N-Glycosylation is important for the correct intracellular localization of HFE and its ability to decrease cell surface transferrin binding Lavinia Bhatt1, Claire Murphy2, Liam S.O’Driscoll2, Maria Carmo-Fonseca3, Mary W McCaffrey1 and John V Fleming2,3 Department of Biochemistry, Biosciences Institute, University College Cork, Ireland Department of Biochemistry, School of Pharmacy and ABCRF, University College Cork, Ireland Institute of Molecular Medicine, University of Lisbon, Portugal Keywords HFE; N-glycosylation; transferrin; transferrin receptor 1; b2-microglobulin Correspondence J V Fleming, Department of Biochemistry and School of Pharmacy, University College Cork, Cork, Ireland Fax: +353 21 4901656 Tel: +353 21 4901679 E-mail: j.fleming@ucc.ie Note L Bhatt and C Murphy contributed equally to this work (Received February 2010, revised 14 May 2010, accepted June 2010) doi:10.1111/j.1742-4658.2010.07727.x HFE is a type transmembrane protein that becomes N-glycosylated during transport to the cell membrane It influences cellular iron concentrations through multiple mechanisms, including regulation of transferrin binding to transferrin receptors The importance of glycosylation in HFE localization and function has not yet been studied Here we employed bioinformatics to identify putative N-glycosylation sites at residues N110, N130 and N234 of the human HFE protein, and used site-directed mutagenesis to create combinations of single, double or triple mutants Compared with the wild-type protein, which co-localizes with the type transferrin receptor in the endosomal recycling compartment and on distributed punctae, the triple mutant co-localized with BiP in the endoplasmic reticulum This was similar to the localization pattern described previously for the misfolding HFE-C282Y mutant that causes type hereditary haemachromatosis We also observed that the triple mutant was functionally deficient in b2-microglobulin interactions and incapable of regulating transferrin binding, once again, reminiscent of the HFE-C282Y variant Single and double mutants that undergo limited glycosylation appeared to have a mixed phenotype, with characteristics primarily of the wild-type, but also some from the glycosylation-deficient protein Therefore, although they displayed an endosomal recycling compartment/punctate localization like the wild-type protein, many cells simultaneously displayed additional reticular localization Furthermore, although the majority of cells expressing these single and double mutants showed decreased surface binding of transferrin, a number appeared to have lost this ability We conclude that glycosylation is important for the normal intracellular trafficking and functional activity of HFE Structured digital abstract l MINT-7896236, MINT-7896218: beta2M (uniprotkb:P61769) physically interacts (MI:0915) with HFE (uniprotkb:Q30201) by anti bait coimmunoprecipitation (MI:0006) l MINT-7896162: TfR1 (uniprotkb:P02786) and HFE (uniprotkb:Q30201) colocalize (MI:0403) by fluorescence microscopy (MI:0416) Abbreviations ER, endoplasmic reticulum; ERC, endosomal recycling compartment; HH, hereditary haemachromatosis; b2M, b2 microglobulin; MHC, major histocompatability complex; PNGase F, N-glycosidase F; Tfn, transferrin; TfR1, transferrin receptor 1; TfR2, transferrin receptor FEBS Journal 277 (2010) 3219–3234 ª 2010 The Authors Journal compilation ª 2010 FEBS 3219 N-Glycosylation of HFE L Bhatt et al l l MINT-7896258, MINT-7896317, MINT-7896330, MINT-7896348, MINT-7896366: HFE (uni protkb:Q30201) and transferrin (uniprotkb:P02787) colocalize (MI:0403) by fluorescence microscopy (MI:0416) MINT-7896149: HFE (uniprotkb:Q30201) and BiP (uniprotkb:P11021) colocalize (MI:0403) by fluorescence microscopy (MI:0416) Introduction The hereditary haemochromatosis (HH) protein HFE (high Fe) is a type transmembrane protein that plays an important role in controlling physiological iron homeostasis [1–3] It is widely expressed throughout the body with expression highest in cells that are involved in iron metabolism [4–6] Mutations in the HFE protein cause type HH, which is an inherited disease of iron metabolism that results in iron overload in several organs [4,7] The HFE mutation detected in the majority of HH patients results in the replacement of cysteine residue 282 with tyrosine (C282Y) The mutant protein is unable to form a structurally important disulfide bridge required for HFE interactions with b2 microglobulin (b2M) [4,5,8–11] In the absence of b2M binding, the protein misfolds and is retained in the endosplasmic reticulum (ER) where it induces an unfolded protein stress response that is characterized by alternative splicing of XBP-1 and increased expression of CHOP and BiP [12–14] A second welldescribed HFE mutation associated with HH leads to the replacement of histidine at residue 63 with aspartate This mutant is capable of b2M interaction and cell-surface expression but is unable to regulate cellular iron uptake like the wild-type HFE protein [4,15] Although much insight into HFE function has been gained through studying the cellular and biochemical properties of these different mutant proteins, the exact mechanism by which HFE regulates intracellular iron levels is still not completely understood The HFE primary sequence exhibits significant homology to major histocompatability complex (MHC) class I molecules and the protein is organized into a1, a2 and a3 structural domains that resemble those described for MHC class I and related proteins [4,16] The N-terminal a1 and a2 domains come together to form a superstructure composed of two a helices layered on top of eight anti-parallel b sheets In MHC class I proteins this a1/a2 superstructure forms a peptide-binding groove that mediates antigen binding and presentation to CD8 + cytolytic T cells In HFE, the proximity of the two a helices and the presence of amino acid side chains that project into the groove appear to prevent peptide binding [16] The a3 region, like its homologous domain in MHC 3220 class I, is an immunoglobulin-like domain that mediates binding to b2M [16,17] C-Terminal residues of HFE mediate its retention in the cell membrane Shortly after HFE was discovered it was reported to co-localize and interact with the type transferrin receptor (TfR1) [5,18] TfR1 mediates the endocytosis of iron-loaded transferrin into acidic endosomes where the iron is released and transported into the cytoplasm via the Nramp2-DCT1 iron transporter Apo-transferrin and TfR1 are recycled to the cell surface where apo-transferrin is released [3,19] Crystallography studies suggest that the a3 stem of HFE lies parallel to the cell membrane and that the a1/a2 superstructure interacts with helical regions located within TfR1 In this way, it is possible for two HFE proteins to be positioned at either side of the TfR1 homodimer and form a tetrameric complex that exhibits twofold symmetry [17] Reports from crystallography experiments have been supported by mutagenesis studies that identified residues located at the end of an a-helical region of the HFE a1 domain (V100 and W103A) as