSF4b were cloned into plasmid pcDNA3.1(+) (Invitrogen, Carlsbad, CA, USA) For expression of hHSFs in Escherichia coli, hHSF1, hHSF2 and hHSF4b (amino acids 220–493) were cloned into plasmid pGEX6P-1 (GE Healthcare, Piscataway, NJ, USA) For expression in yeast cells, hHSF2 and hHSF4b were inserted between the ADH1 promoter and terminator FEBS Journal 276 (2009) 1962–1974 ª 2009 The Authors Journal compilation ª 2009 FEBS N Yamamoto et al of low-copy-number plasmid pSK484 (YCp-TRP1–PADH1– TADH1) [48] and high-copy-number plasmid pK346 (YEpLEU2–PADH1–TADH1) [10] For expression of hHSF–VP16 fusion proteins in HeLa cells, hHSF1, hHSF2 and hHSF4b were cloned into pK543, a derivative of pcDNA3.1(+) containing an activation domain of herpes simplex virus VP16 (amino acids 413–490) Derivatives of hHSF4–VP16 were created by using standard methods The reporter gene HSE–SV40p–LUC contained an HSE oligonucleotide (see Fig 1A) upstream of the SV40 promoter–firefly luciferase gene fusion (SV40p–LUC) of pGL3-Promoter vector (Promega, Madison, WI, USA) The promoter regions of the human cA-crystallin, cB-crystallin, cC-crystallin and cDcrystallin genes were cloned upstream of the luciferase gene of pGL3-Basic vector (Promega) to create CRYGA–LUC, CRYGB–LUC, CRYGC–LUC, and CRYGD–LUC, respectively In vitro polypeptide synthesis, electrophoretic mobility shift assay, and chemical crosslinking analysis hHSF polypeptides were synthesized by in vitro transcription ⁄ translation reaction (TNT Coupled Reticulocyte Lysate System with T7 RNA polymerase; Promega) using pcDNA3.1(+) derivatives that carried the hHSF ORFs as templates The synthesized polypeptides were detected as a single band of the expected molecular mass, as judged by immunoblot analysis with antibodies against hHSF1, hHSF2, and hHSF4 (kindly provided by A Nakai, Yamaguchi University School of Medicine, Japan) The amounts of polypeptides were determined by immunoblot analysis using purified recombinant hHSFs as references (data not shown) The recombinant proteins were expressed in E coli as fusion proteins with glutathione S-transferase Fusion proteins were purified on glutathione Sepharose 4B beads and were treated with PreScission Protease according to the manufacturer’s protocol (GE Healthcare) For electrophoretic mobility shift assays, the binding reaction was carried out in 16 lL of mixture containing 0.2–2.0 lL of in vitro transcription ⁄ translation reaction mixture (0.9–5.8 ng of hHSF polypeptides), 25 mm Hepes ⁄ KOH (pH 7.6), 25 mm NaCl, mm EDTA, 5% glycerol, 200 ng of poly(dI-dC) and 0.02 ng of 32P-labeled HSE oligonucleotide for 20 at 37 or 43 °C The samples were electrophoresed on a 3.5% polyacrylamide gel at room temperature, and subjected to phosphorimaging as described previously [9,10] Oligomer formation of polypeptides was analyzed by chemical crosslinking with EGS [9] In vitro-synthesized polypeptides (1.0–1.5 lL, 4.0 ng of protein) in lL of 13 mm Tris ⁄ Cl (pH 7.6) and 100 mm NaCl were incubated without or with 1.0 and 3.0 mm EGS for 20 at room temperature The reaction was quenched by the addition of glycine to 75 mm Samples were subjected to SDS ⁄ PAGE HSE-type specific recognition by human HSFs and immunoblot analysis using an antibody against VP16 (Abcam, Cambridge, UK) Yeast strains, immunoblot analysis, and RT-PCR Yeast strain HS126 (MATa ade2 his3 leu2 trp1 ura3 can1 hsf1::HIS3 YCp-URA3–yHSF) contains a null