Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase Konstantinos Mavromatis 1, *, Iason Tsigos 2, *, Maria Tzanodaskalaki 2 , Michael Kokkinidis 1,3 and Vassilis Bouriotis 1,2 1 Department of Biology, Division of Applied Biology and Biotechnology, University of Crete, Greece; 2 Institute of Molecular Biology and Biotechnology (IMBB), Enzyme Technology Division, and the 3 Institute of Molecular Biology and Biotechnology, Crystallography Division, Heraklion, Crete, Greece In an effort to explore the role of glycine clusters on the cold adaptation of enzymes, we designed point mutations aiming to alter the distribution of glycine residues close to the active site of the psychrophilic alkaline phosphatase from the Antarctic strain TAB5. The mutagenesis targets were residues Gly261 and Gly262. The replacement of Gly262 by Ala resulted in an inactive enzyme. Substitution of Gly261 by Ala resulted to an enzyme with lower stability and increased energy of activation. The double mutant G261A/ Y269A designed on the basis of side-chain packing criteria from a modelled structure of the enzyme resulted in restor- ation of the energy of activation to the levels of the native enzyme and in an increased stability compared to the mutant G261A. It seems therefore, that the Gly cluster in combi- nation with its structural environment plays a significant role in the cold adaptation of the enzyme. Keywords: alkaline phosphatase; psychrophiles; cold adaptation; structural flexibility; glycine clusters. Cold adapted enzymes, produced by organisms living in permanently cold environments, exhibit a higher specific activity at low temperatures [1–3]. Moreover, this high catalytic efficiency is consistently accompanied by a lower thermal stability, although these properties are not always correlated as shown by recent data from directed evolution experiments which support the interdependence of these properties [4–8]. The adaptation to cold is achieved through a decrease in the activation energy, which results from an increased protein flexibility, either of the whole protein or of a specific domain in some multidomain proteins. Furthermore, evidence from the notothenioid A4-lactate dehydrogenases support a cold adaptation model in which structural flexibility increases are confined to small areas of the molecule, thereby affecting the mobility of adjacent active site structures and resulting in reduced energy barriers [9]. Therefore, psychrophilic adaptation seems to be associated with localized rather than global increases in conformational flexibility [10]. This is in agreement with structural data, which reveal that only minor modifications are necessary to convert a mesophilic or thermophilic enzyme into a cold adapted one [11–14]. Although the strategy of adaptation is unique to each enzyme [15], it has been observed that amino-acid residues involved in the catalytic mechanism are generally conserved in psychrophilic and mesophilic enzymes [1]. This suggests that generally the molecular basis of cold adaptation is associated with sequence changes outside the active site. However, recent work from our group indicated that the psychrophilic character of an enzyme could also be altered or masked by mutating active site residues [16]. Several sequence patterns have been associated with psychrophilic adaptations, such as decreased levels of Pro and Arg residues, weakening of intramolecular interactions, increased solvent interactions, decreased charged residues interactions, and disulfide bonds [1,2,17]. Increased levels of Gly residues or the establishment of Gly clusters have been frequently suggested to be associated with psychrophilicity [2]. This could be a result of increased local structural flexibility due to the intrinsic flexibility of Gly residues [18]. However, recent studies of Gly clusters [19] appear to contradict this assumption. It seems that the correlation between the occurrence of Gly residues and the stability of proteins is complex as several parameters from the whole protein structure are involved and not just the intrinsic flexibility of Gly residues [20]. We have recently reported the cloning, sequencing and overexpression of the gene encoding alkaline phosphatase from the Antarctic strain TAB5 [16]. Based on the crystal structure (at 2.4 A ˚ )ofanEscherichia coli alkaline phospha- tase variant with a 28% amino-acid sequence identity to the psychrophilic enzyme, a three-dimensional model of the