being of particular importance for TfR1 interactions [16,17,20] The effect of HFE binding to TfR1 is to lower the affinity of the receptor for transferrin [15] This most likely reflects the existence of overlapping HFE and transferrin-binding sites on the receptor [21,22] Successive studies indicate that HFE and TfR1 co-localize during endosomal trafficking, although there are contradictory reports as to whether TfR1 recycling is affected by HFE [23–29] Despite these well-described interactions, there is mounting evidence that HFE regulation of cellular iron levels may not depend solely on TfR1 binding [30,31] Attention has shifted to a second transferrin receptor, TfR2, whose pattern of expression is more restricted than that of ubiquitously expressed TfR1 [32] Levels of TfR2 are highest in hepatocytes, the predominant site of HFE expression, and recent studies have confirmed that the two proteins are capable of interacting [33,34] The nature of these interactions differs from those observed between HFE and TfR1 in that they are mediated by the a3 domain of HFE, as opposed to the a1/a2 superstructure [33] An emerging model, therefore, is that TfR2 competes with TfR1 for FEBS Journal 277 (2010) 3219–3234 ª 2010 The Authors Journal compilation ª 2010 FEBS L Bhatt et al HFE binding This occurs maximally at high concentrations of transferrin The resulting HFE–TfR2 complex, which is stabilized at high iron concentrations, is believed to somehow regulate the expression of other genes involved in iron metabolism This includes hepcidin, a 25 amino acid antimicrobial peptide that is expressed in liver cells and is now recognized as a key regulator of iron homeostasis in the body Hepatocellular hepcidin mRNA levels have been shown to be regulated by HFE, and are altered in haemachromatosis patients with the C282Y mutation [35–37] The importance of N-glycosylation with respect to protein expression and function is highly variable Roles have been described in the secretion, stability and oligomerization of proteins [38,39], the bioactivities of enzymes [40] and the binding affinities of ligands and receptors [41] In many instances, specific functions can be attributed to glycosylation at specific sites For example, the human gonadotropin a subunit has N-glycosylation sites at residues Asn52 and Asn78 that have been shown to differentially regulate receptor signalling and secretion, respectively [38,39] Another example is the type transferrin receptor, which has N-glycosylation sites at residues Asn251, Asn317 and Asn727 Mutation of Asn727 decreases cell-surface expression, whereas mutation at the other two sites does not [42] HFE becomes glycosylated during post-translational processing Transfection studies have confirmed that this involves N-glycosylation, and incubation of lysates from HFE-expressing cells with N-glycosidase F (PNGase F) leads to the accumulation of lower molecular mass HFE proteins [13,43] The carbohydrate moiety undergoes processing and endoglycosidase H-resistant HFE isoforms can be detected by 30 post translation [10,13,18,23] Although these studies demonstrate that HFE is glycosylated, the specific role, if any, that glycosylation might play in cellular HFE function has not previously been studied In this article, we map the sites of HFE N-glycosylation and examine the importance of glycosylation on parameters of protein localization and function Results Tunicamycin treatment results in a reticular pattern of HFE localization Previous studies have demonstrated that HFE undergoes post-translational N-glycosylation As a first step towards assessing the importance of N-glycosylation on HFE expression, we transiently transfected HuTu80 to express HFE-WT–HA and cultured the cells in the N-Glycosylation of HFE presence or absence of tunicamycin to inhibit glycan production Control, untreated cells predominantly exhibited a punctate pattern of HFE expression with a tubulovesicular concentration in the pericentrosomal region (Fig 1A,D), consistent with previous observations [11,28] Immunostaining with anti-TfR1, antiRab11a and Rab11-FIP3 Ig has identified the HFEcontaining pericentrosomal compartment of HuTu80 cells as the endosomal recycling compartment (ERC) [28] Treatment of HFE-WT–HA-expressing cells with tunicamycin altered this pattern of localization and resulted in a reticular pattern of cell localization (Fig 1B,D) Immunostaining showed significant co-localization with the ER chaperone protein BiP, demonstrating that the HFE-WT–HA was now localizing primarily to the ER (Fig 1B,D) A similar pattern of reticular expression and BiP co-localization was observed when HuTu80 cells were transfected to express the HH-causing HFE-C282Y variant (Fig 1C,D), which has been shown through multiple biochemical and microscopy approaches to be retained in the ER [10,13,18,28,29] HFE is glycosylated at residues Asn110, Asn130 and Asn234 Although the results in Fig point towards an important role for glycosylation in HFE localization, it remains possible that the effects of tunicamycin treatment were indirect To directly examine the importance of glycosylation on HFE, it was necessary to generate an N-glycosylation-deficient mutant To this end, we used a bioinformatic prediction program (netnglyc 1.0 Server; Technical University of Denmark) to identify putative glycosylation sites in the protein Consistent with previous predictions [18], we identified three high-probability sites: asparagines at positions 110, 130 and 234 Starting with wild-type HFE, we generated all possible combinations of single and double putative N-glycosylation site mutants using site-directed mutagenesis The wild-type and mutant expression constructs were transfected into HEK293T cells and the lysates analysed by western blotting The results from these experiments, which are shown in Fig 2A, indicate that the introduction of single alanine mutations at N110, N130 and N234, respectively, resulted in the production of HFE proteins that migrated with increased mobility on SDS/PAGE compared with the wild-type This suggested that all three sites in the wild-type proteins are capable of becoming glycosylated The decrease in apparent molecular mass became even more pronounced for proteins containing FEBS Journal 277 (2010) 3219–3234 ª 2010 The Authors Journal compilation ª 2010 FEBS 3221 N-Glycosylation of HFE L Bhatt et al A B C Fig Inhibition of N-glycosylation influences patterns of HFE intracellular localization HuTu80 cells were transfected with constructs expressing the HFE-WT–HA (A, B) and HFE-C282Y–HA (C) proteins, HFE-WT-expressing cells were incubated for h in the absence (A) or presence (1B) of lgỈmL–1 tunicamycin (Tunica) as indicated Cells were immunostained with anti-HA and anti-BiP Ig, and processed for fluorescence microscopy Co-localization masks were created as described in Materials and methods, and represent areas with overlapping green and red pixels converted to white Scale bar, 10 lm Identical results were obtained when cells were transfected with constructs directed to express amino-tagged GFP–HFE-WT and GFP–HFE-C282Y, and