Proteasome involvement in the degradation of the G q family of Ga subunits Bente B. Johansson, Laura Minsaas and Anna M. Aragay Department of Biomedicine, Faculty of Medicine, University of Bergen, Norway One common feature of G protein-coupled receptor (GPCR) signaling is the rapid loss of cellular sensitiv- ity even in the presence of a stimulus. Insensitivity to the extracellular stimuli reflects intracellular events such as receptor⁄ G protein uncoupling, G protein inactivation, and receptor sequestration and degrada- tion that together regulate the duration and⁄ or the magnitude of the signaling event. In particular, the rapid degradation of signaling proteins by the protea- some ⁄ ubiquitin system appears to play an important role in the control of the duration of the signal. For instance, ligand-stimulated ubiquitination of several mammalian cell surface receptors has been reported to induce internalization, followed by degradation in lysosomes [1]. The ubiquitin-proteasome pathway influences agonist-induced degradation of opioid receptors [2], rhodopsin [3] and the yeast pheromone receptors, ste2p and ste3p [4,5]. Recently, it has been shown that agonist-stimulated ubiquitination of the b2 adrenergic receptor (b2AR) is required for receptor degradation, whereas b-arrestin 2 ubiquitination is essential for rapid receptor internalization [6]. In addition, the turnover of G protein coupled receptor kinase 2 (GRK2), the kinase that regulates the dur- ation of receptor activation, is mediated by the protea- some [7]. Also, it is becoming increasingly clear that the degradation of members of the family of regulators of G protein signaling (RGS) [8] and inositol (1,4,5)- triphosphate [Ins(1,4,5)P3] receptors [9–12] is another way to modulate cellular responses. Keywords degradation; G proteins; proteasome Correspondence A. M. Aragay, Department of Biomedicine, Faculty of Medicine, University of Bergen, N-5009 Bergen, Norway Fax: +47 55586360 Tel: +47 55586379 E-mail: anna.aragay@biomed.uib.no (Received 28 June 2005, accepted 23 August 2005) doi:10.1111/j.1742-4658.2005.04934.x Metabolically unstable proteins are involved in a multitude of regulatory networks, including those that control cell signaling, the cell cycle and in many responses to physiological stress. In the present study, we have deter- mined the stability and characterized the degradation process of some members of the G q class of heterotrimeric G proteins. Pulse-chase experi- ments in HEK293 cells indicated a rapid turnover of endogenously expressed Ga q and overexpressed Ga q and Ga 16 subunits. Pretreatment with proteasome inhibitors attenuated the degradation of both G alpha subunits. In contrast, pretreatment of cells with inhibitors of lysosomal proteases and nonproteasomal cysteine proteases had very little effect on the stability of the proteins. Significantly, the turnover of these proteins is not affected by transient activation of their associated receptors. Fraction- ation studies showed that the rates of Ga q and Ga 16 degradation are accel- erated in the cytosol. In fact, we show that a mutant Ga q which lacks its palmitoyl modification site, and which is localized almost entirely in the cytoplasm, has a marked increase in the rate of degradation. Taken together, these results suggest that the G q class proteins are degraded through the proteasome pathway and that cellular localization and ⁄ or other protein interactions determine their stability. Abbreviations ALLN, N-acetyl- L-leucyl-L-leucyl-L-norleucinal; GAP, GTPase activating protein; G protein, heterotrimeric guanine nucleotide-binding protein; GPCR, G protein-coupled receptor; GRK, G protein-coupled receptor kinase; PLC, phosphoinositide phospholipase C; PLCb, phosphoinositide phospholipase C; PMSF, phenylmethylsulphonylfluoride; RGS, regulator of G protein signaling. FEBS Journal 272 (2005) 5365–5377 ª 2005 FEBS 5365 Activation of GPCRs by specific ligands, promotes the exchange of GDP for GTP on Ga subunits, result- ing in the dissociation from the Gbc dimer with the result that the Ga subunit