The SWI ⁄ SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt Patrick Lore ` s 1,2, *, Orane Visvikis 1,2, *, Rosa Luna 1,2 , Emmanuel Lemichez 3,4 and Ge ´ rard Gacon 1,2 1 Institut Cochin, Universite ´ Paris Descartes, CNRS (UMR8104), Paris, France 2 INSERM, U567, Paris, France 3 INSERM, U895, Centre Me ´ diterrane ´ en de Me ´ decine Mole ´ culaire, C3M, Toxines Microbiennes dans la relation ho ˆ te pathoge ` nes, Nice, France 4 Universite ´ de Nice Sophia-Antipolis, UFR Me ´ decine, Nice, France Keywords BAF60; Rac GTPase; RING finger; SWI ⁄ SNF complex; ubiquitination Correspondence G. Gacon, De ´ partement Ge ´ ne ´ tique et De ´ veloppement, Institut Cochin, 24 rue du Faubourg Saint-Jacques, 75014 Paris, France Fax: +33 1 44 41 24 48 Tel: +33 1 44 41 24 70 E-mail: gerard.gacon@inserm.fr *These authors contributed equally to this work (Received 4 September 2009, revised 30 November 2009, accepted 8 January 2010) doi:10.1111/j.1742-4658.2010.07575.x The SWI ⁄ SNF chromatin remodelling complexes are important regulators of transcription; they consist of large multisubunit assemblies containing either Brm or Brg1 as the catalytic ATPase subunit and a variable subset of approximately 10 Brg⁄ Brm-associated factors (BAF). Among these factors, BAF60 proteins (BAF60a, BAF60b or BAF60c), which are found in most complexes, are thought to bridge interactions between transcription factors and SWI ⁄ SNF complexes. We report here on a Rac-dependent process leading to BAF60b ubiquitination. Using two-hybrid cloning procedures, we identified a mammalian RING finger protein homologous to drosophila Unkempt as a new partner of the activated form of RacGTPases and dem- onstrated that mammalian Unkempt specifically binds to BAF60b and pro- motes its ubiquitination in a Rac1-dependent manner. Immunofluorescence studies demonstrated that Unkempt is primarily localized in the cytoplasmic compartment, but has the ability to shuttle between the nucleus and the cytoplasm, suggesting that the Rac- and Unkempt-dependent process lead- ing to BAF60b ubiquitination takes place in the nuclear compartment. Ubiquitinated forms of BAF60b were found to accumulate upon treatment with the proteasome inhibitor MG132, indicating that BAF60b ubiquitina- tion is of the degradative type and could regulate the level of BAF60b in SWI ⁄ SNF complexes. Our observations support the new idea of a direct connection between Rac signalling and chromatin remodelling. Structured digital abstract l MINT-7543606: Rac1 (uniprotkb:P63000) physically interacts (MI:0915) with Unkempt (uni- protkb: B1GXI8)bytwo hybrid (MI:0018) l MINT-7543198: Unkempt (uniprotkb:B1GXI8) physically interacts (MI:0915) with Rac1 (uni- protkb: P63000)bypull down (MI:0096) l MINT-7543251: Unkempt (uniprotkb:B1GXI8) physically interacts (MI:0915) with BAF60b (uniprotkb: B4DV56)bypull down (MI:0096) l MINT-7543745: Unkempt (uniprotkb:B1GXI8) physically interacts (MI:0915) with BAF60b (uniprotkb: B4DV56)bytwo hybrid (MI:0018) l MINT-7543182: Ubiquitin (uniprotkb:P61864) physically interacts (MI:0915) with Unkempt (uniprotkb: B1GXI8)bypull down (MI:0096) l MINT-7543805: Ubiquitin (uniprotkb:P61864) physically interacts (MI:0915) with Unkempt (uniprotkb: Q6RUT6)bypull down (MI:0096) l MINT-7543760: Ubiquitin (uniprotkb:P61864) physically interacts (MI:0915) with BAF60b (uniprotkb: B4DV56)bypull down (MI:0096) Abbreviations BAF, Brg ⁄ Brm-associated factor; GST, glutathione S-tranferase; HA, hemagglutinin; UNK-C-ter, Unkempt C-terminal region; UNK-fl, full- length Unkempt; shRNA, short hairpin RNA. FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS 1453 Introduction The SWI ⁄ SNF chromatin remodelling complexes are evolutionary conserved multimeric enzymes using ATP hydrolysis to mobilize nucleosomes and remodel chromatin structure [1–4]; these complexes are large multisubunit assemblies containing either Brm or Brg1 as the catalytic ATPase subunit and a variable subset of approximately 10 Brg ⁄ Brm-associated factors (BAF). Among the later, the 60 kDa subunit BAF60 is found in most complexes; it can be represented by BAF60a, BAF60b or BAF60c, which are encoded by the smarcd1, smarcd2 and smarcd3 genes, respectively [1]. BAF60 proteins have been shown to interact with multiple transcription factors and are thought to bridge interactions between these transcription factors and SWI ⁄ SNF complexes, thereby allowing the recruit- ment of SWI ⁄ SNF to target genes [5–9]. Biochemical purification and analysis of SWI ⁄ SNF complexes have revealed that few to no free subunits are present within the cells, suggesting that most, if not all, subunits are assembled into the complexes [1]. Thus, cells must co-ordinate the expression and degradation of SWI ⁄ SNF subunits in order to maintain the stoichiome- try of the complexes. Recent studies have demonstrated the role of protein–protein interactions, ubiquitination and proteasomal degradation in regulating SWI⁄ SNF subunit levels [10,11]. However, the mechanisms leading to ubiquitination of specific SWI ⁄ SNF subunits and their regulation have not been molecularly defined. Ubiquitination consists of the covalent attachment to proteins of