psychrophilic enzyme was constructed [21]. We have also presented mutagenesis data that substantiate the role of the local flexibility on the psychrophilic character, and catalytic properties of the enzyme [16]. In the case of alkaline phos- phatases, positions 261, 262 (in TAB5 alkaline phosphatase numbering) are often occupied by one Gly; this site is next to one of the catalytic residues (Trp260 in the case of TAB5 alkaline phosphatase). In E.coliand some Bacillus sp., there Correspondence to V. Bouriotis, Department of Biology, Division of applied Biology and Biotechnology, University of Crete, PO Box 1470, Heraklion 711 10, Crete, Greece. Fax/Tel.: + 30 810 394375, E-mail: bouriotis@imbb.forth.gr Abbreviation: pNPP, p-nitrophenyl phosphate. Enzyme: alkaline phosphatase (EC 3.1.3.1). *Note: these authors have equally contributed to this work. (Received 12 December 2001, revised 14 March 2002, accepted 18 March 2002) Eur. J. Biochem. 269, 2330–2335 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.02895.x are no Gly residues at these positions. In TAB5 alkaline phosphatase, these two positions are both occupied by Gly. The presence of this Gly cluster in TAB5 alkaline phosphatase has provoked us to explore its potential role in the establishment of the psychrophilic properties of the enzyme. EXPERIMENTAL PROCEDURES Materials Restriction and DNA modification enzymes were pur- chased from New England Biolabs (Beverly, MA, USA) and MINOTECH (Heraklion, Greece). All chemicals were of analytical grade for biochemical use. PCR primers were purchased from the Microchemistry Laboratory of IMBB. Enzymatic assay Alkaline phosphatase activity was followed spectrophoto- metrically utilizing p-nitrophenyl phosphate (pNPP) as substrate. The release of product, p-nitrophenolate, was monitored by measuring the absorbance at 405 nm using a PerkinElmer photometer. Specific activity was determined in a buffer containing 1 M diethanolamine/HCl (pH 10), 10% glycerol, 10 m M MgCl 2 ,1m M ZnCl 2 ,and10m M pNPP at 20 °C. Enzyme units were calculated as previously described [22]. Steady-state enzyme kinetics Steady-state enzyme kinetics were performed in the tem- perature range 5–25 °C. The program HYPER v1.01was used for the determination of V max and K m values. The k cat values were calculated from V max using a molecular mass of 76 122 Da for the enzyme. Reported values are the average of three measurements. The standard deviations do not exceed 10%. Thermodynamic parameters of the enzyme were calculated as described previously [27]. Thermal inactivation of enzymes In order to measure the thermal inactivation of enzymes, they were incubated at 50 °C, in a buffer containing 1 M diethanolamine pH 10.0, 10 m M MgCl 2 ,1m M ZnCl 2 and 10% glycerol for different time periods and they were subsequently incubated on ice for 30 min. The remaining activity was measured at 20 °C. Reported values are the average of at least two measurements. The standard deviations do not exceed 10%. Site-directed mutagenesis Site directed mutagenesis was performed using standard PCR methods [23]. For the construction of the mutations the following primers were synthesized: Gly261 to Ala, upper primer 5¢-d(CAAATAGATTGGGCTGGCCATG CAAATAAT)-3¢, lower primer 5¢-d(TATTTGCATGGCC AGCCCAATCTATTTGAG)-3¢; Gly262 to Ala, upper primer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAA TGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCA CCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper primer 5¢-d(TAATGCATCCGCTTTAATTTCTGAAATTA ATG)-3¢, lower primer 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢. The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAG CATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the EcoRI restriction site (underlined) was: 5¢-d(TT GAATTC GTTTATTGATTCCACTTTG)-3¢. The PCR reaction mixtures were incubated on an Eppendorf thermal cycler for 30 cycles of 94 °Cfor1min, 49 °C for 1 min, and 72 °C for 1 min. The amplified product was isolated by agarose gel electrophoresis, gel purified using QIAEX (Qiagen) and digested with NdeIand EcoRI restriction enzymes. The resulting NdeI–EcoRI fragment was inserted into the pRSETA vector previously digested with these enzymes. The ligation mixture was used to transform competent cells of E.colistrain XL1-MRF. Molecular modelling A three-dimensional molecular model of the psychrophilic alkaline phosphatase was built [21] on the basis of the homology to the E.colienzyme the