and Gbc become free to affect downstream effectors. The activity of some G alpha subunits is also controlled by RGS proteins [13– 15] or by downstream effectors which act as GTPase activating proteins (GAPs) for Ga [16,17]. GRK2 regulates Ga q -mediated signaling by direct interaction of its RGS domain with the transitional state of Ga q [18,19]. On the other hand, there is compelling evi- dence that G proteins are regulated through co- and post-translational modifications [20]. For instance, all known Ga subunits undergo myristoylation and ⁄ or palmitoylation and the lipid modifications are needed for the full activity of G proteins. In addition, regula- tion by serine ⁄ threonine or tyrosine phosphorylation has been shown for different G protein alpha subunits. Furthermore, chronic exposure to ligands leads to receptor down regulation and can modulate the levels of G protein alpha subunits [21]. Therefore, the regula- tion of G protein turnover may be another mechanism to regulate the signaling response. In this study, we sought to characterize the degrada- tion process of G q class of Ga subunits. This class of Ga subunits stimulates phosphoinositide phospho- lipase C (PLCb) enzymes to generate inositol 1,4,5-tris- phosphate and release of Ca 2+ from intracellular stores [22]. The G q class includes Ga q ,Ga 11 ,Ga 14 and Ga 15 ⁄ 16 .Ga q ,Ga 11 and Ga 14 are highly homologous and have similar activities towards effector activation. Ga q and Ga 11 are ubiquitously expressed. On the con- trary, Ga 16 expression is confined to hematopoietic cells derived mainly from early stages of differentiation [23–26]. In addition, it appears that Ga 15 ⁄ Ga 16 can be activated by a greater variety of receptors than Ga q , Ga 11 and Ga 14 [27], besides being phosphorylated by protein kinase C [28]. Here, we show that two mem- bers of the Gq class Ga subunits, namely Ga q and Ga 16 have a fast rate of degradation. The results impli- cate a prominent role for the proteasome pathway in down regulation and basal turnover of the proteins. The rate of degradation of the G q proteins does not seem to be affected by receptor stimulation but instead it is enhanced in the cytoplasm. Results In order to study the stability of the G q class of G proteins, pulse and chase analysis of metabolically labeled cells were performed. For this, HEK293 cells were incubated for 30 min in presence of [ 35 S]methio- nine and then chased in the presence of unlabeled medium for various time points. Subsequently, cells were lysed and immunoprecipitated with the Ga q -spe- cific antibodies for the recovery of proteins from the membrane. The specificity of antibodies was verified by analyzing HEK293 cells transiently transfected with Ga q and Ga 16 cDNAs and immunoprecipitating with the anti-Ga q (CT-12872 or sc-392) and anti-Ga 16 (CT56) antibodies prior to pulse-chase experiments. As shown in Fig. 1(A,B), both anti-Ga q Igs detected a band of 42 kDa that was more prominent in HEK293 cells transient transfected with the plasmid encoding for Ga q . The CT56 antibody shows no apparent reac- tion, at 43 kDa, in HEK293 cells that do not express ABC Fig. 1. Characterization of antibodies against Ga q and Ga 16 proteins. The HEK293 cells were transiently transfected with pCISLacZ as control, pCISGa q or pCISGa 16 and labeled with [ 35 S]methionine as described in experi- mental procedures. Cells were lysed and protein extracts were immunoprecipitated with Ga q or Ga 16 antiserum: (A) anti-G q CT-12178; (B) anti-G q sc-392; and (C) anti-Ga 16 CT56, followed by SDS ⁄ PAGE (A and C, 12.5% and B, 10% PAGE). The figure shows representative autoradio- graphies of whole SDS ⁄ PAGE gels loaded with the 35 S immunoprecipitates and the arrowheads indicate the position of Ga q and Ga 16 . The molecular mass standards are indicated. The arrow indicates the position of some unspecific bands. Proteasome degradation of G q proteins B. B. Johansson et al. 5366 FEBS Journal 272 (2005) 5365–5377 ª 2005 FEBS the Ga 16 protein (Fig. 1C). Nevertheless, some unspe- cific bands of higher molecular mass