mutation of the chromosomal yHSF gene and bears wild-type yHSF on a URA3-marked centromeric plasmid [10] For construction of strains HS170T, YYT49, YYT42, YYT50, and YYT17, HS126 was transformed respectively with YCp-TRP1– yHSF, YCp-TRP1–PADH1–hHSF2–TADH1, YEp-LEU2– PADH1–hHSF2–TADH1, YCp-TRP1–PADH1–hHSF4b–TADH1, and YEp-LEU2–PADH1–hHSF4b–TADH1, and the resident YCp-URA3–yHSF was evicted by streaking transformed cells on medium containing 5-fluoroorotic acid [10] Cells were grown in YPD medium consisting of 1% yeast extract, 2% polypeptone, and 2% glucose Cells expressing hHSF2 and hHSF4 were disrupted by vortexing with glass beads as described previously [9] After centrifugation at 20 000 g for min, protein concentration was measured by the Bio-Rad assay The cleared extracts and recombinant hHSF proteins were subjected to immunoblot analysis with antibodies against hHSF2 and hHSF4 Total RNA was prepared from yeast cells, and mRNA levels of genes were analyzed by RT-PCR as described previously [10] The amounts of PCR products were compared after normalizing RNA samples to the levels of control ACT1 mRNA (encoding actin) Cell culture, transfection, luciferase assay, and immunoblot analysis HeLa cells (cell number RCB0007; RIKEN Bio Resource Center, Ibaraki, Japan) were cultured in minimal essential medium supplemented with 10% newborn bovine serum at 37 °C in a 5% CO2 atmosphere Cells grown in 12-well plates were transfected using HilyMax (Dojindo Laboratories, Kumamoto, Japan), with DNA mixtures including 100 or 200 ng of firefly luciferase reporter plasmid, 10 ng of pRLTK control plasmid containing the Renilla luciferase gene driven by the HSV-TK promoter (Promega), 10 or 100 ng of hHSF–VP16 expression plasmid, and sufficient carrier pcDNA3.1(+) to bring the total amount of DNA to 1.6 lg Cells were cultured for 20–24 h following transfection, and firefly and Renilla luciferase activities were measured using the Dual-Luciferase Reporter Assay System (Promega) and a luminometer (AB-2200-R; ATTO Co., Tokyo, Japan) The Renilla luciferase activity of each sample was used to normalize firefly luciferase for transfection efficiency The expression of hHSF–VP16 fusion proteins in transfected cells was analyzed as follows Cells were lysed in buffer containing 50 mm Tris ⁄ Cl (pH 8.0), 150 mm NaCl, 1% Triton X-100, 0.5 mm phenylmethanesulfonyl fluoride, and protease inhibitor cocktail (Nakarai Tesque, Kyoto, FEBS Journal 276 (2009) 1962–1974 ª 2009 The Authors Journal compilation ª 2009 FEBS 1971 HSE-type specific recognition by human HSFs N Yamamoto et al Japan) After centrifugation at 20 000 g for 10 min, the supernatant (100 lg of protein) was subjected to SDS ⁄ PAGE and immunoblot analysis using an antibody against VP16 (Abcam) Acknowledgements We thank A Nakai for providing the cDNA clones and antibodies This work was supported in part by Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science, and Technology of Japan to H Sakurai References Pirkkala L, Nykanen P & Sistonen L (2001) Roles of the heat shock transcription factors in regulation of the heat shock response and beyond FASEB J 15, 1118–1131 Voellmy R (2004) On mechanisms that control heat shock transcription factor activity in metazoan cells Cell Stress Chaperones 9, 122–133 Westerheide SD & Morimoto RI (2005) Heat shock response modulators as therapeutic tools for diseases of protein conformation J Biol Chem 280, 33097– 