structure of which is known [24]. For display of the model and for design and analysis of mutations the program SWISSPDB VIEWER was used [25]. Expression and purification of enzymes The protocol used for the expression of enzymes used has been previously described [16]. RESULTS Choice of amino-acid substitutions Based on sequence comparisons, in most alkaline phospha- tases, the dipeptide corresponding to positions 261 and 262 (TAB5 numbering) contains one Gly residue; the second residue is usually Ala or His (Fig. 1). In the E.coli phosphatase these two positions are occupied by Gln and Asp, respectively. Both positions are occupied by Gly residues in the TAB5 alkaline phosphatase. This clustering of Gly provides an interesting mutation target due to its potential relation to the psychrophilic character of the enzyme. Two point mutants were constructed; G261A and G262A where Gly261 and Gly262 were replaced by Ala, Fig. 1. Partial alignment of alkaline phosphatases at the region studied. Mutation targets at positions 261, 262 and 269 of TAB5 alkaline phosphatase are shown in bold. Grey boxes indicate corresponding residues in the other alkaline phosphatases. Ó FEBS 2002 Mutagenesis of a psychrophilic alkaline phosphatase (Eur. J. Biochem. 269) 2331 respectively. By introducing an Ala residue in the place of Gly it is expected that the conformational flexibility of the main chain can be constrained with a minimum perturba- tion of the local structure, resulting to a more rigid protein (Fig. 2). Moreover, Ala residues are common among phosphatases at these positions (Fig. 1). On the basis of the molecular model [21] Ala261 is expected to introduce steric clashes with the side chain of Tyr269 (Fig. 2B), which are not present in the structure of the psychrophilic enzyme with the smaller Gly residue at position 261 (Fig. 2A). Replacement of Tyr269 by Ala in the double mutant G261A/Y269A is expected to remove most of the spatial constraints of the side chain interactions (Fig. 2C). Temperature dependence of activity in wild-type and mutant enzymes The specific activity of all mutants was measured over the entire range of temperature (5–25 °C) where wild-type alkaline phosphatase is stable (Fig. 3A). Mutant G262A had no significant activity at all temperatures tested making it impossible to measure the specific activity or any kinetic parameters of this mutant. We could only measure traces of activity after prolonged incubation (24 h). The mutant G261A is more active at elevated tempera- tures (20–25 °C) compared to wild-type protein, while the mutant G261A/Y269A is less active at any given tempera- ture. However, compared to the mesophilic enzyme from E.coli, these enzymes are approximately 10 times more active. Determination of E a and thermodynamic parameters for wild-type and mutant enzymes In order to elucidate the effect of mutations in terms of psychrophilic adaptation, we determined the energy of activation E a for wild-type and mutant enzymes. Figure 3B shows the Arrhenius plots for the temperature range of 10–25 °C. The E a of the enzymes reveal that the mutant G261A exhibits a higher value almost 2.5-fold higher than the native cold adapted enzyme (Table 1). The mutant G261A/Y269A exhibits an E a almost the same as in the case ofthenativeenzyme(Table1). Thermal inactivation of mutant and wild-type enzymes In order to investigate the effects of mutations on the stability of psychrophilic alkaline phosphatase, the enzymes were incubated at 50 °C for different time periods and subsequently their remaining activity was measured. As shown in Fig. 3C, replacement of Gly261 by Ala in mutant G261A resulted in an enzyme with slightly lower stability. On the other hand, in the double mutant G261A/Y269A the additional replacement of Tyr269 by Ala restores the stability of the protein producing a more stable enzyme than thenativeone. DISCUSSION Recent studies have established that, adjustment of con- formational flexibility is essential for the temperature adaptation of enzymes [26]. Moreover, localized increases in conformational flexibility constitute an essential element in cold adaptation [9]. However, our incomplete under- standing of the relation between enzyme properties and conformational flexibility limits the exploitation of the full potential of protein engineering in the redesign of psychro- philic enzyme properties [15]. In particular, the effects of local flexibility in psychrophilic enzyme properties have been so far studied only for regions, which indirectly affect the mobility of active site structures, but not for the active sitesthemselves[9]. Fig. 2. Drawing of the three dimensional model of the wild type (A) and mutant alkaline phosphatases G261A (B) and G261A/Y269A (C); only residues that where studied are shown. 