appear and are labeled with arrows. Figure 2A shows a representative experiment of the pulse chase analysis of endogenous Ga q . As can be seen, endogenous Ga q showed a rapid protein degra- dation. The levels of endogenous Ga q decreased very rapidly the first 3 h (60%) and then decreased progres- sively at 6, 12 and 24 h to 44, 35 and 25% of zero time controls, respectively. Based on curve fitting analysis, the half life of Ga q was estimated  4 h if we assume a monoexponential rate of decay. Control immuno- precipitates of cells overexpressing Ga q are shown in Fig. 1A (293 + Ga q ). A similar degradation rate ( 3h) was obtained for Ga q or Ga 16 proteins overexpressed in cells (Fig. 2B,C). Control immunoprecipitates of HEK293 cells expressing only endogenous Ga q or in absence of Ga 16 are shown in Fig. 2B,C (293). Taken together, these results suggest that the Ga q and Ga 16 proteins either endogenous or overexpressed display a rapid turnover in HEK293 cells. To investigate which proteases were responsible for the degradation of Ga subunits, assays were performed using cell-permeable protease inhibitors. Pulse and chase experiments were performed after 3 h of preincu- bation in the presence of the specific protease inhibitors of different proteolytic pathways (Fig. 3). Leupeptin (100 lgÆmL )1 ), an inhibitor of protein degradation in lysosomes, had no effect on the stability of the Ga q and Ga 16 proteins. The presence of N-acetyl-l-leucyl- l-leucyl-l-norleucinal (ALLN; 1 lm), which blocks non- proteasomal proteases at 1 lm doses, did not influence A B C Fig. 2. Ga q and Ga 16 show a rapid turnover. Pulse-chase analysis of endogenous Ga q (A), transfected Ga q (B), and transfected Ga 16 (C). The HEK293 cells transfected with pCISLacZ as control (293), with pCISGa q (293 + Ga q ) or with pCISGa 16 (293 + Ga 16 ) were meta- bolically labeled and chased for the indicated hours. After pulse- chase, protein extracts (900 lginA;100lg in B and C) were immunoprecipitated with Ga q or Ga 16 antiserum (A, anti-G q sc-392; B, anti-G q CT-12178 and C, anti-Ga 16 CT56) followed by SDS ⁄ PAGE (A, 10%; B and C, 12.5% PAGE). Control immunoprecipitates of cells expressing only endogenous Ga q (293) or in absence of Ga 16 (293) are shown in (B) and (C). The relative amounts of [ 35 S]Ga q and [ 35 S]Ga 16 were determined using a phophoimager and plotted as a function of the chase time. Single experiments were per- formed with triplicate samples and the mean of triplicates was nor- malized by the mean at time zero. Data represent the mean of at least four independent experiments where error bars are standard deviations. Upper unspecific are shown by arrows. There are smalls variations in the amount of these bands but no correspondence in seen with the decrease G protein content during the chase taking into account all experiments performed. Arrowheads indicate the position of Ga q and Ga 16 . B. B. Johansson et al. Proteasome degradation of G q proteins FEBS Journal 272 (2005) 5365–5377 ª 2005 FEBS 5367 the turnover rate of the proteins, thus excluding their involvement in protein breakdown. On the contrary, treatment with the proteasome inhibitors MG132 (50 lm) and the highly specific lactacystin (30 lm) clearly prevented the Ga q protein degradation after 3 h of chase when compared with control conditions A BD E C Fig. 3. The degradation of Ga q and Ga 16 is specifically decreased by proteasome inhibitors. The effect of protease inhibitors on the degrada- tion of endogenous and transfected Ga q and Ga 16 was determined by incubating cells in presence or absence of 100 lgÆmL )1 leupeptin (lysosome inhibitor), 50 l M MG132 (proteasome inhibitor), 1 lM ALLN (inhibitor of nonproteasomal cystein proteases) or 30 lM lactacystin (proteasome inhibitor) prior to [ 35 S]methionine labeling. Cells were metabolically labeled, chased for the indicated hours and protein extracts (900 lg from endogenous G q expressing cells and 100 lg from transfected cells) were immunoprecipitated and analyzed by SDS ⁄ PAGE. (A) Representative autoradiographies of endogenous