ubiquitin, a highly conserved 76 amino acid polypeptide. It is catalysed by three enzymes: a ubiquitin-activating enzyme (E1), a ubiquitin-conjugat- ing enzyme (E2) and a ubiquitin protein ligase (E3), acting sequentially to form an isopeptide bond between the ubiquitin C-terminus and the e-amino group of lysines of the protein substrate; ubiquitin contains seven lysine residues that can be attached to other ubiquitins in a highly processive reaction to form a polyubiquitin chain [12,13]. The specificity of protein ubiquitination is conferred by E3 ligases, which have the ability to bind both to an E2 and to the substrate; consistently, in contrast to two E1 genes and less than 40 E2 genes, a genome-wide annotation of human E3 ligases recently identified more than 600 genes encod- ing putative E3s, the vast majority of which exhibit a RING finger domain [14]. Ubiquitination, which was initially found to target proteins to proteasomal degra- dation, has emerged more recently as a central regula- tory mechanism that controls not only protein stability, but also localization, interactions and func- tions of modified proteins [15,16]. We report here on the occurrence of BAF60 ubiqui- tination. We have identified and characterized a signal- ling process involving Rac GTPase and a novel partner of activated Rac, the RING finger protein Unkempt, which binds to BAF60b and promotes its specific ubiquitination. Results Unkempt protein binds specifically to activated forms of RacGTPases In a two-hybrid screen for partners of activated RacGTPase, we isolated a human cDNA sequence with a partial ORF showing a strong homology with a previously described drosophila protein, d-Unkempt [17], and with Unkempt-like sequences from human and mouse origin (accession UniProtKB ⁄ TrEMBL Q9H9P5 and Q6RUT6, respectively). Northern blot analysis revealed ubiquitous expression of a 4.4 kb mRNA in mouse tissues (not shown). Iterative 5¢ RACE PCR amplification starting from mouse and human RNA resulted in ORFs encoding two predicted proteins of 678 and 680 amino acids, respectively, with quasi-identical sequences (87% identity; 95% similar- ity) and significant homology with the full-length dro- sophila d-Unkempt (40% identity; 64% similarity) (Fig. 1A). The novel human mRNA sequence that encodes the 680 amino acid Unkempt-like protein has been assigned the accession number AM944365 by the EMBL nucleotide sequence database. Alignment of drosophila Unkempt protein with mouse and human Unkempt-like sequences revealed conserved zinc finger motifs in the N-terminal part of the protein and a RING finger at the C-terminal end (Fig. 1A). For further studies, we constructed plasmids encoding glutathione S-transferase (GST)- and hemagglutinin (HA)-tagged human Unkempt C-terminal region (UNK-C-ter) and murine full-length Unkempt (UNK- fl), as well as mutated versions of these proteins, as shown in Fig. 1B. Interestingly, the putative interaction between acti- vated Rac and UNK-C-ter could be validated by GST pull-down experiments. Indeed, the results confirmed the specificity of the binding of activated Rac to UNK-C-ter, as the GTP-bound form Rac1L61 showed a strong binding to UNK-C-ter, whereas Rac1 WT (predominantly GDP bound) and Rac1N17 (a domi- nant negative form of Rac) did not interact with UNK-C-ter (Fig. 2) and neither RhoAL63 nor Cdc42L61, i.e. the activated forms of archetypal mem- BAF60b ubiquitination is controlled by Rac and Unkempt P. Lore ` s et al. 1454 FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS bers of Rho and Cdc42 subfamilies, was able to bind to UNK-C-ter (Fig. 2). Of note, the disruption of the RING finger in the mutant form UNK-C-ter double mutant (C639A ⁄ C670A double mutant) did not impair the binding of RacGTP. The data indicate that Unkempt is a specific partner of the GTP-bound form of RacGTPases and therefore suggest that its function, whatever it is, may be regulated by Rac signalling. Little is known about the role of Unkempt in dro- sophila: homozygous inactivation of d-unkempt resulted in larval lethality, whereas heterozygous flies bearing an hypomorphic allele showed roughened eyes, splayed wings and crossed scutellar bristles, i.e. the so-called Unkempt phenotype [17]. Moreover, the biochemical activity of d-Unkempt protein has not been documented. Unkempt ubiquitination is stimulated by activated Rac As mentioned above (Fig. 1A, B), Unkempt contains in its C-terminal region a conserved RING finger, a motif that is typical of a large group of E3 ubiquitin ligases known as RING E3s [14,18]; this prompted us to investigate whether self-ubiquitination and ubiquitin A B Fig. 1. Structure of Unkempt proteins. (A) Sequence alignment of human, mouse and drosophila Unkempt proteins. Triple identity is shown in red, double identity in orange. Zinc finger and RING finger motifs are indicated by blue and green bars, respectively, the conserved C ⁄ H being indicated by asterisks. The position of the C-terminal RING finger deletion in UNK-fl-DRF is indicated by a red arrowhead. (B) Sche- matic representation of the Unkempt-derived proteins used in the present study. Zinc finger and RING finger motifs are in dark and