2332 K. Mavromatis et al. (Eur. J. Biochem. 269) Ó FEBS 2002 In a previous study [16], we explored the possibility of modifying the psychrophilic properties of an enzyme by introducing, via mutagenesis, predictable flexibility changes to key active site residues of the psychrophilic alkaline phosphatase from the Antarctic strain TAB5. This approach was based on an approximate homology-based three-dimensional model of the psychrophilic enzyme and sequence comparisons with mesophilic sequences. The mutagenesis targets were residues Trp260 and Ala219 of the catalytic site and His135 of the Mg 2+ binding site. The most striking result was the loss of the psychrophilic character of mutant W260K/A219N (as reflected by a three- fold increase of the E a value compared to the wild-type enzyme). Interestingly, the activity of the mutant at elevated temperatures (20–25 °C) exceeded that of the wild-type protein. Further substitution of His135 by Asp in the triple mutant W260K/A219N/H135D restored a low energy of activation. In addition, the His135 fi Asp replacement resulted in a considerable stabilization of enzymes harboring this mutation (single mutant H135D and triple mutant W260K/A219N/H135D). These results suggested that the psychrophilic character of mutants can be established or masked by very slight variations of the wild-type sequence, which may affect various conformational constraints asso- ciated with active site flexibility. The aim of the present study was to further explore the local flexibility concept in the adaptation strategies of enzymes to low temperatures. As in the previous study [16], our interest is focused to the vicinity of the active site of the psychrophilic alkaline phosphatase from the Antarctic Table 1. Enzymatic and thermodynamic parameters of the psychrophilic alkaline phosphatase and mutants. Reported values were determined at 10 °C. The k cat values were calculated from V max using a molecular weight for the enzyme of 76122 Da in a buffer containing 1 M diethanolamine- HCl pH 10, 10% glycerol, 10 m M MgCl 2 ,1m M ZnCl 2 ,and10m M pNPP. E a values were calculated from the slope of the Arrhenius plots in the temperature range 5–25 °C for native and G261A/Y269A mutant, and 5–15 °C for the G261A mutant. Thermodynamic parameters DG # , DH # , TDS # were calculated as described previously [27]. Enzyme k cat (s )1 ) E a (kJÆmol )1 ) DG # (kJÆmol )1 ) DH # (kJÆmol )1 ) TDS # (kJÆmol )1 ) D(DG # ) n-m (kJÆmol )1 ) D(DH # ) n-m (kJÆmol )1 ) TD(DS # ) n-m (kJÆmol )1 ) Native 1212 42.8 52.48 40.45 )12.03 G261A 423 106.5 54.96 104.15 49.19 )2.48 )63.7 )61.22 G261A/Y269A 310 45.1 55.69 42.75 )12.94 )3.21 )2.3 0.91 Fig. 3. Kinetic studies of wild-type and mutant alkaline phosphatases. (A) Temperature dependence of k cat of TAB5 (d), mutants G261A (r), G261A/Y269A (j)andE.coli (·) alkaline phosphatases at temperature range 5–25 °C. k cat values were determined in a buffer containing 1 M diethanolamine-HCl pH 10, 10% glycerol, 10 m M MgCl 2 ,1m M ZnCl 2 ,and10m M pNPP at 20 °C. Alkaline phospha- tase activity was followed spectrophotometrically utilizing p-nitro- phenyl phosphate (pNPP) as substrate. The release of product, p- nitrophenolate, was monitored by measuring the absorbance at 405 nm using a PerkinElmer photometer. Reported values are the average of three measurements. The standard deviations do not exceed 10%. (B) Arrhenius plots of TAB5, mutants G261A,G261A/Y269A and E.colialkaline phosphatases. Symbols are as in (A). Reported values are the average of three measurements. The standard deviations do not exceed 10%. (C) Thermal inactivation profiles of E.coliand TAB5 alkaline phosphatases. Enzymes were incubated at 50 °C, in a buffer containing 1 M diethanolamine pH 10.0, 10 m M MgCl 2 ,1m M ZnCl 2 and 10% glycerol for different time periods and they were subsequently incubated on ice for 30 min. The remaining activity was measured at 20 °C. Symbols are as in (A). Reported values are the average of at least two measurements. The standard deviations do not exceed 10%. Ó FEBS 2002 Mutagenesis of a psychrophilic alkaline phosphatase (Eur. J. Biochem. 