33100 Akerfelt M, Trouillet D, Mezger V & Sistonen L (2007) Heat shock factors at a crossroad between stress and development Ann NY Acad Sci 1113, 15–27 Morimoto RI (2008) Proteotoxic stress and inducible chaperone networks in neurodegenerative disease and aging Genes Dev 22, 1427–1438 Hahn JS, Hu Z, Thiele DJ & Iyer VR (2004) Genomewide analysis of the biology of stress responses through heat shock transcription factor Mol Cell Biol 24, 5249– 5256 Yamamoto A, Mizukami Y & Sakurai H (2005) Identification of a novel class of target genes and a novel type of binding sequence of heat shock transcription factor in Saccharomyces cerevisiae J Biol Chem 280, 11911– 11919 Eastmond DL & Nelson HC (2006) Genome-wide analysis reveals new roles for the activation domains of the Saccharomyces cerevisiae heat shock transcription factor (Hsf1) during the transient heat shock response J Biol Chem 281, 32909–32921 Hashikawa N, Yamamoto N & Sakurai H (2007) Different mechanisms are involved in the transcriptional activation by yeast heat shock transcription factor through two different types of heat shock elements J Biol Chem 282, 10333–10340 10 Sakurai H & Takemori Y (2007) Interaction between heat shock transcription factors (HSFs) and divergent binding sequences: binding specificities of yeast HSFs and human HSF1 J Biol Chem 282, 13334–13341 1972 11 McMillan DR, Xiao X, Shao L, Graves K & Benjamin IJ (1998) Targeted disruption of heat shock transcription factor abolishes thermotolerance and protection against heat-inducible apoptosis J Biol Chem 273, 7523–7528 12 Xiao X, Zuo X, Davis AA, McMillan DR, Curry BB, Richardson JA & Benjamin IJ (1999) HSF1 is required for extra-embryonic development, postnatal growth and protection during inflammatory responses in mice EMBO J 18, 5943–5952 13 Dai C, Whitesell L, Rogers AB & Lindquist S (2007) Heat shock factor is a powerful multifaceted modifier of carcinogenesis Cell 130, 1005–1018 14 Reinke H, Saini C, Fleury-Olela F, Dibner C, Benjamin IJ & Schibler U (2008) Differential display of DNAbinding proteins reveals heat-shock factor as a circadian transcription factor Genes Dev 22, 331–345 15 Xing H, Wilkerson DC, Mayhew CN, Lubert EJ, Skaggs HS, Goodson ML, Hong Y, Park-Sarge OK & Sarge KD (2005) Mechanism of hsp70i gene bookmarking Science 307, 421–423 16 Kallio M, Chang Y, Manuel M, Alastalo TP, Rallu M, Gitton Y, Pirkkala L, Loones MT, Paslaru L, Larney S et al (2002) Brain abnormalities, defective meiotic chromosome synapsis and female subfertility in HSF2 null mice EMBO J 21, 2591–2601 17 Chang Y, Ostling P, Akerfelt M, Trouillet D, Rallu M, Gitton Y, El Fatimy R, Fardeau V, Le Crom S, Morange M et al (2006) Role of heat-shock factor in cerebral cortex formation and as a regulator of p35 expression Genes Dev 20, 836–847 18 Akerfelt M, Henriksson E, Laiho A, Vihervaara A, Rautoma K, Kotaja N & Sistonen L (2008) Promoter ChIP-chip analysis in mouse testis reveals Y chromosome occupancy by HSF2 Proc Natl Acad Sci USA 105, 11224–11229 19 Nakai A, Tanabe M, Kawazoe Y, Inazawa J, Morimoto RI & Nagata K (1997) HSF4, a new member of the human heat shock factor family which lacks properties of a transcriptional activator Mol Cell Biol 17, 469–481 20 Bu L, Jin Y, Shi Y, Chu R, Ban A, Eiberg H, Andres L, Jiang H, Zheng G, Qian M et al (2002) Mutant DNA-binding domain of HSF4 is associated with autosomal dominant lamellar and Marner cataract Nat Genet 