in general we found that HA and GFP tags could be interchanged without altering the pattern of cell localization (data not shown) Figures shown are representative of at least three independent experiments (D) Graph showing the relative amounts of transfected cells exhibiting punctate or reticular localization of expressed HFE proteins (n = 3) D combinations of double mutants, which displayed a lower apparent molecular mass than either wild-type or single mutant forms of the protein Although immunoblot analysis demonstrated that the single and double mutants had decreased mass compared with the wild-type protein, they still appeared to be of higher molecular mass than the unglycosylated form of the wild-type HFE protein – which was produced when wild-type-expressing cells were treated with tunicamycin (Fig 2A; WT-Tunica) This suggested that both the single and double mutants were still partially glycosylated To test this, we transfected HEK293T cells to express either the wild-type or mutant proteins, and incubated the cells 3222 in the presence or absence of tunicamycin Drug treatments resulted in the accumulation of forms of the mutant proteins that were of lower apparent molecular mass and of similar size to the unglycosylated form of the wild-type protein (see Fig 2B for single mutants and Fig 2C for double mutants) This suggested that the mutant proteins indeed still undergo limited glycosylation For the single mutants, additional supporting evidence for the persistence of N-linked glycans was obtained by PNGase F digestions of immunoprecipitated proteins, which then migrated with lower apparent molecular mass compared with the undigested forms (results not shown) FEBS Journal 277 (2010) 3219–3234 ª 2010 The Authors Journal compilation ª 2010 FEBS L Bhatt et al A B C Fig Characterization of N-glycosylation site single and double mutants (A) HEK293T cells were transfected to transiently express HFE-WT–HA, HFE-N110–HA, HFE-N130A–HA, HFE-N234A–HA, HFENN110/130AA–HA, HFE-NN130/234AA–HA or HFE-NN234/110AA– HA proteins HFE-WT–HA expressing cells were incubated for 16 h before lysis in the presence or absence of mM tunicamycin (Tunica) Cleared cell lysates were fractioned by 11% SDS/PAGE for immunoblotting with a mouse anti-HA Ig (B) Transiently transfected HEK293T cells expressing HFE-WT–HA, HFE-N110–HA, HFE-N130A–HA or HFE-N234A–HA were incubated for 16 h in the presence or absence of mM tunicamycin as indicated (Tunica) HA-tagged proteins in cleared cells lysates were detected by immunoblotting with a mouse anti-HA Ig (C) Transiently transfected HEK293T cells expressing HFEWT–HA, HFE-NN110/130AA–HA, HFE-NN130/234AA–HA or HFENN234/110AA–HA protein were incubated for 16 h in the presence or absence of mM tunicamycin as indicated (Tunica) HA-tagged proteins in cleared cells lysates were detected by immunoblotting with a mouse anti-HA Ig HFE NNN110/130/234/AAA triple mutant is glycosylation deficient To investigate whether the three N-glycosylation sites studied to date are the only sites of HFE N-glycosyla- N-Glycosylation of HFE tion – and with the aim of producing an HFE mutant that is completely deficient in N-glycosylation – we used site-directed mutagenesis to create a NNN110/ 130/234AAA triple mutant To determine the effect of these combined mutations on HFE, we transfected HEK293T cells to express wild-type, single, double or triple mutants Western blot analysis of cell lysates shown in Fig 3A indicated that the triple mutant fractionated with a lower molecular mass than the wild-type protein, and either the single or double mutants This lower molecular mass form appeared to be the same size as the unglycosylated form of the wild-type protein produced in tunicamycin-treated cultures (Fig 3A; WT-Tunica) These data suggested that all potential glycosylation sites had been mutated To confirm this, we transfected HEK293T cells to express wild-type or triple mutant forms of HFE and incubated the cells in the presence and absence of tunicamycin Drug treatment resulted in the accumulation of an unglycosylated lower molecular mass form of the wild-type HFE protein, whereas it had no effect on the apparent molecular mass of the triple mutant (Fig 3B) In a second approach, HFE was immunoprecipitated from wild-type or triple-mutant-expressing cells and incubated with PNGase-F As is shown in Fig 3C, enzyme treatment of wild-type HFE resulted in the production of a lower molecular mass product Treatment had no detectable effect on migration of the triple mutant, which had the same apparent molecular mass as the PNGase F-treated wild-type protein We conclude that HFE is normally glycosylated in vivo at three sites (N110, N130 and N234), and that mutation of these sites gives rise to an HFE protein that is N-glycosylation deficient N-Glycosylation of HFE is required for its appropriate localization to the ERC Our results from Fig indicated that tunicamycin treatment of HFE-WT-expressing cells results in a reticular localization pattern To definitively establish the importance of N-glycosylation on HFE localization in HuTu80 cells, we transfected cells to express GFPtagged forms of wild-type or triple-mutant HFE As shown in Fig 4A, HFE-WT–GFP localized predominantly to a tubulovesicular structure near the nucleus with some punctate staining, similar to that observed in Fig 1A The GFP-tagged triple mutant, by contrast, predominantly displayed a reticular localization pattern (Fig 4A,B) This was similar to the expression pattern previously observed for HFE-WT in tunicamycin-treated cells (Fig 1B) FEBS Journal 277 (2010) 3219–3234 ª 2010 The Authors Journal compilation ª 2010 FEBS 3223 N-Glycosylation of HFE L Bhatt et al A B C Fig Characterization of N-glycosylation site triple mutant (A) HEK293T cells were transiently transfected with constructs expressing HFE-WT–HA, HFE-N110–HA, HFE-N130A–HA, HFE-N234A–HA, HFE-NN110/130AA–HA, HFE-NN130/234AA–HA, HFE-NN234/110AA–HA or HFE-NNN110/130/234–HA (Triple) proteins HFE-WT–HA expressing cells were incubated for 16 h before lysis in the presence or absence of mM tunicamycin (Tunica) HA-tagged proteins were detected by fractionation of cleared cell lysates on 11% SDS/PAGE for immunoblotting with a mouse antiHA Ig (B) Transiently transfected HEK293T cells expressing HFE-WT–HA or HFE-NNN110/130/234–HA (Triple) proteins were incubated for 16 h in the presence or absence of mM tunicamycin (Tunica) as indicated (C) HFE-WT–HA or HFE-NNN110/130/ 234AAA–HA proteins were transiently expressed in HEK293T cells Forty-eight hours after transfection cells were harvested and HAtagged proteins were immunprecipitated with a polyclonal rabbit anti-HA Ig Immunoprecipitated proteins were digested with PNGase F and fractionated by 11% SDS/PAGE for immunoblotting with a mouse anti-HA Ig HuTu80 cells transfected with HFE-WT or HFE triple-mutant proteins were subsequently immunostained with an anti-TfR1 Ig The results from these experiments demonstrated that the wild-type protein co-localizes with TfR1 predominantly in the tubulovesicular perinuclear ERC and discrete punctae (hereafter referred