light grey, respectively. The C to A mutations of the RING finger in UNK-C-ter double mutant (UNK-C-ter-DM) are indicated. P. Lore ` s et al. BAF60b ubiquitination is controlled by Rac and Unkempt FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS 1455 ligase activity were associated with mammalian Unkempt. HA-tagged versions of Unkempt and 6-His-tagged ubiquitin were coexpressed in cultured cells and the resulting 6-His-tagged ubiquitinated proteins were col- lected on cobalt beads and analysed by western blot- ting. Following this procedure, we were able to demonstrate Unkempt ubiquitination in various cell lines, including CHO, HEK 293 (not shown) and HeLa. As shown in Fig. 3A, UNK-C-ter ubiquitination was clearly detected in HeLa cells; interestingly, the ubiquitination pattern was enhanced by activated Rac1(Rac1L61) and decreased by the dominant nega- tive mutant Rac1N17, thus suggesting that Rac activa- tion positively regulates Unkempt ubiquitination. Of note, the substitution of two cysteine residues in the RING finger motif (C639A ⁄ C670A double mutant; see Fig. 1B) did not drastically impair UNK-C-ter ubiqui- tination; the stimulating effect of activated Rac was also maintained in the mutant (Fig. 3A). Analysis of UNK-fl ubiquitination led to similar observations, as shown in Fig. 3B: UNK-fl ubiquitination was found to be inhibited by Rac1N17 and stimulated by activated Rac1 and deletion of the RING finger in UNK-fl (UNK-fl DRF) did not abrogate, but rather enhanced, ubiquitination and did not alter the stimulating effect of activated Rac. In all cases, proteasome inhibition through MG132 treatment resulted in the accumulation of ubiquitinated forms (as illustrated for UNK-C-ter in Fig. 3A). Collectively, the above data indicate that Unkempt does undergo ubiquitination; this process is clearly up- regulated by activated Rac. Surprisingly, the RING finger domain appears to be dispensable for Unkempt ubiquitination, thus suggesting the involvement of partner protein(s) contributing Ubiquitin ligase activ- ity. In this connection, it is noteworthy that several Fig. 2. Unkempt interacts specifically with activated Rac GTPase. HeLa cells were transfected with plasmids encoding myc-tagged GTPases RhoA, Rac1 and Cdc42, either wild-type (Rac1WT and Cdc42WT), inactive mutant form (Rac1N17) or activated mutant forms (RhoAL63, Rac1L61, Cdc42L61).The expression level of GTP- ases in total cellular lysates is shown (input). The GTPases were extracted from lysates with GST-UNK-C-ter (WT or RING finger double mutant) beads, or with GST beads as a control, and pull- down proteins were revealed by anti-myc western blotting (pull- down). The results are representative of three experiments. A B Fig. 3. Ubiquitination of Unkempt is dependent on activated Rac. Ubiquitination of Unkempt was assessed by transfecting HeLa cells with a combination of expression plasmids encoding 6His-Ub, myc-Rac1L61 ⁄ N17 and HA-UNK-C-ter or HA-UNK-fl as indicated. Ubiquitinated proteins were extracted on cobalt beads and immu- noblotted with anti-HA IgG. The expression of transfected proteins was monitored on total protein extracts by immunoblotting using the indicated antibodies. Where indicated, cells were treated with the proteasome inhibitor MG132 for 4 h prior to lysis. (A) Ubiquiti- nation of UNK-C-ter. WT, UNK-C-ter wild-type; DM, UNK-C-ter dou- ble mutant C639A, C670A. (B) Ubiquitination of UNK-fl. WT, UNK-fl wild-type; DRF, UNK-fl with RING finger deletion. The results are representative of at least three experiments. BAF60b ubiquitination is controlled by Rac and Unkempt P. Lore ` s et al. 1456 FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS RING finger proteins devoid of intrinsic ubiquitin ligase activity have been found to form oligomeric complexes, especially with other RING finger proteins, resulting in active E3 ligases [19–22]. We therefore reasoned that Unkempt may partici- pate in a protein complex showing an E3 ligase activity regulated by Rac and directed towards Unkempt itself and possibly other substrates to be identified. BAF60b, a component of the SWI ⁄ SNF chromatin remodelling complex, shows a Rac ⁄ Unkempt- dependent ubiquitination In a search for Unkempt interacting proteins, a two-hybrid screen using UNK-C-ter as bait allowed the isolation of several independent cDNA clones encoding the C-terminal part of BAF60b ⁄ SMARCD2 (see Materials and methods, and Fig. 4A); BAF pro- teins are constitutive of the SWI ⁄ SNF multiprotein chromatin remodelling complexes that contain either Brm or Brg1 as the core ATP hydrolysing subunit [1–3]. BAF60a, b and c are homologous proteins, thought to bridge interactions between transcription factors and SWI ⁄ SNF complexes [5–9]. Despite the overall homology among BAF60 family members, pull-down experiments demonstrated a clear interaction of UNK-C-ter only with BAF60b (Fig. 4B). Sequencing our BAF60a, b and c encoding plasmids revealed significant differences between BAF60b and both BAF60a and BAF60c within the region involved in UNK-C-ter interaction, which could explain their differential binding (Fig. 4A). Substitution of two conserved cysteine residues in the A B