269) 2333 strain TAB5. We particularly attempted to investigate the functional importance of the Gly pair, located in the vicinity of the active site of the cold adapted enzyme and to study its potential role in the establishment of its psychrophilic character. This work uses, in accordance with more or less generally established concepts, the energy of activation, E a ,asthe main criterion for the evaluation of the psychrophilic nature of enzyme variants. In cold adapted enzymes, this param- eter generally tends to be lower compared to their mesophilic counterparts [27]. Furthermore, as a measure of enzyme stability, thermal inactivation at 50 °Cisused. We refer to stability in an activity sense and not in a thermodynamic sense. We therefore assume that even low enzymatic activity is associated with a mutant that retains to a considerable extent the overall fold of the wild-type protein and that loss of activity is associated either with perturbation of the native structure or local disruption of the metal binding or the active site. The point mutation of Gly262 fi Ala results in an enzyme that exhibits very low activity (less than 1 : 1000 of the native enzyme). This fact did not allow the study of its kinetic parameters and its thermal inactivation profile. However, this mutation demonstrates that at position 262 the presence of Gly is essential, and a mutation altering this residue results in a practically inactive enzyme. This Gly may provide the necessary flexibility required for catalysis. Several alkaline phos- phatases have one Gly at the corresponding positions 261 and 262, while the psychrophilic enzyme has both positions occupied by Gly. The most striking effect of the Gly261 fi Ala substitu- tion (Fig. 2B) is the loss of the psychrophilic character as deduced from the drastically altered E a value (Fig. 3B, Table 1). As shown in Table 1, this is mainly attributed to the considerable increase of DH # of the mutant compared to the native enzyme. This observation is in agreement with previous reports [27], suggesting that the main adaptation of psychrophilic enzymes lies in a significant decrease of DH # with an unavoidable concurrent decrease of TDS # .The slope of the Arrhenius plot, in the temperature range 5–15 °C, corresponds to an approximately threefold increase of the E a value compared to the wild-type enzyme. Interestingly, while this mutant exhibits a considerable decreased value of k cat at lower temperatures, at elevated temperature (25 °C) the value of the same parameter slightly exceeds that of the wild type (Fig. 3A). This can be also observed as a bend on the Arrhenius plot occurring at temperatures > 20 °C, indicating that the E a value in this temperature range is considerably lowered. On the basis of the model, the behavior of the G261A variant can be interpreted in terms of constraints introduced by the Ala side chain. The presence of the additional Gly at position 261 possibly offers increased flexibility to the adjacent residue Trp260 that forms part of the active site and therefore facilitates the catalysis at low temperatures. Consequently, when the mutant G261A is driven to operate in a cold environment, and the lack of Gly261 does not allow the reaction to proceed as efficiently as in the case of the native enzyme. At higher temperatures, the additional energy provided by the environment is sufficient and the mutant can proceed with the catalysis as efficiently as the wild type (Fig. 3A). Investigation of the three-dimensional homology-based model of the enzyme revealed that the methyl group of Ala261 side-chain could produce steric clashes with the aromatic ring of Tyr269, and these unfavorable interactions could lead to a decrease of local flexibility and an increased E a value. The validity of the above interpretation was further reinforced by the construction of the double mutant G261A/Y269A. The additional substitution of Tyr269 fi Ala was designed with the aim of reducing the spatial constraints originating from the side-chain interactions between Tyr269 and Ala261 (Fig. 2C). The main difference between the G261A and G261A/Y269A enzymes is the restoration of the psychrophilic character in the double mutant. Both mutations resulted in an enzyme exhibiting a significantly lower E a , DH # and TDS # values similar to that of the wild-type enzyme (Fig. 3B, Table 1). In addition, considerable stabilization of the double mutant as compared to the wild-type enzyme was observed (Fig. 