Ga q (293), transfected Ga q (293 + Ga q ) or transfected Ga 16 (293 + Ga 16 ). The relative amounts of the [ 35 S]Ga subunits were determined using a phosphoimager and plotted as a function of treatment: (B) transfected Ga q ; (C) endogenous Ga q ; and (D) transfected Ga 16 . Data represent mean of triplicates from a single experiment normalized by the mean at zero hours where error bars are standard deviations. At least three independent experiments obtained similar results. (E) HEK293 cells transiently transfected with either M2 muscarinic receptor or control vector in presence or absence of Ga 16 or with M1 muscarinic receptor and Ga q were labeled with myo-[2- 3 H]inositol (10 lCiÆmL )1 ) for 24 h before incubation in presence or absence of the proteasome inhibitor MG132 (50 l M) 3 h prior to treatment with carbachol (10 lM). Values represent the means of duplicate determinants ± SD from a single experiment, which is representative of two such experiments. Proteasome degradation of G q proteins B. B. Johansson et al. 5368 FEBS Journal 272 (2005) 5365–5377 ª 2005 FEBS (Fig. 3B). Consistently, similar effects were observed with endogenous Ga q and cells expressing Ga 16 pro- teins (Fig. 3C,D). We also studied the effect produced by the treatment with the proteasome inhibitors on cell viability and G protein activity by analyzing the release of inositol phosphates by carbachol in cells expressing the M1R (Fig. 3E). Carbachol-stimulation of HEK293 cells transiently transfected with the muscarinic recep- tor 1 (M1R) and Ga q , showed the characteristic increase in accumulation of inositol phosphates. Lig- and-induced release of inositol phosphates was again markedly increased after 3 h of preincubation with the proteasome inhibitor MG132. Similar observations were made in cells transiently transfected with the muscarinic receptor 2 (M2R) and Ga 16 . To explore whether receptor activation can modulate Ga-turnover, receptors for carbachol (M1R and M2R) were transfected in HEK293 cells that do not express these receptors endogenously. These receptors were chosen as it is well established the specificity of coup- ling of G q with M1 receptor and G 16 with M2 recep- tor. Cells were transfected with pCISM1R and analysis of endogenous Ga q half-life after carbachol activation was performed by pulse-chase (Fig. 4A). Under control AB CD Fig. 4. Activation of Ga q and Ga 16 does not alter the half-life of the protein. HEK293 cells were transiently transfected with plasmids encoding for M1R (A) and Ga q and Ga q R183C (B), Ga 16 and M2R (C), Ga 16 and Ga 16 Q212L (D), as indicated. Cells were metabolically labeled, stimula- ted with carbachol (10 l M) as indicated and chased for the indicated hours. Protein extracts [900 lg from endogenous Ga q expressing cells (293 + M1R) and 100 lg from Ga q ⁄ Ga 16 transfected cells (293 + Ga q ⁄ 293 + Ga 16 )] were immunoprecipitated (anti-G q CT-12178 and anti-Ga 16 CT56) and analyzed by SDS ⁄ PAGE (12.5%). Relative amounts of [ 35 S]Ga q and [ 35 S]Ga 16 were determined using a phophoimager and plotted as a function of the chase time. Data represent the mean of triplicates from a single representative experiment normalized by the mean at zero hours where error bars are standard deviations. Representative autoradiographies are shown and arrow heads indicate the positions of Ga q and Ga 16 . A minimum of three independent experiments obtained similar results in the all experiments shown. B. B. Johansson et al. Proteasome degradation of G q proteins FEBS Journal 272 (2005) 5365–5377 ª 2005 FEBS 5369 conditions, the levels of Ga q decay were essentially as described in Fig. 2(A,B). Agonist stimulation did not alter the degradation rate with 60 and 40% of the pro- tein remaining at 3 and 6 h, respectively, both for the ligand-activated and nonactivated Ga q . Adding new media containing 10 lm carbachol every 30 min during the chase period did not have any effect on the rate of degradation either (data not shown). More surpris- ingly, the activated mutant of Ga q ,Ga q R183C, showed no significant differences in