31, 276–278 21 Fujimoto M, Izu H, Seki K, Fukuda K, Nishida T, Yamada S, Kato K, Yonemura S, Inouye S & Nakai A (2004) HSF4 is required for normal cell growth and differentiation during mouse lens development EMBO J 23, 4297–4306 22 Min JN, Zhang Y, Moskophidis D & Mivechi NF (2004) Unique contribution of heat shock transcription factor in ocular lens development and fiber cell differentiation Genesis 40, 205–217 FEBS Journal 276 (2009) 1962–1974 ª 2009 The Authors Journal compilation ª 2009 FEBS N Yamamoto et al 23 Tanabe M, Sasai N, Nagata K, Liu XD, Liu PC, Thiele DJ & Nakai A (1999) The mammalian HSF4 gene generates both an activator and a repressor of heat shock genes by alternative splicing J Biol Chem 274, 27845– 27856 24 Frejtag W, Zhang Y, Dai R, Anderson MG & Mivechi NF (2001) Heat shock factor-4 (HSF-4a) represses basal transcription through interaction with TFIIF J Biol Chem 276, 14685–14694 25 Tu N, Hu Y & Mivechi NF (2006) Heat shock transcription factor (Hsf)-4b recruits Brg1 during the G1 phase of the cell cycle and regulates the expression of heat shock proteins J Cell Biochem 98, 1528– 1542 26 Kroeger PE, Sarge KD & Morimoto RI (1993) Mouse heat shock transcription factors and prefer a trimeric binding site but interact differently with the HSP70 heat shock element Mol Cell Biol 13, 3370– 3383 27 Kroeger PE & Morimoto RI (1994) Selection of new HSF1 and HSF2 DNA-binding sites reveals difference in trimer cooperativity Mol Cell Biol 14, 7592– 7603 28 Liu XD, Liu PC, Santoro N & Thiele DJ (1997) Conservation of a stress response: human heat shock transcription factors functionally substitute for yeast HSF EMBO J 16, 6466–6477 29 Perisic O, Xiao H & Lis JT (1989) Stable binding of Drosophila heat shock factor to head-to-head and tailto-tail repeats of a conserved bp recognition unit Cell 59, 797–806 30 Hashikawa N, Mizukami Y, Imazu H & Sakurai H (2006) Mutated yeast heat shock transcription factor activates transcription independently of hyperphosphorylation J Biol Chem 281, 3936– 3942 31 Sarge KD, Zimarino V, Holm K, Wu C & Morimoto RI (1991) Cloning and characterization of two mouse heat shock factors with distinct inducible and constitutive DNA-binding ability Genes Dev 5, 1902– 1911 32 Yoshima T, Yura T & Yanagi H (1998) Function of the C-terminal transactivation domain of human heat shock factor is modulated by the adjacent negative regulatory segment Nucleic Acids Res 26, 2580–2585 33 Zuo J, Rungger D & Voellmy R (1995) Multiple layers of regulation of human heat shock transcription factor Mol Cell Biol 15, 4319–4330 34 Fujimoto M, Oshima K, Shinkawa T, Wang BB, Inouye S, Hayashida N, Takii R & Nakai A (2008) Analysis of HSF4 binding regions reveals its necessity for gene regulation during development and heat shock response in mouse lenses J Biol Chem 283, 29961– 29970 HSE-type specific recognition by human HSFs 35 Hu Y & Mivechi NF (2006) Association and regulation of heat shock transcription factor 4b with both extracellular signal-regulated kinase mitogen-activated protein kinase and dual-specificity tyrosine phosphatase DUSP26 Mol Cell Biol 26, 3282–3294 36 Rabindran SK, Haroun RI, Clos J, Wisniewski J & Wu C (1993) Regulation of heat shock factor trimer formation: role of the conserved leucine zipper Science 259, 230–234 37 Zuo J, Baler R, Dahl G & Voellmy R (1994) Activation of the DNA-binding ability of human heat shock transcription factor may