Fig. 4. BAF60 proteins and their interactions with UNK-C-ter. (A) Sequence alignment of human BAF60a, b and c proteins used in the pres- ent study. Triple identity is indicated in red, double identity in orange. The region of BAF60b involved in UNK-C-ter interaction, as mapped from two-hybrid clones, is underlined (green bar). (B) UNK-C-ter interacts specifically with BAF60b. HeLa cells were transfected with expres- sion plasmids encoding FLAG-tagged BAF60a, b or c. Proteins were extracted from lysates with GST-UNK-C-ter (WT or RING finger double mutant) beads, or by GST beads as a control, and pull-down proteins were revealed by anti-FLAG western blotting. Identical results were obtained in two independent experiments. P. Lore ` s et al. BAF60b ubiquitination is controlled by Rac and Unkempt FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS 1457 RING finger motif of UNK-C-ter (C639A ⁄ C670A double mutant) did not significantly alter the binding of BAF60b (Fig. 4B). Considering that BAF60b may be a partner of Unkempt, we investigated BAF60b ubiquitination and its regulation by Rac and Unkempt. Attempts to detect the ubiquitinated fraction of endogenous BAF60b were unsuccessful, possibly due to the low sensitivity of available antibodies (not shown). There- fore, a FLAG-tagged version of BAF60b was expressed in HeLa cells, and the resulting ubiquitina- tion of FLAG-BAF60b could be analysed. As illustrated in Fig. 5A, ubiquitinated forms of BAF60b were detected in HeLa cells in the absence of ectopic expression of Unkempt; they were found to accumulate upon treatment with the proteasome inhibi- tor MG132, indicating that BAF60b ubiquitination is at least partly of the degradative type. Interestingly, simi- lar patterns of BAF60b ubiquitination were observed in HEK 293 and CHO cell lines (Fig. 5A). Most AB CD Fig. 5. Ubiquitination of BAF60b. (A) Ubiquitinated BAF60b is detected in HeLa, HEK 293 and CHO-K1 cells in the absence of exogenous Unkempt and accumulates upon treatment with proteasome inhibitor MG132. Ubiquitination of BAF60b was assessed by transfecting cells with plasmids encoding 6His-Ub and FLAG-BAF60b; where indicated, cells were treated with the proteasome inhibitor MG132 for 4 h prior to lysis. Ubiquitinated proteins were collected on cobalt beads and immunoblotted with anti-FLAG IgG. (B) BAF60b ubiquitination is downreg- ulated by an Unkempt-specific shRNA. HeLa cells were transfected with pSUPER plasmids containing either no additional sequence (h), a scrambled sequence (SCR) or an Unkempt targeting sequence (UNK) prior to performing ubiquitination assays (see Experimental procedures for details and sequences). The same experiment was performed four times with similar results. (C) BAF60b is the preferred substrate of Unkempt-dependent ubiquitination. Ubiquitination of BAF60a, b and c was assessed by transfecting HeLa cells with a combination of expres- sion plasmids encoding 6His-Ub, FLAG-BAF60a, b or c, and HA-UNK-C-ter. Ubiquitinated proteins were collected on cobalt beads and immu- noblotted with anti-FLAG Ig. Where indicated, cells were treated with the proteasome inhibitor MG132 for 4 h prior to lysis. (D) BAF60b ubiquitination is strongly dependent on Rac activation. Ubiquitination assays were carried out as previously described, in HeLa cells express- ing either no exogenous Unkempt, UNK-C-ter, or UNK-fl and Rac1N17 or Rac1L61, as indicated. The results are representative of at least three experiments. BAF60b ubiquitination is controlled by Rac and Unkempt P. Lore ` s et al. 1458 FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS importantly, in HeLa cells, the expression of an Unkempt-specific short hairpin RNA (shRNA) led to a more than 80% knockdown of Unkempt mRNA, as measured by semiquantitative RT-PCR, and resulted in a clear decrease in the amount of ubiquitinated BAF60b (Fig. 5B), implying that endogenous Unkempt is involved in BAF60b ubiquitination. As expected, expression of UNK-C-ter resulted in enhanced ubiquitination of BAF60b (Fig. 5C, left panel); of note, ubiquitination assays run in parallel with BAF60a, b and c demonstrated that, in agreement with interaction studies (see Fig. 4), BAF60b is the preferred substrate of Unkempt-dependent ubiquitina- tion. Similar to the pattern observed in the absence of ectopic expression of Unkempt (Fig. 5A), ubiquiti- nated forms of BAF60b generated in the presence of UNK-C-ter strongly accumulated upon MG132 treat- ment (Fig. 5C, right panel). Next, we analysed the effects of Rac activation on BAF60b ubiquitination. When coexpressed with the dominant negative mutant Rac1N17 (i.e. in the absence of activated Rac), BAF60b was poorly ubiqui- tinated; by contrast, the ubiquitination profile was strikingly enhanced by coexpression of Rac1L61 (Fig. 5D, lane 1 versus 4). Similarly, in the presence of exogenous Unkempt, either UNK-C-ter or UNK-fl, the amount of BAF60b ubiquitination appeared strongly dependent on Rac activation (Fig. 5D, lane 2 versus 5 and lane 3 versus 6). Interestingly, the stimu- lation of BAF60b ubiquitination could be replicated by treating HeLa cells with CNF1, a toxin from uro- pathogenic Escherichia coli