to as ERC/punctate pattern of 3224 localization) The triple mutant, by contrast, shows no TfR1 co-localization (Fig 4A) Although these results attest to the importance of N-glycosylation for the normal cellular localization of HFE, we wondered whether this was a cumulative effect or whether there are specific glycosylation sites that are more important than others for ensuring expression and recycling of the protein To test this, we transfected HuTu80 cells to express HFE-N110A– GFP, HFE-N130A–GFP or HFE-N234A–GFP proteins In all instances, we observed that the majority of transfected cells displayed an ERC/punctate pattern of localization, similar to the wild-type protein (Fig 4A,B) Interestingly, a significant number of cells displaying this ERC/punctate pattern simultaneously displayed reticular localization in the same cells (50 ± 2% of N110A-expressing cells, 50 ± 2% of N130A-expressing cells and 58 ± 5% of N234Aexpressing cells, n = 3) This was a feature also of cells expressing HFE double mutants, in which we likewise observed an ERC/punctate localization pattern in the majority of cells (Fig 5A,B) and a significant number of these cells simultaneously displaying reticular localization (55 ± 7% of NN110/130AA-expressing cells, 51 ± 4% of NN130/234AA-expressing cells and 67 ± 7% of NN234/110AA-expressing cells, n = 4) This type of mixed phenotype, where reticular localization was observed in cells that already had the correct ERC/punctate pattern, was not observed to any significant degree in cells expressing the wild-type or triple-mutant proteins N-Glycosylation is important for interactions with b2M The wild-type HFE protein interacts with b2M during transport to the cell surface It is commonly reported that misfolding and ER retention of the HFE-C282Y variant happens specifically because this b2M interaction does not occur [5,9–11] The HFE triple mutant, just like the HFE-C282Y mutant, shows a reticular pattern of localization and in immunostaining studies was seen to co-localize in the ER with BiP (Fig 6A) Accordingly, we wondered whether this pattern of localization reflected an underlying inability to interact with b2M or whether, in addition to b2M binding, the HFE protein needs to be appropriately glycosylated in order to successfully transit the ER HEK293T cells were transfected to express wild-type or mutant forms of the HFE protein Cells were lysed and an anti-b2M Ig used to immunoprecipitate b2M and any interacting proteins As shown in Fig 6B, the triple mutant showed significantly decreased interactions with b2M FEBS Journal 277 (2010) 3219–3234 ª 2010 The Authors Journal compilation ª 2010 FEBS L Bhatt et al N-Glycosylation of HFE B A Fig Intracellular localization of HFE triple and single N-glycosylation site mutants (A) HuTu80 cells were transfected to express HFE-WT– GFP, HFE-N110A–GFP, HFE-N130A–GFP, HFE-N234A–GFP or HFE-NNN110/130/234AAA–GFP triple mutant Sixteen to eighteen hours post transfection the cells were immunostained with an anti-TfR1 Ig, and processed for fluorescence microscopy Scale bar, 10 lm (B) Graph showing the relative amounts of transfected cells exhibiting ERC/punctate or reticular localization of expressed HFE proteins (n = 3) This deficiency could not be attributed to a specific glycosylation site, because each of the single mutants retained the ability to interact with b2M The HFEC282Y mutant was employed in these experiments as a negative control (Fig 6B) Combined with our earlier cell localization results, the data presented in Fig point towards an important role for N-glycosylation in HFE folding However, once again, it is only when all three sites are mutated that we observe a significant loss of function N-Glycosylation is important for HFE regulation of transferrin binding Previous reports have established that in certain cell types HFE acts to regulate intracellular iron levels by decreasing the binding of transferrin to transferrin receptors and reducing cellular iron uptake as a consequence Indeed, it is commonly believed that iron overload in HH occurs because the misfolding HFEC282Y variant fails to make it to the cell surface and is unable to exert this control We wanted to determine FEBS Journal 277 (2010) 3219–3234 ª 2010 The Authors Journal compilation ª 2010 FEBS 3225 N-Glycosylation of HFE L Bhatt et al A B Fig Intracellular localization of HFE double N-glycosylation site mutants (A) HuTu80 cells were transfected to express HFE-NN110/130AA–HA, HFE-NN130/ 234AA–HA or HFE-NN234/110AA–HA Sixteen to eighteen hours post transfection the cells were immunostained with an anti-TfR1 Ig, and processed for fluorescence microscopy Scale bar, 10 lm (B) Graph showing the relative amounts of transfected cells exhibiting ERC/punctate or reticular localization of expressed HFE proteins (n = 4) whether N-glycosylation is important for HFE regulation of transferrin uptake To this end, transfected HuTu80 cells expressing HA-tagged forms of wild-type or mutant HFEs were analysed for their ability to bind fluorescently labelled transferrin Consistent with previ3226 ous reports, we noted that cells expressing wild-type HFE displayed a striking decrease in cell-surface binding of transferrin, and that little or no reduction in transferrin binding was observed in cells expressing the HFE-C282Y mutant (Fig 7A) FEBS Journal 277 (2010) 3219–3234 ª 2010 The Authors Journal compilation ª 2010 FEBS L Bhatt et al N-Glycosylation of HFE A B Fig ER localization of the HFE-triple mutant and interaction of N-glycosylation site mutants with b2M (A) HuTu80 cells transfected to express HFE-triple mutant–HA were immunostained with anti-HA and anti-BiP Ig, and processed for fluorescence microscopy Co-localization masks were created as described in Materials and methods Scale bar, 10 lm (B) Constructs expressing HFE-WT–HA, HFE-NNN110/130/ 234–HA (triple), HFE-N110A–HA, HFE-N130A–HA, HFE-N234A–HA or HFE-C282Y–HA proteins were transiently transfected into HEK293T cells Forty-eight hours after transfection cells were harvested HA-tagged proteins in cleared cell lysates were fractionated on 11% SDS/ PAGE for immunoblotting with a mouse anti-HA Ig (upper) b2M and b2M-interacting proteins were immunoprecipitated using a rabbit antib2M Ig and precipitated proteins were fractionated by SDS/PAGE (11%) for detection of HA-tagged proteins by immunoblot using a mouse anti-HA Ig (lower) In a complementary series of experiments NiNTA–agarose was used to precipitate His-tagged versions of the WT, C282Y and triple-mutant HFE proteins from transfected HEK293T cells Immunoblots confirmed that only the wild-type HFE protein was capable of co-precipitating significant quantities of b2M (data not shown) In experiments to compare the status of our glycosylation mutants in this assay we observed that the triple mutant displayed a phenotype indistinguishable from the C282Y mutant, with an almost complete loss of the ability to regulate transferrin binding (Fig 7B) By contrast, cells transfected with either the single or double mutants were all capable of reducing transferrin binding In each case, however, there