involve the transition from an intramolecular to an intermolecular triple-stranded coiled-coil structure Mol Cell Biol 14, 7557–7568 38 Liu PC & Thiele DJ (1999) Modulation of human heat shock factor trimerization by the linker domain J Biol Chem 274, 17219–17225 39 Drees BL, Grotkop EK & Nelson HC (1997) The GCN4 leucine zipper can functionally substitute for the heat shock transcription factor’s trimerization domain J Mol Biol 273, 61–67 40 Littlefield O & Nelson HC (1999) A new use for the ‘wing’ of the ‘winged’ helix–turn–helix motif in the HSF–DNA cocrystal Nat Struct Biol 6, 464–470 41 Ahn SG, Liu PC, Klyachko K, Morimoto RI & Thiele DJ (2001) The loop domain of heat shock transcription factor dictates DNA-binding specificity and responses to heat stress Genes Dev 15, 2134–2145 42 Ahn SG & Thiele DJ (2003) Redox regulation of mammalian heat shock factor is essential for Hsp gene activation and protection from stress Genes Dev 17, 516–528 43 Trinklein ND, Chen WC, Kingston RE & Myers RM (2004) Transcriptional regulation and binding of heat shock factor and heat shock factor to 32 human heat shock genes during thermal stress and differentiation Cell Stress Chaperones 9, 21–28 44 Ostling P, Bjork JK, Roos-Mattjus P, Mezger V & ă Sistonen L (2007) Heat shock factor (HSF2) contributes to inducible expression of hsp genes through interplay with HSF1 J Biol Chem 282, 7077–7086 45 Loison F, Debure L, Nizard P, Le Goff P, Michel D & Le Drean Y (2006) Up-regulation of the clusterin gene after proteotoxic stress: implication of HSF1–HSF2 heterocomplexes Biochem J 395, 223–231 46 Cvekl A & Duncan MK (2007) Genetic and epigenetic mechanisms of gene regulation during lens development Prog Retin Eye Res 26, 555–597 47 Brakenhoff RH, Aarts HJ, Reek FH, Lubsen NH & Schoenmakers JG (1990) Human c-crystallin genes: a gene family on its way to extinction J Mol Biol 216, 519–532 48 Sakurai H & Fukasawa T (2003) Artificial recruitment of certain mediator components affects requirement of basal transcription factor IIE Genes Cells 8, 41–50 FEBS Journal 276 (2009) 1962–1974 ª 2009 The Authors Journal compilation ª 2009 FEBS 1973 HSE-type specific recognition by human HSFs N Yamamoto et al Supporting information The following supplementary material is available: Fig S1 Electrophoretic mobility shift assay of hHSF– HSE complexes Fig S2 Electrophoretic mobility shift assay of hHSF– VP16 polypeptides 1974 This supplementary material can be found in the online version of this article Please note: Wiley-Blackwell is not responsible for the content or functionality of any supplementary materials supplied by the authors Any queries (other than missing material) should be directed to the corresponding author for the article FEBS Journal 276 (2009) 1962–1974 ª 2009 The Authors Journal compilation ª 2009 FEBS ... Roles of the heat shock transcription factors in regulation of the heat shock response and beyond FASEB J 15, 1118–1131 Voellmy R (2004) On mechanisms that control heat shock transcription factor. .. HSE-type specific recognition by human HSFs resulted in robust activation by hHSF4–VP16, without changing the magnitude of the heat shock response (cp3) The mutational analysis of the CRYGA and CRYGC... (2007) Different mechanisms are involved in the transcriptional activation by yeast heat shock transcription factor through two different types of heat shock elements J Biol Chem 282, 10333–10340 10