known to strongly activate endogenous Rac [23], thus confirming the results of ectopic expression of activated Rac (not shown). Although Unkempt seems to play a critical role in BAF60b ubiquitination, it is noteworthy that muta- ted ⁄ deleted forms UNK-C-ter and UNK DRF retained full efficiency in BAF60b ubiquitination and Rac- dependent regulation (Fig. S1), thus suggesting that the RING finger domain of ectopically expressed Unkempt is not critical for these effects. The above data indicate that BAF60b ubiquitination is an Unkempt-dependent process and is tightly regu- lated by Rac GTPase. Unkempt protein shuttles between cytosolic and nuclear compartments in HeLa cells Assuming that BAF60b is ubiquitinated through a process depending on Unkempt and activated Rac, the question arises of the cellular compartment where this process takes place. Indeed, although Rac activation is believed to occur primarily at the plasma membrane, BAF60b, as well as BAF60a and BAF60c, were found, as expected, entirely localized to the nuclear compart- ment (Fig. 6A). Conversely, UNK-fl was detected mostly in the cytosol; however, it was found to accu- mulate in the nucleus upon treatment of the cells with leptomycin B, a specific inhibitor of the nuclear export protein exportin 1 (Fig. 6B). This observation is strong evidence that UNK-fl has the ability to shuttle between the nucleus and the cytoplasm and can therefore reach its putative substrate BAF60b in the nuclear compart- ment. Interestingly in this regard, several studies have reported on the localization of Rac1GTPase in the nuclear compartment; specifically, it has been shown that the polybasic sequence in the Rac1 C-terminal region behaves like an active nuclear localization signal (NLS) [24]. Moreover, Rac1, in association with Mgc- RacGAP, has also been implicated in the nuclear entry of signal transducer and activator of transcription (STAT) transcription factors [25]. Finally, recent studies have convincingly demonstrated a cell cycle- dependent modulation of the amount of Rac1 in the nucleus (i.e. accumulation in late G2 and exclusion in early G1) [26]. These results prompted us to investigate whether the binding of activated Rac might influence the shuttling of Unkempt between cytosol and nucleus: so far we have not been able to demonstrate any dif- ferential effect of Rac1L61 or Rac1N17 on nuclear accumulation of Unkempt (not shown). However, taken together, these data support the idea that Rac and Unkempt can translocate in the nuclear compartment and activate BAF60b ubiquitination; how these processes are co-ordinated remains to be analysed. Discussion Although the results reported above are consistent with BAF60b being ubiquitinated through a Rac- and Unkempt-dependent process, the molecular composi- tion of the E3 ligase involved and the role of Unkempt RING finger remain uncertain. On the basis of the results of a mutational analysis (Figs 3 and S1), it appears that the RING finger of exogenously expressed Unkempt is not critically involved in the ubiquitination reaction. A possible explanation is that exogenously expressed mutants of Unkempt form dimers ⁄ oligomers with endogenous Unkempt and ⁄ or associates with other RING finger protein(s), resulting in active E3 ligase. As already mentioned, there are multiple examples of RING E3s, the activity of which critically depends on multiprotein complexes, including homo- or hetero-oligomers of RING finger proteins. Of note, interaction between RING finger proteins P. Lore ` s et al. BAF60b ubiquitination is controlled by Rac and Unkempt FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS 1459 does not necessarily depend on the RING finger motif itself. Thus, yBRE1, a RING finger protein involved in H2B ubiquitination in budding yeast, forms a homomeric complex, possibly a tetramer, through multiple intermolecular interactions, implicating only minimally the C-terminal RING finger [27]. Similarly, in human, the RING finger type paralogs hBRE1A and hBRE1B form a heterotetramer and are both required for H2B ubiquitination, but the hBRE1B RING finger is dispensable [28]. Another interesting example is provided by Pirh2, a p53-induced RING finger E3 ligase promoting ubiquitination and degrada- tion of p53; very recently, isoforms of Pirh2 with a dis- rupted RING finger motif have been found capable of promoting p53 ubiquitination, possibly through their ability to interact directly with MDM2, the principal E3 ligase for p53 [24,29]. The RING finger protein Unkempt may share similarities with these models. We have recently observed that UNK-C-ter is capable of forming homomeric complexes in GST pull-down experiments (unpublished results); however, it remains to be demonstrated that an E3 ligase activity is associ- ated with Unkempt homomers (or with heteromers involving an unidentified RING finger protein) and whether and how RacGTP regulates this putative E3 ligase. To address these issues, in vitro studies aimed at analysing intrinsic E3 ligase activity of recombinant Unkempt will be required. Our results also raise the questions of the physiolog- ical relevance and significance of BAF60b ubiquitina- tion. Unfortunately, using