3C). This is probably the result of the ÔrelaxationÕ of the side-chain packing constraints between positions 269 and 261. This explanation is additionally supported by sequence compar- isons. As shown in Fig. 1, in other alkaline phosphatases the corresponding residue at position 269 is often occupied by residues with smaller side chain when a larger than Gly residue is found at position 261. This is more striking in the case of the enzyme from the thermophilic alkaline phos- phatase from Thermotonga maritima where the presence of a large side chain (Glu) at corresponding position 261 is accompanied by a Gly at corresponding position 269 thus compensating this increase in the side chain volume. The contribution of Gly clusters in the cold adaptation of enzymes was also examined in the case of the mammalian psychrotolerant hormone-sensitive lipase [19]. In that study, a Gly rich loop (HGGG motif), which was only found in that enzyme, was extensively mutated and the activity of the engineered catalysts was analyzed in various temperatures. However, it was found that although the HGGG loop was a critical structural element for the catalytic efficiency of the enzyme, the cold adaptation of the enzyme could not be attributed to the presence of the Gly cluster in this element. The present study supports the idea that the Gly cluster, in combination with its structural environment, is an essential feature of the psychrophilic character of TAB5 alkaline phosphatase. It seems that the volume of the side- chains at positions 261 and 269 controls the psychrophilic character as judged from the levels of the E a . In the G261A mutant, this volume is increased (Fig. 2B) and the enzyme proves to be as efficient as the native at elevated but not at lower temperatures. The presence of Gly residues at both positions 261 and 262 is necessary for the enhanced specific activity of the enzyme in its natural environment; catalysts harboring a Gly fi Ala mutation in any of these positions exhibit a significantly decreased specific activity (Fig. 3A). Consequently, the Gly cluster at this position plays a dual role, contributing both to higher catalytic efficiency and lower E a . Moreover, the present work provides evidence that mutations introduced to Gly cluster produced enzymes that still exhibit psychrophilic properties while suitable compen- sating mutations may even produce mutants with increased stability. To our knowledge, the present study along with a previous one from our laboratory describing the mutagen- esis of residues Trp260 and His135 of the same enzyme, are 2334 K. Mavromatis et al. (Eur. J. Biochem. 269) Ó FEBS 2002 the first examples where rational redesign of residues, at or close to the active site, has been used to demonstrate that the psychrophilic character of an enzyme can be strongly affected by very slight variations of its amino-acid sequence. Crystallographic studies of the mutants, aiming to further test the hypotheses about the structural basis of kinetic findings, are in progress. ACKNOWLEDGEMENT This work was supported by the TMR Network FMRX-CT97-0131. REFERENCES 1. Zecchinon, L., Claverie, P., Collins, T., D’Amico, S., Delille, D., Feller, G., Georlette, D., Gratia, E., Hoyoux, A., Meuwis, M A., Sonan, G. & Gerday, C. (2001) Did psychrophilic enzymes really win the challenge? Extremophiles 5, 313–321. 2. Feller, G. & Gerday, C. (1997) Psychrophilic enzymes: molecular basis of cold adaptation. Cell. Mol. Life Sci. 53, 830–841. 3. Feller, G., Narinx, E., Arpigny, J.L., Aittaleb, M., Baise, E., Genicot, S. & Gerday, C. (1996) Enzymes from psychrophilic organisms. FEMS Microbiol. Rev. 18, 189–202. 4. Gagnon, M.C., Williams, M., Doucet, A. & Beauregard, M. (2000) Replacement of Tyr62 by Trp in the designer protein Milk Bundle-1 results in significant improvement of conformational stability. FEBS Lett. 484, 144–148. 5. Miyazaki, K. & Arnold, F.H. (1999) Exploring nonnatural evo- lutionary pathways by saturation mutagenesis: rapid improvement of protein function. J. Mol. Evol. 49, 716–720. 6. Miyazaki, K., Wintrode, P.L., Grayling, R.A., Rubingh, D.N. & Arnold, F.H. (2000) Directed evolution study of temperature adaptation in a psychrophilic enzyme. J. Mol. Biol. 297, 1015– 1026. 7. Wintrode, P.L., Miyazaki, K. & Arnold, F.H. (2001) Patterns of adaptation in a laboratory evolved thermophilic enzyme. Biochim. Biophys. Acta 1549, 1–8. 