stability regardless of its constitutive activity, indicating that the activated mutant is as stable as the wild-type form (Fig. 4B). Accordingly, the levels of Ga 16 decay were the same in the presence or absence of carbachol (Fig. 4C) in cells expressing the M2R. Also the activated mutant of Ga 16 ,Ga 16 Q212L, showed no significant differences in half-life compared with the wild-type Ga 16 (Fig. 4D). Taken together, these results demonstrate that the rate of G protein degradation is independent of ligand acti- vation. The observation that ligand activation did not pro- duce any change in protein degradation could be due to the inability of the transfected receptors to activate the G proteins. To investigate this, the effect of ligand- activation on inositol phosphate release was studied in HEK293 cells coexpressing the M1R and endogenous Ga q or M2R together with Ga 16 . As observed in Fig. 5A, treatment of M1R-expressing cells with car- bachol induces the typical increase responsiveness on inositol phosphates. Equivalent results were observed AB CD Fig. 5. Functional assay of the Ga subunits. HEK293 cells were transiently transfected with or without receptor in presence or absence of Ga subunit and labeled with myo-[2- 3 H]inositol (10 lCiÆmL )1 ) for 24 h prior to treatment with ligand for 25 min. (A) Cells expressing the M1 muscarinic receptor in presence of endogenous Ga q and un-treated or treated with carbachol (10 lM). (B) Cells expressing Ga q ,Ga q R183C or control vector in absence of M1 receptor and treated as in (A). (C) Cells expressing Ga 16 and M2R and treated as in (A). (D) Cells expres- sing Ga 16 ,Ga 16 Q212L or control vector in absence of M2 receptor and treated as in (A). Expression of the G proteins in each of the assays is shown in the lower panel. Values represent means of duplicate determinants from a single experiment, which is representative of minimum two such experiments. Proteasome degradation of G q proteins B. B. Johansson et al. 5370 FEBS Journal 272 (2005) 5365–5377 ª 2005 FEBS for carbachol-induced M2 activation of Ga 16 (Fig. 5C) and for the constitutive activate mutant forms of Ga q and Ga 16 (Fig. 5B,D). All these results confirm previ- ous studies and demonstrate that in fact receptor sti- mulation leads to activation of Ga 16 and Ga q subunits. Therefore the lack of change in the rate of degradation cannot be due to lack of receptor-activa- tion of the alpha subunits. Given that the activation of G proteins by ligand- stimulated receptors takes place in the cytoplasmic leaflet of the cell membrane and that not all the Ga subunits in the cell will be activated by receptor stimu- lation, pulse-chase experiments were performed with cell extracts enriched in particulated vs. cytoplasmic fractions, in order to enrich in the GPCR-activated pool. For this, cells were metabolically labeled, stimu- lated and cell extracts were separated by centrifugation (Fig. 6). Significantly, these experiments confirmed our previous results that show no difference in the degra- dation rate between the stimulated and nonstimulated G proteins in both crude cytoplasmic and particulated fractions and for both endogenous and overexpressed Ga q and M1R or Ga 16 and M2R (Fig. 6A–C). How- ever, a somehow surprising result was the fact that the crude cytoplasmic fractions of both Ga q and Ga 16 were less stable than the membrane-enriched fraction. After 6 h only 20% of the cytosolic proteins were remaining vs. 50–60% of the membrane fraction. These results are consistent with the idea that the Ga subunits are more stable in the membrane than in the cytoplasm. To study this further we designed a mutant Ga q protein where the two palmitoylated cys- teine residues CC9 ⁄ 10 were mutated to serine residues. For Ga q and Ga 11 , subcellular distribution and the role of N-terminal palmitoylation has been extensively studied previously [29–33]. Consistent with these previ- ous findings, fractionation and immunofluorescence studies showed that the mutant Ga q CC9 ⁄ 10SS was A B C Fig. 6. Differences in Ga q and Ga 16 degradation