available antibodies to BAF60b, we were not able to detect ubiquitinated forms of endogenous BAF60b. However, in HeLa cells expressing exogenous BAF60b, we found that BAF60b is significantly ubiquitinated, even in the absence of exogenous Unkempt; in addition, the ubiquitinated forms of BAF60b strongly accumulated in the presence of MG132, suggesting that the fate of ubiquitinated BAF60b is proteasomal degradation. Thus, it may be that ubiquitination results in degradation of an excess of BAF60b subunits, thereby allowing the stoichiome- try of SWI ⁄ SNF complexes to be maintained. Another interesting possibility would be that BAF60b, alone or in complex with Unkempt, interacts with other uniden- A B Fig. 6. Subcellular localization of BAF60 and Unkempt proteins. (A) Nuclear localization of BAF60 proteins. HeLa cells were trans- fected with FLAG-BAF60a, b or c, and FLAG immunofluorescence was carried out on fixed cells the following day. (B) Nucleocyto- plasmic shuttling of Unkempt. HeLa cells were transfected with HA-UNK-fl expression vector, and left untreated or treated over- night with the nuclear export inhibitor lepto- mycin B (LMB). Unkempt accumulated in the cytoplasm of untreated cells (upper panels), but could also be detected in the nucleus of LMB-treated cells (lower panels). BAF60b ubiquitination is controlled by Rac and Unkempt P. Lore ` s et al. 1460 FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS tified substrates of Unkempt-dependent E3 ligase. As previously mentioned, BAF60 proteins are thought to bridge interactions between transcription factors and SWI ⁄ SNF complexes [5–9]; therefore, candidate sub- strates include other constituents of SWI ⁄ SNF com- plexes, some of which have been found to be regulated by proteasomal degradation [10,11], and transcription factors targeted by BAF60b that remain to be defined. Whatever the precise mechanisms are, Unkempt may be importantly linked to the physiological control of the SWI ⁄ SNF complexes, thus opening up a direct connection between Rac signalling and chromatin remodelling. Experimental procedures cDNA cloning Two-hybrid cloning procedures using RacL61 as a bait to screen a Jurkat cDNA library have been previously described [30]. Among others, we isolated a series of overlap- ping clones homologous to drosophila Unkempt [17]. Several rounds of 5¢ RACE were performed (5¢RACE System; Invitrogen, Carlsbad, CA, USA) to complete the human and mouse cDNA sequences, using as templates human and mouse polyA + -enriched fractions extracted from peripheral blood leukocytes and kidney, respectively. cDNA sequences deduced from sequencing overlapping 5¢ RACE fragments were confirmed by resequencing both strands of the complete cDNAs amplified by RT-PCR (Access RT- PCR System; Promega, Madison, WI, USA) using 5¢- and 3¢-specific primers. In the search for Unkempt-interacting proteins, a human placental cDNA library was screened with UNK-C-ter as the bait (Hybrigenics S.A., Paris, France); this resulted in the isolation of four ‘high confidence’-independent clones encoding overlapping regions of hSMARCD2 ⁄ BAF60b. DNA plasmids and mutagenesis Mouse and human Unkempt cDNA were inserted in N-ter- HA pcDNA-3 (Invitrogen) and in pGEX-4T2 (Pharmacia, Pfizer, New York, NY, USA) plasmid vectors. A RING finger deletion mutant was generated from the full-length sequence in pCDNA3 by NcoI digestion, Kle- now extremities fill-in and re-ligation. Human cDNAs of WTRac1 and WTCdc42, dominant negative mutant Rac1N17 and constitutively activated forms Rac1L61, Cdc42L61 and RhoAL63, cloned in pRK5-myc plasmids were obtained from A. Hall (Memorial Sloan-Kettering Cancer Center, New York, NY, USA); the pRBG4-6His- myc-Ub plasmid has been used previously [31,32]. Expres- sion vectors encoding FLAG-BAF60a, b and c were generated by inserting BAF60a, b and c cDNAs (a gift from W. Wang, National Institutes of Health, Baltimore, MD, USA) into a p3XFLAG-myc-CMV Ò -24 expression vector (Sigma, St Louis, MO, USA). The point mutations were generated with primers 5¢CCGCTCCCGGCAGGCCACAGC CTGCCTGGCGCG GAGCTGG (for C639A mutation) and 5¢CCTTGCAG TAGGGGGCCTCAGGTGCGGTGGC (for C670A m uta- tion) and their respective reverse complement primers, using the QuickChange-Site Directed Mutagenesis Kit (Strata- gene, La Jolla, CA, USA ) following the manufacturer’s procedure. In all cases, the absence of additional mutations was verified by sequencing the entire coding region. Unkempt mRNA silencing pSUPER.basic (Oligoengine, Seattle, WA, USA) was used as a shRNA expression vector, to target the Unkempt mRNA sequence 5¢GCAGAACCACCTGGCCGTG. The scrambled sequence 5¢CGGACCGGACTTCGACGCAC was used as a control. The construction of pSUPER vectors was carried out following the manufacturer’s instructions. In silencing experiments, HeLa cells were transfected twice with pSUPER plasmids (with a 24 h inter- val) and RNAs were extracted 24 h after the second trans- fection, using RNAxel (Eurobio, Les Ulis, France). Unkempt cellular mRNA levels were monitored by RT-PCR (Access RT-PCR system; Promega, Madison, WI, USA) using Unkempt-specific primers 5¢TCTTCGAGTG CAAGTCCAAA and 