tended to be a decrease in the proportion of cells that retained this ability compared with the wild-type protein (Fig 7B–D) This effect was strongest for the 110/130 double mutant (Fig 7D) Discussion Although N-glycosylation can dramatically alter the structure and function of many proteins, there are also cited instances in whch the mutation of glycosylation sites has little or no effect [42,44] The importance of glycosylation is highly variable, therefore, and even in cases where it is important, the effect may be either direct or indirect In this study, we set out to explore the importance of HFE glycosylation In doing so, we aimed to expand on previous studies, which despite reference to glycan addition and the development of endo-H resistance [13,18], nevertheless failed to identify the role, if any, that glycosylation plays in HFE localization and function We established for the first time that the protein becomes N-glycosylated at asparagine residues 110, 130 and 234, and that mutation of all three sites results in the production of a protein that is glycosylation deficient Glycosylation at each of the substrate asparagine residues can occur independently of the glycosylation status at the other two sites FEBS Journal 277 (2010) 3219–3234 ª 2010 The Authors Journal compilation ª 2010 FEBS 3227 N-Glycosylation of HFE L Bhatt et al A B Fig Regulation of transferrin binding by N-glycosylation site mutants HuTu80 were transfected to express (A) HFE-WT–HA or HFE-C282Y–HA, (B) triple mutant HFENNN110/130/234–HA (triple) or single mutants HFE-N110A–HA, HFE-N130A–HA and HFE-N234A–HA or (C) double mutants HFE-NN110/130AA–HA, HFE-NN234/110A– HA or HFE-NN234/110AA–HA, as indicated Sixteen hours post transfection the cells were serum starved for h followed by incubation with Alexa Fluor 594-bound Tfn for h at °C Cells were immunostained with an anti-HA Ig and processed for fluorescence microscopy Scale bar, 10 lm (D) Graph showing the percentage of transfected cells with reduced transferrin binding in response to the expression of various HFE proteins as indicated *P < 0.05, **P < 0.01 by Student’s unpaired t-test (n = 6) 3228 FEBS Journal 277 (2010) 3219–3234 ª 2010 The Authors Journal compilation ª 2010 FEBS L Bhatt et al N-Glycosylation of HFE C D Fig (Continued) From the outset, we were interested in looking at the importance of overall glycosylation patterns on HFE intracellular trafficking, localization and function Initially this was done in the context of inhibiting cellular glycan production, with tunicamycin treatment altering HFE localization so that we observed a reticu- lar pattern of protein localization Tunicamycin disrupts the glycosylation status of many cellular proteins, however, and it remained a possibility that the observed changes were indirect By mapping the relevant asparagine residues, and disrupting the glycosylation status specifically of HFE, it allowed us to FEBS Journal 277 (2010) 3219–3234 ª 2010 The Authors Journal compilation ª 2010 FEBS 3229 N-Glycosylation of HFE L Bhatt et al establish the importance of HFE glycosylation and to confirm ER localization in its absence It is noteworthy that just a single glycosylation site has been identified in homologous MHC class I proteins, at a position comparable with N110 In contrast to our HFE data, where protein glycosylation is important for function, studies with MHC class I proteins HLA-A2 and HLAB7 suggest that it is fully functional in the absence of glycosylation [45] Despite the sequence and structural similarities between the two proteins, therefore, we observed a clear divergence from MHC class I in this regard Parameters of protein function can frequently be attributed to glycosylation at specific sites A good example of this is TfR1, in which mutation of one of the three glycosylation sites (Asn727) results in a reticular rather than ERC pattern of localization [41,42] HFE does not appear to be regulated in this way, and despite the overall importance of glycosylation, our results nevertheless argue against the existence of a single glycosylation site that is of such absolute importance that it is capable in its own right of regulating localization, b2M interactions or transferrin binding Instead, we observed a tendency towards a mixed phenotype for the partially glycosylated mutants Therefore, although cells expressing either the double or single mutants showed incorporation into the ERC and punctate patterns of cellular localization similar to the wild-type protein, a significant number of transfected cells demonstrated both ERC/punctate and reticular localization within the same cell Furthermore, in cells expressing either the double or single mutants, we tended to see a decrease in the number of cells with the ability to reduce transferrin binding compared with the wild-type protein It should be emphasized in all instances, however, that the majority of single or double mutant transfected cells continued to exhibit ERC/punctate localization and regulate transferrin binding, consistent with production and localization of a functional protein Many studies have demonstrated the importance of glycosylation in the folding and/or oligomerization of trafficking proteins, with underglycosylated proteins frequently becoming misfolded and exhibiting a reticular pattern of cellular localization [41,46–48] Evidence to suggest that N-glycosylation is important also for HFE folding can be observed in many of our experiments The pattern of ER localization observed for the triple mutant, or following tunicamycin treatment of wild-type expressing cells, is similar to that detected for the misfolding HFE-C282Y variant The triple mutant, like HFE-C282Y, also demonstrated a marked decrease in interactions with b2M, which is believed to 3230 be important for HFE folding and stabilization [4,5,8– 11] Our combined biochemical and microscopy studies reveal a consistent picture linking the cell biology of the HFE glycosylation-deficient mutant with that of the HFE-C282Y protein that is known to misfold and induce a cellular unfolded protein response We propose that glycosylation is important for the folding of HFE and is essential for transport and exit of the protein from the ER The importance of glycosylation is cumulative, however, with all three glycosylation sites requiring mutagenesis before an absolute effect was observed Therefore, although glycan addition at just a single site – no matter which one – was sufficient to ensure production of protein that could function in the regulation of transferrin binding, our results likely reflect the fact that the efficiency of folding is compromised by underglycosylation, affecting some but not all proteins as they transit the ER This would in part explain the observed intermediate phenotype for partially glycosylated proteins As might be expected from the ER-localized and potentially misfolding triple mutant, we observed little or no regulation of transferrin binding in cells expressing glycosylation-deficient HFE It remains unclear, however, whether this deficiency is occurring solely as