rates in membrane and cytosolic fractions. Cells were transiently transfected with plas- mids encoding M1R and LacZ (A), M1R and Ga q (B) or M2R and Ga 16 (C), metabolically labeled and chased for the indicated hours. Cells were lysed (900 lg of total protein from endogenous Ga q expressing cells and 500 lg from transfected cells) and particulated and cytosolic fractions were separated by centrifugation. Protein extracts from each fraction were immunoprecipitated (anti-G q CT-12178 and anti-G a 16 CT56) and analyzed by SDS ⁄ PAGE (12%). Relative amounts of [ 35 S]Ga q and [ 35 S]Ga 16 were determined using a phophoimager and were plotted as a function of chase time. The amount of Ga q and Ga 16 at time zero was set to 100%. The data represent mean of triplicates from a single representative experi- ment normalized by the mean at time zero where error bars are standard deviations. A two-tailed Student’s t-test was run to com- pare membrane fraction and cytosolic fraction. All tests show a sig- nificance of *, **P < 0.001 where n varies from 5 to 9. No significant difference was seen between ligand stimulated and nonstimulated cells in the same experiments. Representative auto- radiographies are shown and arrowheads indicate the positions of Ga q and Ga 16 . Upper nonspecific bands are shown by arrows. B. B. Johansson et al. Proteasome degradation of G q proteins FEBS Journal 272 (2005) 5365–5377 ª 2005 FEBS 5371 present mainly in the cytoplasm-enriched fraction (data not shown), in contrast both transfected and endo- genous Ga q showed a similar distribution with the pro- tein present mainly close to the cytoplasmic membrane but also some present in the cytoplasmic fraction. When pulse-chase analysis of Ga q CC9 ⁄ 10SS and Ga q were examined, a decrease in the total amount of the Ga q CC9 ⁄ 10SS mutant was observed prior to chase (Fig. 7). A decrease in the amount of 35 S associated with Ga q CC9 ⁄ 10SS immediately after incubation with [ 35 S]methionine may indicate an alteration in the rate of its degradation during the labeling period. In fact, only 15% of 35 S-labeled mutant protein remains (vs. 100% of wild-type protein at 0 h). Nevertheless, it could also be explained by changes in translation or maturation of the protein. An increase was also observed in the rate of degradation of the remaining mutant protein (20% left of the protein) vs. the wild type (40% left of the protein) at 3 h of chase (Fig. 7A,B). We also analyzed the rate of degradation of another mutant Ga q protein, Ga q IE25 ⁄ 26AA. This mutant protein has two residues substituted to alanine in the putative Gbc binding site [34,35]. An equivalent region in Ga i was shown before to be in direct contact to Gbc [36]. As shown in Fig. 7(A,B), no change in the total amount of protein or in the rate of degrada- tion was observed, which is an indication that the binding of Ga to Gbc subunits may not the limiting factor for its stability. Discussion In this report we present evidence that endogenous Ga q , transfected Ga q and Ga 16 proteins degrade with half-lives of around 3–4 h, if we assume a monoexpo- nential rate of decay. Furthermore, we provide novel data showing that members of the G q class proteins are degraded through the proteasome pathway. The degradation of the G q proteins is not dependent on GPCR activation or on G protein activity. On the con- trary, the association of Ga subunits to other proteins close to or at the cytoplasmic membrane may play a major role in protein stability. Many signaling proteins with fast degradation rates are degraded through the proteasome. Here, we have provided evidence that the proteasomal pathway is also responsible for the degradation of the members of the G q alpha class. Specific degradation of the Ga sub- unit by the proteasome-dependent pathway has been shown for the yeast Gpa1 [37,38] and for Ga o [39]. Therefore it is increasingly evident that the protea- some-dependent pathway plays an important role in the regulation of G protein stability. An open question in signal transduction studies has been the effect that receptor