8. Wintrode, P.L., Miyazaki, K. & Arnold, F.H. (2000) Cold adap- tation of a mesophilic subtilisin-like protease by laboratory evo- lution. J. Biol. Chem. 275, 31635–31640. 9. Fields, P.A. & Somero, G.N. (1998) Hot spots in cold adaptation: localized increases in conformational flexibility in lactate dehy- drogenase A4 orthologs of Antarctic notothenioid fishes. Proc. Natl Acad. Sci. USA 95, 11476–11481. 10. Lonhienne, T., Zoidakis, J., Vorgias, C.E., Feller, G., Gerday, C. & Bouriotis, V. (2001) Modular structure, local flexibility and cold-activity of a novel chitobiase from a psychrophilic Antarctic bacterium. J. Mol. Biol. 310, 291–297. 11. Aghajari, N., Feller, G., Gerday, C. & Haser, R. (1998) Crystal structures of the psychrophilic alpha-amylase from Alteromonas haloplanctis in its native form and complexed with an inhibitor. Protein Sci. 7, 564–572. [published erratum appears in Protein Sci. (1998) 7, 1481] 12. Alvarez, M., Zeelen, J.P., Mainfroid, V., Rentier-Delrue, F., Martial, J.A., Wyns, L., Wierenga, R.K. & Maes, D. (1998) Triose-phosphate isomerase (TIM) of the psychrophilic bacterium Vibrio marinus. Kinetic and structural properties. J. Biol. Chem. 273, 2199–2206. 13. D’Amico, S., Gerday, C. & Feller, G. (2001) Structural deter- minants of cold adaptation and stability in a large protein. J. Biol. Chem. 276, 25791–25796. 14. Kim, S.Y., Hwang, K.Y., Kim, S.H., Sung, H.C., Han, Y.S. & Cho, Y. (1999) Structural basis for cold adaptation. Sequence, biochemical properties, and crystal structure of malate dehydro- genase from a psychrophile Aquaspirillium arcticum. J. Biol. Chem. 274, 11761–11767. 15. Gerday, C., Aittaleb, M., Bentahir, M., Chessa, J.P., Claverie, P., Collins, T., D’Amico, S., Dumont, J., Garsoux, G., Georlette, D., Hoyoux, A., Lonhienne, T., Meuwis, M.A. & Feller, G. (2000) Cold-adapted enzymes: from fundamentals to biotechnology. Trends Biotechnol. 18, 103–107. 16. Tsigos, I., Mavromatis, K., Tzanodaskalaki, M., Pozidis, C., Kokkinidis, M. & Bouriotis, V. (2001) Engineering the properties of a cold active enzyme through rational redesign of the active site. Eur.J.Biochem.268, 5074–5080. 17. Argos, P., Rossmann, G.M., Grau, M.U., Zuber, H., Frank, G. & Tratschin, J.D. (1979) Thermal stability and protein structure. Biochemistry 18, 5698–5703. 18. Branden, C. & Tooze, J. (1999) Introduction to Protein Structure. Garland Publishers, New York. 19. Laurell, H., Contreras, J.A., Castan, I., Langin, D. & Holm, C. (2000) Analysis of the psychrotolerant property of hormone-sen- sitive lipase through site-directed mutagenesis. Protein Eng. 13, 711–717. 20. Masumoto, K., Ueda, T., Motoshima, H. & Imoto, T. (2000) Relationship between local structure and stability in hen egg white lysozyme mutant with alanine substituted for glycine. Protein Eng. 13, 691–695. 21. Rina, M., Pozidis, C., Mavromatis, K., Tzanodaskalaki, M., Kokkinidis, M. & Bouriotis, V. (2000) Alkaline phosphatase from the Antarctic strain TAB5. Properties and psychrophilic adapta- tions. Eur. J. Biochem. 267, 1230–1238. 22. Garen, A. & Levinthal, C. (1960) A fine structure genetic and chemical study of the enzyme alkaline phosphatase of E.coli.1. Purification and characterization of alkaline phosphatase. Biochim. Biophys. Acta 38, 470–483. 23. Horton, R.M., Cai, Z.L., Ho, S.N. & Pease, L.R. (1990) Gene splicing by overlap extension: tailor-made genes using the poly- merase chain reaction. Biotechniques 8, 528–535. 24. Kim, E.E. & Wyckoff, H.W. (1991) Reaction mechanism of alkaline phosphatase based on crystal structures. Two-metal ion catalysis. J. Mol. Biol. 218, 449–464. 25. Guex, N. & Peitsch, M.C. (1997) SWISS-MODEL and the Swiss- PDB Viewer: An environment for comparative protein modeling. Electrophoresis 18, 2714–2723. 26. Zavodszky, P., Kardos, J. & Svingor & Petsko, G.A. (1998) Adjustment of conformational flexibility is a key event in the thermal adaptation of proteins. Proc. Natl Acad. Sci. USA 95, 7406–7411. 27. Lonhienne, T., Gerday, C. & Feller, G. (2000) Psychrophilic enzymes: revisiting the thermodynamic parameters of acti- vation may explain local flexibility. Biochim. Biophys. Acta 1543, 1–10. Ó FEBS 2002 Mutagenesis of a psychrophilic alkaline phosphatase (Eur. J. Biochem. 269) 2335 . Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase Konstantinos Mavromatis 1, *, Iason Tsigos 2, *, Maria Tzanodaskalaki 2 ,. the vicinity of the active site of the psychrophilic alkaline phosphatase from the Antarctic Table 1. Enzymatic and thermodynamic parameters of the psychrophilic