a result of protein mislocalization or whether there might be glycosylation events that are of specific relevance for this parameter of HFE function The results for the 110/130 double mutant were particularly interesting, not only was there a decrease in the number of transfected cells that could regulate transferrin binding compared with the wild-type, but there was also a significant decrease compared with all other single and double mutants Current understanding suggests that the majority of cell types regulate cellular iron levels by binding of transferrin to the type transferrin receptor [15] The crystal structure of HFE complexed to the TfR1 has been determined and although the two proteins interact over a relatively large interface, it has been shown that residues V100 and W103 (V78 and W81 of the mature protein) are of particular importance [16,17,21,22] Additional missense mutations at residues I105 and G93 in this region have also been implicated in the disruption of iron metabolism [49] In structural terms, this corresponds to a helical and loop region in the a1 domain of HFE that incorporates both the N110 and N130 residues Our studies therefore place these N-glycosylation sites in a region of the protein that has previously been mapped as being of functional importance for TfR1 binding It remains possible that the 110/130 combination of mutations may directly disrupt regulation of TfR1, although specific co-immunoprecipitation and FEBS Journal 277 (2010) 3219–3234 ª 2010 The Authors Journal compilation ª 2010 FEBS L Bhatt et al functional studies with TfR1 would be required to further explore this possibility The molecular basis for the observed deficiency in b2M binding of the triple mutant remains unclear One possibility is that glycosylation deficiency compromises HFE folding and the misfolded protein cannot bind b2M At a cellular level, however, underglycosylation of HFE that compromises protein trafficking may mean that it never accesses b2M Further experiments will be needed to clarify the exact sequence with which HFE binds its interacting partners and progress the work of Gross et al [18] who first addressed the sequential order and glycosylation dependence of events In summary, our results demonstrate that N-glycosylation is required for the appropriate localization of HFE, presumably due to effects on trafficking Future studies will address the role that this may play in the functional regulation of transferrin binding Materials and methods Cell culture HEK293T and HuTu80 cells were obtained from the American Type Culture Collection and cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum and 1% penicillin/streptomycin solution Cells were maintained in a 5% CO2 humidified incubator at 37 °C HEK293T were transfected with 1–2 lg of HFE-expressing plasmid DNA using calcium phosphate precipitation HuTu80 cells were transfected using Effectene (Qiagen, Crawley, UK) according to the manufacturer’s protocol Unless otherwise stated, HFE-transfected HEK293T and HuTu80 cells were co-transfected with an equal concentration of pCDNA3.1–b2M or pSPORT–b2M as described previously [11,12,28] Tunicamycin was purchased from Sigma (Arklow, Ireland) Expression constructs and site-directed mutagenesis Mammalian expression vectors pEP7–HA, pEP7–HFE– HA, pEP7–HFE-C282Y–HA, pEP7–HFE–GFP, pEP7– HFE-C282Y–HA, pCDNA3.1–b2M, pSPORT6–b2M, pEGFP–N1 HFE WT pEGFP-N1-HFE-WT and pEGFPN1-HFE-C282Y have been described previously [12,13,28, 50–52] The pEP7–HFE–HA vector was used as template to mutate putative N-glycosylation sites in the HFE coding sequence using the QuikChange Site-Directed Mutagenesis protocol (Stratagene, Agilent Technologies, Dublin, Ireland) To generate the pEP7–HFE-N110A–HA vector we used the following primer set: sense, ATGGAAAATC ACGCCCACAGCAAGGAG; antisense, CTCCTTGTCG N-Glycosylation of HFE TGGGCGTGATTTTCCAT To generate the pEP7–HFEN130A–HA mutation we used the following primer set: sense, ATGCAAGAAGACGCCAGTACCGAGGGC; antisense, GCCCTCGGTACTGGCGTCTTCTTGCAT To generate the pEP7–HFE-N234A–HA vector we used the following primer set: sense, TACTACCCCCAGGCCATC ACCATGAAG; antisense, CTTCATGGTGATGGCCTG GGGGTAGTA Bold type indicates the mutations For simplicity, the proteins expressed from these constructs are frequently described in the text and figures as the single mutants Double glycosylation site mutations were generated by using expression constructs for the single mutants as templates for site-directed mutagenesis The HFE NN110/ 130AA mutant was made by introducing the N130A mutation into the pEP7–HFE-N110A–HA plasmid The HFE NN130/234AA mutant was made by introducing the N234A mutation into the pEP7–HFE-N130A–HA plasmid The HFE NN234/110AA mutant was made by introducing the N110A mutation into the pEP7–HFE-N234A–HA plasmid For simplicity, the proteins expressed from these vectors are frequently described in the text and figures as double mutants An expression construct lacking N-glycosylation sites was generated by introducing the N234A mutation into the pEP7–HFE-NN110/130AA–HA plasmid and sequenced Throughout the text and figures, the protein expressed from this construct is frequently referred as the triple mutant Mutated HFE cDNAs were subcloned into the BglII/ SalI sites of the pEP7–GFP vector [52] Western blot analysis Experimental cells were lysed in RIPA buffer containing complete protease inhibitor (EDTA-free; Boehringer, Dublin, Ireland) and phosphatase inhibitors (1 mm sodium vanadate and sodium fluoride) Cleared cell lysates were fractionated on 11% SDS/polyacrylamide gels and transferred to nitrocellulose membranes for western blotting with a monoclonal anti-HA Ig (Covance, Crawley, UK) Fluorescently tagged goat anti-(mouse secondary Ig) IRDye 680DX (LI-COR Biosciences, Cambridge, UK) was used for primary antibody detection and blots were scanned using an infrared imager (Odyssey; LI-COR Biosciences) Associated software provided quantification of band intensity PNGase F digestion For in vitro deglycosylation experiments, HEK293T cells expressing wild-type and mutant HFE variants were lysed in RIPA buffer Cleared cell lysates were precleared with 20 lL of Protein A/G PLUS-Agarose (Santa Cruz Biotechnology, Heidelberg, Germany) and HA-tagged proteins were immunoprecipitated using a : 200 dilution of rabbit FEBS Journal 277 (2010) 3219–3234 ª 2010 The Authors Journal compilation ª 2010 FEBS 3231 N-Glycosylation of HFE L Bhatt et al polyclonal a-HA (Santa Cruz Biotechnology) and 20 lL of Protein A/G agarose Immunoprecipitates were recovered by centrifugation and washed three times in RIPA buffer Immunoprecipitated proteins were boiled for 10 in the presence of glycoprotein denaturing buffer (New England Biolabs, Hitchin, UK) and transferred to a new tube Samples were then incubated at 37 °C for h with PNGase F and NP-40 as advised by the manufacturer (New England Biolabs) to remove N-glycans Samples were denatured by boiling in Laemmli buffer for and fractionated on 11% polyacrylamide gels before transfer and western blotting as described above Co-immunoprecipitation HEK293T cells