activation has on the turnover of downstream proteins. As is the case, GRK2 degradation through proteasome is enhanced by GPCR stimulation [7]. Chronic exposure to ligand produces a decrease in G protein levels [21]. On the other hand, our results have provided evidence for the lack of ligand-induced degradation of Ga q proteins. Neither receptor-activation of Ga q or Ga 16 in total lysates nor in membrane or cytoplasm fractions had any effect on the half-life of the proteins. Muta- tional activation of Ga q through the inhibition of its GTPase-activity, did not produce any enhancement in the rate of degradation compared with the wild-type protein. Our data is more consistent with an increased destabilization of the protein in the cytoplasm, a pro- cess that, in the case of the G q family of proteins, is independent of receptor activation. Short-term receptor A B Fig. 7. The mutant Ga q CC9 ⁄ 10SS has an increased rate of degrada- tion compared to the Ga q wt. HEK293 cells were transiently transfected with pcDNA3Ga q , pcDNA3Ga q CC9 ⁄ 10SS, pcDNA3Ga q IE25 ⁄ 26AA or empty pcDNA3 vector as a control (293) and metabolically labeled with [ 35 S]methionine and chased for 3 h. (A) Shows the autoradiographies of the two mutant G proteins compared with the wild-type protein at 0 and 3 h. (B) The relative amounts of the [ 35 S]Ga q subunits were determined using a phos- phoimager and plotted as a function of chase time. Data represents the mean of triplicates from a single representative experiment nor- malized by the mean at zero hours where error bars are standard deviations. Two experiments produce similar results in all the experiments shown. Proteasome degradation of G q proteins B. B. Johansson et al. 5372 FEBS Journal 272 (2005) 5365–5377 ª 2005 FEBS activation of G q proteins does not induce translocation of these subunits to the cytoplasm [31]. On the con- trary, ligand activation of G s proteins induces trans- location of these G proteins to the cytoplasm [40,41], which could explain previous results showing that lig- and activation of receptors coupled to G s promotes an increase in the degradation of this subunit [41]. On the other hand, chronic agonist treatment of receptors coupled to Ga q could deplete the cytoplasmic mem- brane from receptors and proteins associated to them, and could explain the increased degradation of Ga q in the experiments with persistent ligand stimulation [42– 44]. Interestingly, very recent work done with the yeast Ga subunit Gpa1 have shown that poly ubiquitinated Gpa1 exhibits a cytoplasmic localization [45]. On the contrary a Gpa1 mutant that lacks the ubiquitinated subdomain remains unmodified and is predominantly localized at the plasma membrane. Protein stability in the plasma membrane can be a consequence of receptor association, but interactions of Ga q subunits with other proteins could also be respon- sible for the stabilization in the membrane. The fact that the activated mutant forms of Ga q and Ga 16 have the same behavior as the wild-type forms argues in favor of the need of other proteins to stabilize the pro- teins in the membrane. The interaction of Ga subunits with Gbc could be a stabilizing factor. Mutations on Ga q residues which locate in the Gbc binding region and have been shown to diminish association with the plasma membrane [34] did not have any consequence in protein stability. It is still possible that this mutant retains some binding to Gbc subunits, as it was shown that localization at the plasma membrane could be res- cued by expression of Gbc subunits [35]. Other proteins that interact with the Ga q subunits and may have a role in the stabilization of these subunits in the mem- brane are the regulators of G-protein signaling (RGS) [14] or the GRK2, which has been shown recently to have a RGS-like domain that binds to Ga q [18,19]. Recent results have described an RGS–GAIP-inter- acting protein, GIPN, that has E3-ubiquitin ligase activity and promotes proteasome-dependent degrada- tion of Ga i3 [46]. The role of these proteins in the turn- over of the Ga q protein