5¢AAGATCACCTGTGCCTCCAC, and normalized against endogenous glutamic acid decar- boxylase mRNA levels, detected by RT-PCR with specific primers 5¢GTCAGCCGCATCTTCTTTTG and 5¢GCAGA GATGATGACCCTTT. Cell culture, reagents and transfections HeLa (ATCC reference CCL-2), HEK 293 (ATCC reference CRL-1573) and CHO-K1 (ATCC reference CCL-61) cells were grown in Dulbecco’s modified Eagle’s medium (Gibco- BRL, Rockville, MD, USA) supplemented with 10% fetal bovine serum (Gibco-BRL), 100 lgÆmL )1 streptomycin, 100 lgÆmL )1 penicillin and 250 ngÆmL )1 fungizone (Gibco- BRL), in a humidified atmosphere of 5% CO 2 at 37 ° C. Where indicated, cells were treated with proteasome inhibitor MG132 20 lm (Sigma) for 4 h. Cells were transiently trans- fected using FuGENE 6 Transfection Reagent (Roche, Basel, Switzerland) following the manufacturer’s instructions. Antibodies The primary antibodies used were M2 mouse monoclonal antibody to FLAG Ò epitope (Sigma), 9E10 mouse mono- clonal antibody to myc-tag (Roche), 16B12 mouse mono- clonal antibody to HA-tag (Roche). P. Lore ` s et al. BAF60b ubiquitination is controlled by Rac and Unkempt FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS 1461 For western blotting, the secondary peroxidase-conju- gated rabbit anti-mouse IgG (Dako, Glostrup, Denmark), the secondary peroxidase-conjugated swine anti-rabbit IgG (Dako) or the secondary peroxidase-conjugated rabbit anti- goat IgG (Dako) were used. The secondary fluorescent anti- body used in immunofluorescence studies was Alexa Fluor 488-labelled goat anti-mouse IgG (Molecular Probes, Eugene, OR, USA). Western blotting Proteins were resolved in SDS ⁄ PAGE mini-gels and electro- transferred onto BA85 nitrocellulose membranes (Schleicher & Schuell, Millipore, Billerica, MA, USA). Membranes were probed using the indicated primary antibodies and secondary peroxidase-conjugated antibodies followed by chemiluminescence using the ECL Ô western blotting detec- tion reagent (Amersham Biosciences, Piscataway, NJ, USA). Pull-down assay HeLa cells seeded in 100 mm Petri dishes were transfected with a total amount of 5 lg of the indicated GTPase and BAF60 expression vectors. The following day, the cells were lysed in 500 lL lysis buffer [50 m m Hepes pH 7.5, 10 mm MgCl 2 , 150 mm NaCl, 1% Triton X-100, 0.5% NP40 and a protease inhibitor cocktail (Amersham)]. In total, 500 lg protein in 150 lL was incubated for 2 h at 4 °C with 15 lg GST or GST-UNK-C-ter coupled to 20 lL glutathione- sepharose beads (Amersham Biosciences). Pelleted beads were washed twice with washing buffer (50 mm Tris ⁄ HCl pH 7.5, 150 mm NaCl, 10 mm MgCl 2 ,1mm dithiothreitol, 0.1% Triton X-100, 0.2 mgÆmL )1 BSA and a protease inhibitor cocktail). Bound proteins were recovered by boiling beads in Laemmli sample buffer 2· (Sigma) and analysed by western blotting. Ubiquitination assay HeLa, HEK 293 and CHO-K1 cells seeded in 100 mm Petri dishes were transfected with a plasmid mix containing 1–3 lg each plasmid encoding 6His-myc-Ub and the indi- cated proteins; in silencing experiments, HeLa cells were transfected twice (with a 24 h interval) with plasmid mix including pSUPER. Twenty hours after transfection, the cells were washed in phosphate-buffered saline and lysed in 1 mL denaturating buffer (8 m urea, 20 mm Tris ⁄ HCl pH 7.5, 200 mm NaCl, 10 mm imidazole, 0.1% Triton X-100, 5mm N-ethylmaleimide, 10 mm iodoacetic acid); 50 lL lysate was resuspended in Laemmli sample buffer 2X to evaluate the total quantity of proteins. 6His-myc-ubiquiti- nated proteins were recovered by incubating the remaining lysate for 90 min with 30 lL cobalt-chelated resin (BD TALON metal affinity resin; BD Bioscience, Lexington, KY, USA), previously incubated in denaturating buffer with 0.2 mgÆmL )1 BSA. The beads were then washed four times in 1 mL denaturating buffer, and resuspended in 25 lL Laemmli sample buffer 2X. Total lysates and ubiqui- tinated protein fractions were resolved by SDS ⁄ PAGE and analysed by western blotting. Leptomycin treatment HeLa cells plated at low confluence on 18 mm diameter glass coverslips in 12-well plates were transfected with 0.5 lg HA-UNK-fl expression vector. The cells were treated overnight with 10 ngÆmL )1 leptomycin B (Sigma). The fol- lowing day, HA immunofluorescence was performed on fixed cells, as described previously [32]. Acknowledgements We thank Dr W. Wang for BAF60 cDNAs. We also thank Dr A. Doye for help with ubiquitination assays, and F. Letourneur for assistance in sequencing work. This work was supported by funding from INSERM, CNRS, Universite ´ Paris Descartes and the Agence Nationale pour la Recherche (ANR 05-MRAR-033- 02) to G.G. O.V. is the recipient of a fellowship from the Association pour la recherche sur le cancer. References 1 Wang W, Cote J, Xue Y, Zhou S, Khavari PA, Biggar SR, Muchardt C, Kalpana GV, Goff SP, Yaniv M et al. (1996) Purification and biochemical heterogeneity of the mammalian SWI-SNF complex. EMBO J 15, 5370–5382. 2 Olave IA, Reck-Peterson SL & Crabtree GR (2002) Nuclear actin and actin-related proteins in chromatin remodeling. Annu Rev Biochem 71, 755–781. 