were transfected to express wild-type, C282Y, triple-mutant or single-mutant forms of HFE Forty-eight hours later the cells were harvested in 50 mm Hepes buffer (pH7.4) containing 250 mm NaCl, 0.5% Tween-20 and 0.5 mm dithiothreitol and sonicated on ice A sample of cleared cell lysate was fractionated on 11% SDS/ PAGE for anti-HA immunoblotting as described above The remaining cleared cell lysates were precleared with 20 lL of Protein A/G PLUS-Agarose (Santa Cruz Biotechnology) and proteins that were interacting with endogenous b2 were immunoprecipitated using a : 600 dilution of rabbit polyclonal a-b2M (Abcam, Cambridge, UK) and 20 lL of Protein A/G agarose Immunoprecipitates were recovered by centrifugation and washed three times in lysis buffer Immunoprecipitated proteins were boiled for 10 in Laemmli buffer and fractionated on 11% SDS/PAGE gel for immunoblotting with a mouse anti-HA Ig Immunofluorescence microscopy HuTu80 cells were cultured and transfected, and immunofluorescence microscopy was performed essentially as described [28] Primary antibodies used were mouse monoclonal anti-HA (Abcam), rabbit anti-BiP (Abcam) and antiTfnR (Zymed, Biosciences, Dun Laoighaire, Ireland) The secondary antibodies used were goat anti-mouse conjugated to TRITC (Jackson ImmunoResearch, Newmarket, UK) or Alexa Fluor 488 (Molecular Probes, Biosciences, Dun Laoighaire, Ireland), and donkey anti-rabbit conjugated to TRITC or Alexa Fluor 488 Coverslips were mounted in MOWIOL (CalBiochem, Nottingham, UK) For Tfn-binding experiments, cells were serum starved for h and then incubated for h, at °C, with lgỈmL)1 of Alexa Fluor 594-labelled iron-saturated holotransferrin (Invitrogen, Biosciences, Dun Laoghaire, Ireland) Images were recorded using a Zeiss LSM 510 META confocal microscope fitted with a 63·/1.4 plan apochromat lens Co-localization masks were generated with Zeiss image examiner Software Overlapping green and red pixels were extracted from the merged image and converted to white 3232 Acknowledgements This work was supported by grants from Fundacao ¸ ˜ para Ciencia e a Technologia (POCI/SAU-MMO/ ˆ 61129/2004) and the Health Research Board (RP/ 2006/294) to J.V.F and Health Research Board Grant (RP/2005/107) and Science Foundation Ireland (SFI) Investigator Grant (05/IN.3/13859) to MMC The authors wish to thank Maria de Sousa and Sergio de Almeida for useful discussions References Fleming RE, Britton RS, Waheed A, Sly WS & Bacon BR (2005) Pathophysiology of hereditary hemochromatosis Semin Liver Dis 25, 411–419 Pietrangelo A (2002) Physiology of iron transport and the hemochromatosis gene Am J Physiol Gastrointest Liver Physiol 282, G403–G414 Hentze MW, Muckenthaler MU & Andrews NC (2004) Balancing acts: molecular control of mammalian iron metabolism Cell 117, 285–297 Feder JN, Gnirke A, Thomas W, Tsuchihashi Z, Ruddy DA, Basava A, Dormishian F, Domingo R, Ellis MC, Fullan A et al (1996) A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis Nat Genet 13, 399–408 Parkkila S, Waheed A, Britton RS, Bacon BR, Zhou XY, Tomatsu S, Fleming RE & Sly WS (1997) Association of the transferrin receptor in human placenta with HFE, the protein defective in hereditary hemochromatosis Proc Natl Acad Sci USA 94, 13198–13202 Parkkila S, Waheed A, Britton RS, Feder JN, Tsuchihashi Z, Schatzman RC, Bacon BR & Sly WS (1997) Immunohistochemistry of HLA-H, the protein defective in patients with hereditary hemochromatosis, reveals unique pattern of expression in gastrointestinal tract Proc Natl Acad Sci USA 94, 2534–2539 Pietrangelo A (2006) Hereditary hemochromatosis Annu Rev Nutr 26, 251–270 Muckenthaler MU, Rodrigues P, Macedo MG, Minana B, Brennan K, Cardoso EM, Hentze MW & de Sousa M (2004) Molecular analysis of iron overload in beta2microglobulin-deficient mice Blood Cells Mol Dis 33, 125–131 Feder JN, Tsuchihashi Z, Irrinki A, Lee VK, Mapa FA, Morikang E, Prass CE, Starnes SM, Wolff RK, Parkkila S et al (1997) The hemochromatosis founder mutation in HLA-H disrupts beta2-microglobulin interaction and cell surface expression J Biol Chem 272, 14025–14028 10 Waheed A, Parkkila S, Zhou XY, Tomatsu S, Tsuchihashi Z, Feder JN, Schatzman RC, Britton RS, Bacon BR & Sly WS (1997) Hereditary hemochromatosis: effects of C282Y and H63D mutations on FEBS Journal 277 (2010) 3219–3234 ª 2010 The Authors Journal compilation ª 2010 FEBS L Bhatt et al 11 12 13 14 15 16 17 18 19 20 21 association with beta2-microglobulin, intracellular processing, and cell surface expression of the HFE protein in COS-7 cells Proc Natl Acad Sci USA 94, 12384–12389 Bhatt L, Horgan CP & McCaffrey MW (2009) Knockdown of beta2-microglobulin perturbs the subcellular distribution of HFE and hepcidin Biochem Biophys Res Commun 378, 727–731 de Almeida SF, Fleming JV, Azevedo JE, Carmo-Fonseca M & de Sousa M (2007) Stimulation of an unfolded protein response impairs MHC class I expression J Immunol 178, 3612–3619 de Almeida SF, Picarote G, Fleming JV, Carmo-Fonseca M, Azevedo JE & de Sousa M (2007) Chemical chaperones reduce endoplasmic reticulum stress and prevent mutant HFE aggregate formation J Biol Chem 282, 27905–27912 de Almeida SF & de Sousa M (2009) The unfolded protein response in hereditary hemochromatosis J Cell Mol Med 12, 421–434 Feder JN, Penny DM, Irrinki A, Lee VK, Lebron JA, Watson N, Tsuchihashi Z, Sigal E, Bjorkman PJ & Schatzman RC (1998) The hemochromatosis gene product complexes with the transferrin receptor and lowers its affinity for ligand binding Proc Natl Acad Sci USA 95, 1472–1477 Lebron JA, Bennett MJ, Vaughn DE, Chirino AJ, Snow PM, Mintier GA, Feder JN & Bjorkman PJ (1998) Crystal structure of the hemochromatosis protein HFE and characterization of its interaction with transferrin receptor Cell 93, 111–123 Bennett MJ, Lebron JA & Bjorkman PJ (2000) Crystal structure of the hereditary haemochromatosis protein HFE complexed with transferrin receptor Nature 403, 46–53 Gross CN, Irrinki A, Feder JN & Enns CA (1998) Co-trafficking of HFE, a nonclassical major histocompatibility complex class I protein, with the transferrin receptor implies a role in intracellular iron regulation J Biol Chem 273, 22068–22074 Fleming MD, Romano MA, Su MA, Garrick LM, Garrick MD & Andrews NC (1998) Nramp2 is mutated in the anemic Belgrade (b) rat: evidence of a role for Nramp2 in endosomal iron transport Proc Natl Acad Sci USA 95, 1148–1153 Lebron JA, West AP Jr & Bjorkman PJ (1999) The hemochromatosis protein HFE competes with transferrin for binding to the transferrin receptor J Mol Biol 294, 239–245 West AP Jr, Giannetti AM, Herr AB, Bennett MJ, Nangiana JS, Pierce JR, Weiner LP, Snow PM & Bjorkman PJ (2001) Mutational analysis of the transferrin receptor reveals overlapping HFE and transferrin binding sites J Mol Biol 313, 385– 397 N-Glycosylation of HFE 22 Lebron JA & Bjorkman PJ (1999) The transferrin receptor binding site on HFE, the class I MHC-related protein mutated in hereditary hemochromatosis J Mol Biol 289, 1109–1118 23 Salter-Cid L, Brunmark A, Peterson PA & Yang Y (2000) The major histocompatibility complex-encoded class I-like HFE abrogates endocytosis of transferrin receptor by inducing receptor phosphorylation Genes Immun 1, 409–417 24 Salter-Cid L, Brunmark A, Li Y, Leturcq D, Peterson PA, Jackson MR & Yang Y (1999) Transferrin receptor is negatively modulated by the hemochromatosis protein HFE: implications for cellular iron homeostasis Proc Natl Acad Sci USA 96, 5434–5439 25 Roy CN, Penny DM, Feder JN & Enns CA (1999) The hereditary hemochromatosis protein, HFE, specifically regulates transferrin-mediated iron uptake in HeLa cells J Biol Chem 274, 9022–9028 26 Laham N, Rotem-Yehudar R, Shechter C, Coligan JE & Ehrlich R (2004) Tranferrins receptor association and endosomal localization of soluble HFE are not sufficient for regulation of cellular iron homeostasis J Cell Biochem 91, 1130–1145 27 Ikuta K, Fujimoto Y, Suzuki Y, Tanaka K, Saito H, Ohhira M, Sasaki K & Kohgo Y (2000) Overexpression of hemochromatosis protein, HFE, alters transferrin recycling process in human hepatoma cells Biochim Biophys Acta 1496, 221–231 28 Bhatt L, Horgan CP, Walsh M & McCaffrey MW (2007) The hereditary hemochromatosis protein HFE and its chaperone beta2-microglobulin localise predominantly to the endosomal-recycling compartment Biochem Biophys Res Commun 359, 277–284 29 Pinto JP, Ramos P & de Sousa M (2007) Overexpression of HFE in HepG2 cells reveals differences in intracellular distribution and co-localization of wt- and mutated forms Blood Cells Mol Dis 39, 75–81 30 Zhang AS, Davies PS, Carlson HL & Enns CA (2003) Mechanisms of HFE-induced regulation of iron homeostasis: insights from the W81A HFE mutation Proc Natl Acad Sci USA 100, 9500–9505 31 Carlson H, Zhang AS, Fleming WH & Enns CA (2005) The hereditary hemochromatosis protein, HFE, lowers intracellular iron levels independently of transferrin receptor in TRVb cells Blood 105, 2564–2570 32 Kawabata H, Yang R, Hirama T, Vuong PT, Kawano S, Gombart AF & Koeffler HP (1999) Molecular cloning of transferrin receptor A new member of the transferrin receptor like family J Biol Chem 274, 20826–20832 33 Chen J, Chloupkova M, Gao J, Chapman-Arvedson TL & Enns CA (2007) HFE modulates transferrin receptor levels in hepatoma cells via interactions that FEBS Journal 277 (2010) 3219–3234 ª 2010 The Authors Journal compilation ª 2010 FEBS 3233 N-Glycosylation of HFE 34 35 36 37 38 39 40 41 42 43 L Bhatt et al differ from transferrin receptor 1–HFE interactions J Biol Chem 282, 36862–36870 Goswami T & Andrews NC (2006) Hereditary hemochromatosis protein, HFE, interaction with transferrin receptor suggests a molecular mechanism for mammalian iron sensing J Biol Chem 281, 28494–28498 Ludwiczek S, Theurl I, Bahram S, Schumann K & ă Weiss G (2005) Regulatory networks for the control of body iron homeostasis and their dysregulation in HFE mediated hemochromatosis J Cell Physiol 204, 489– 499 Muckenthaler M, Roy CN, Custodio AO, Minana B, deGraaf J, Montross LK, Andrews NC & Hentze MW (2003) Regulatory defects in liver and intestine implicate abnormal hepcidin and Cybrd1 expression in mouse hemochromatosis Nat Genet 34, 102–107 Nicolas G, Viatte L, Lou D-Q, Bennoun M, Beaumont C, Kahn A, Andrews NC & Vaulont S (2003) Constitutive hepcidin expression prevents iron overload in a mouse model of hemochromatosis Nat Genet 34, 97–101 Matzuk M & Boime I (1988) The role of the asparagine-linked oligosaccharides of the alpha subunit in the secretion and assembly of human chorionic gonadotrophin J Cell Biol 106, 1049–1059 Matzuk M, Keene J & Boime I (1989) Site specificity of the chorionic gonadotropin N-linked oligosaccharides in signal transduction J Biol Chem 264, 2409–2414 Makanji Y, Harrison CA, Stanton PG, Krishna R & Robertson DM (2007) Inhibin A and B in vitro bioactivities are modified by their degree of glycosylation and their affinities to betaglycan Endocrinology 148, 2309–2316 Williams A & Enns C (1991) A mutated transferrin receptor lacking asparagine-linked glycosylation sites shows reduced functionality and an association with binding immunoglobulin protein J Biol Chem 266, 17648–17654 Williams A & Enns C (1993) A region of the C-terminal portion of the human transferrin receptor contains an asparagine-linked glycosylation site critical for receptor structure and function J Biol Chem 268, 12780–12786 Schimanski LM, Drakesmith H, Sweetland E, Bastin J, Rezgui D, Edelmann M, Kessler B, Merryweather- 3234 44 45 46 47 48 49 50 51 52 Clarke AT, Robson KJ & Townsend AR (2009) In vitro binding of HFE to the cation-independent mannose-6 phosphate receptor Blood Cells Mol Dis 43, 180–193 Elbein AD (1987) Inhibitors of the biosynthesis and processing of N-linked oligosaccharide chains Annu Rev Biochem 56, 497–534 Parham P, Alpert BN, Orr HT & Strominger JL (1977) Carbohydrate moiety of HLA antigens Antigenic properties and amino acid sequences around the site of glycosylation J Biol Chem 252, 7555–7567 Zhang Y & Dahms NM (1993) Site-directed removal of N-glycosylation sites in the bovine cation-dependent mannose 6-phosphate receptor: effects on ligand binding, intracellular targetting and association with binding immunoglobulin protein Biochem J 295(Pt 3), 841–848 Weitz G & Proia RL (1992) Analysis of the glycosylation and phosphorylation of the alpha-subunit of the lysosomal enzyme, beta-hexosaminidase A, by site-directed mutagenesis J Biol Chem 267, 10039– 10044 Ng DT, Hiebert SW & Lamb RA (1990) Different roles of individual N-linked oligosaccharide chains in folding, assembly, and transport of the simian virus hemagglutinin-neuraminidase Mol Cell Biol 10, 1989–2001 Barton JC, Sawada-Hirai R, Rothenberg BE & Acton RT (1999) Two novel missense mutations of the HFE gene (I105T and G93R) and identification of the S65C mutation in Alabama hemochromatosis probands Blood Cells Mol Dis 25, 147–155 Fleming JV, Fajardo I, Langlois MR, Sanchez-Jimenez F & Wang TC (2004) The C-terminus of rat l-histidine decarboxylase specifically inhibits enzymic activity and disrupts pyridoxal phosphate-dependent interactions with l-histidine substrate analogues Biochem J 381(Pt 3), 769–778 Fleming JV, Sanchez-Jimenez F, Moya-Garcia AA, Langlois MR & Wang TC (2004) Mapping of catalytically important residues in the rat l-histidine decarboxylase enzyme using bioinformatic and site-directed mutagenesis approaches Biochem J 379(Pt 2), 253– 261 Fleming JV & Wang TC (2003) The production of 53–55-kDa isoforms is not required for rat l-histidine decarboxylase activity J Biol Chem 278, 686–694 FEBS Journal 277 (2010) 3219–3234 ª 2010 The Authors Journal compilation ª 2010 FEBS ... effect of HFE binding to TfR1 is to lower the affinity of the receptor for transferrin [15] This most likely reflects the existence of overlapping HFE and transferrin- binding sites on the receptor... understanding suggests that the majority of cell types regulate cellular iron levels by binding of transferrin to the type transferrin receptor [15] The crystal structure of HFE complexed to the. .. We propose that glycosylation is important for the folding of HFE and is essential for transport and exit of the protein from the ER The importance of glycosylation is cumulative, however, with