3 de la Serna IL, Ohkawa Y & Imbalzano AN (2006) Chromatin remodelling in mammalian differentiation: lessons from ATP-dependent remodellers. Nat Rev Genet 7, 461–473. 4 Reyes JC, Muchardt C & Yaniv M (1997) Components of the human SWI ⁄ SNF complex are enriched in active chromatin and are associated with the nuclear matrix. J Cell Biol 137, 263–274. 5 Hsiao PW, Fryer CJ, Trotter KW, Wang W & Archer TK (2003) BAF60a mediates critical interactions between nuclear receptors and the BRG1 chromatin- remodeling complex for transactivation. Mol Cell Biol 23, 6210–6220. 6 Debril MB, Gelman L, Fayard E, Annicotte JS, Rocchi S & Auwerx J (2004) Transcription factors and nuclear receptors interact with the SWI ⁄ SNF complex through the BAF60c subunit. J Biol Chem 279, 16677–16686. 7 Ito T, Yamauchi M, Nishina M, Yamamichi N, Mizutani T, Ui M, Murakami M & Iba H (2001) BAF60b ubiquitination is controlled by Rac and Unkempt P. Lore ` s et al. 1462 FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS [...]... Minoshima Y, Hatori T, Tsuchiya A, Kiyono M, Nosaka T et al (2006) Rac1 and a GTPaseactivating protein, MgcRacGAP, are required for nuclear translocation of STAT transcription factors J Cell Biol 175, 937–946 26 Michaelson D, Abidi W, Guardavaccaro D, Zhou M, Ahearn I, Pagano M & Philips MR (2008) Rac1 accumulates in the nucleus during the G2 phase of the cell cycle and promotes cell division J Cell... tumorigenic variant Rac1 b, is ubiquitinated on Lys 147 through a JNK-regulated process FEBS J 275, 386–396 FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS 1463 ` P Lores et al BAF60b ubiquitination is controlled by Rac and Unkempt Supporting information The following supplementary material is available: Fig S1 Ubiquitination of BAF60b by RING mutants of Unkempt This supplementary... Q, Huang Y & Sheikh MS (2009) Identification and characterization of two novel isoforms of Pirh2 ubiquitin ligase that negatively regulate p53 independent of RING finger domains J Biol Chem 284, 21955–21970 30 Toure A, Dorseuil O, Morin L, Timmons P, Jegou B, Reibel L & Gacon G (1998) MgcRacGAP, a new human GTPase- activating protein for Rac and Cdc42 similar to Drosophila rotundRacGAP gene product, is. .. Polyubiquitin chains: polymeric protein signals Curr Opin Chem Biol 8, 610– 616 Li W, Bengtson MH, Ulbrich A, Matsuda A, Reddy VA, Orth A, Chanda SK, Batalov S & Joazeiro CA (2008) Genome-wide and functional annotation of human E3 ubiquitin ligases identifies MULAN, a mitochondrial E3 that regulates the organelle’s dynamics and signaling PLoS ONE 3, e1487 Pickart CM (2004) Back to the future with ubiquitin... ubiquitin- and Ubl-binding proteins in cell signaling Curr Opin Cell Biol 19, 199–205 Mohler J, Weiss N, Murli S, Mohammadi S, Vani K, Vasilakis G, Song CH, Epstein A, Kuang T, English J et al (1992) The embryonically active gene, unkempt, of Drosophila encodes a Cys3His finger protein Genetics 131, 377–388 Joazeiro CA & Weissman AM (2000) RING finger proteins: mediators of ubiquitin ligase activity Cell... development Nature 432, 107–112 Flajollet S, Lefebvre B, Cudejko C, Staels B & Lefebvre P (2007) The core component of the mammalian SWI ⁄ SNF complex SMARCD3 ⁄ BAF60c is a coactivator for the nuclear retinoic acid receptor Mol Cell Endocrinol 270, 23–32 Chen J & Archer TK (2005) Regulating SWI ⁄ SNF subunit levels via protein- protein interactions and proteasomal degradation: BAF155 and BAF170 limit... This supplementary material can be found in the online version of this article 1464 Please note: As a service to our authors and readers, this journal provides supporting information supplied by the authors Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset Technical support issues arising from supporting information (other than missing files)... Flatau G, Lemichez E, Gauthier M, Chardin P, Paris S, Fiorentini C & Boquet P (1997) Toxin-induced activation of the G protein p21 Rho by deamidation of glutamine Nature 387, 729–733 24 Lanning CC, Ruiz-Velasco R & Williams CL (2003) Novel mechanism of the co-regulation of nuclear transport of SmgGDS and Rac1 J Biol Chem 278, 12495–12506 25 Kawashima T, Bao YC, Nomura Y, Moon Y, Tonozuka Y, Minoshima... 549–552 Buchwald G, van der Stoop P, Weichenrieder O, Perrakis A, van Lohuizen M & Sixma TK (2006) Structure and E3-ligase activity of the Ring- Ring complex of polycomb proteins Bmi1 and Ring1 b EMBO J 25, 2465–2474 Poyurovsky MV, Priest C, Kentsis A, Borden KL, Pan ZQ, Pavletich N & Prives C (2007) The Mdm2 RING domain C-terminus is required for supramolecular assembly and ubiquitin ligase activity EMBO... J 26, 90–101 BAF60b ubiquitination is controlled by Rac and Unkempt 21 Xia Y, Pao GM, Chen HW, Verma IM & Hunter T (2003) Enhancement of BRCA1 E3 ubiquitin ligase activity through direct interaction with the BARD1 protein J Biol Chem 278, 5255–5263 22 Singh RK, Iyappan S & Scheffner M (2007) Heterooligomerization with MdmX rescues the ubiquitin ⁄ Nedd8 ligase activity of RING finger mutants of Mdm2 . identified a mammalian RING finger protein homologous to drosophila Unkempt as a new partner of the activated form of RacGTPases and dem- onstrated that mammalian. The SWI ⁄ SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt Patrick Lore ` s 1,2, *,