should be further investigated. Interestingly, G q , apparently without Gbc subunits, stably associates with caveolin in caveolae structures [47]. Caveolin has been suggested to act as a scaffold to trap and stabilize Gq. On the other hand, the degrada- tion of Ga o via the proteasome pathway is protected by interaction of the Ga o subunit with Hsp90 [39]. Also the Ga 12 subunit, which localizes in membrane frac- tions [48], has been shown to associate to Hsp90 and its association is important for Ga 12 signaling [49]. Work in progress indicates that the same interaction could be taking place for Ga q subunits. In summary, our results suggest that subcellular localization and ⁄ or protein interactions at the mem- brane are responsible for Ga protein stability. Further work will help to elucidate the molecular bases of those mechanisms that control the stability of G pro- tein subunits close to the cytoplasmic membrane. Experimental procedures Materials HEK293 cells (293-EBNA) and LipofectAMINE were purchased from Invitrogen (Groningen, the Netherlands). Carbachol and leupeptin were obtained from Sigma-Aldrich (St Louis, MO, USA). C5a was a generous gift from M. Oppermman (Georg-August Universita ¨ t, Gottingen, Germany). ALLN and lactacystin were purchased from Calbiochem (San Diego, CA, USA). MG132 was obtained from BIOMOL Research Laboratories Inc (Plymouth Meeting, PA, USA). C-Terminal peptide polyclonal anti- bodies against Ga q and Ga 16 were generated in M. Simon’s laboratory (California Institute of Technology, Pasadena, CA, USA). In some experiments (indicated in the legends) the C-terminal peptide polyclonal antibodies against Ga q were obtained from Santa Cruz Biotechnologies (Santa Cruz, CA, USA). Secondary HRP-labeled antibody was ordered from Zymed Laboratories. [ 35 S]Methionine was ordered from Amersham Pharmacia Biotech (Piscataway, NJ, USA). Myo-[2- 3 H]inositol was purchased from Ameri- can Radiolabeled Chemicals Inc (Saint Louis, MO, USA). Enhanced chemiluminescence reagents were obtained from Amersham Pharmacia Biotech. All other reagents were of the highest grade commercially available. DNA constructs The cDNAs from Ga q and Ga 16 cloned into pCIS were provided by M.I. Simon (California Institute of Technol- ogy). The mutant deficient of Gbc-binding was generated by using site-directed mutagenesis using pCISGa q as a tem- plate and the following oligos: Ga q IE25 ⁄ 26AA: 5¢-ggat caacgacgaggccgcgcggcagctgcgcaggg-3¢,Ga q IE25 ⁄ 26AA-cccc tgcgcagctgccgcgcggcctcgtcgttgatcc. The palmitoylation-defi- cient mutant Ga q CC9 ⁄ 10SS was generated by site-directed mutagenesis and amplified using pCISGa q wt as a template. PCR was carried out using a forward primer with a KpnI site (underlined): Ga q -N-term-Kpn1: 5¢-cgcgggtaccatgatc ctggagtccatcatggcgtgctgcctgagcgaggag-3¢,Ga q CC9 ⁄ 19SS-N- term-Kpn1: 5¢- cgcgggtaccatgactctggagtccatcatggcgtcctccctg agcgaggag-3¢, and a reverse primer with a BamHI site (underlined): Ga q -C-term- BamHI: 5¢-cgcggatccttagaccagat tgtactcctt-3¢. The PCR products were digested and ligated B. B. Johansson et al. Proteasome degradation of G q proteins FEBS Journal 272 (2005) 5365–5377 ª 2005 FEBS 5373 into pcDNA3. Ga 16 was subcloned from pCIS vector to pcDNA3 by PCR, with primers including restriction enzyme sites. All the plasmids presented were sequenced prior to use. Cell culture and transfection HEK293 cells were cultured in Dulbecco’s modified Eagle’s medium, supplemented with 10% (v ⁄ v) fetal bovine serum at 37 °C in a humidified atmosphere containing 5% (v ⁄ v) CO 2 . Transient transfections were performed on 70–80% confluent monolayers by using LipofectAMINE reagent according to the manufacturer’s instructions. Briefly, HEK293 cells (1.5 · 10 6 cells) were seeded on a P60-plate a day prior to transfection with 5 lg of total plasmid DNA: pCISGa q or pCISGa 16 in presence or absence of pCISM1R or pCISM2R ⁄ pCISC5aR (Ga ⁄ R ¼ 0.4 ⁄ 0.6), respectively. The total amount of DNA was kept constant with the addi- tion of pCISLacZ. Metabolic labeling Metabolic labeling was performed 48 h following transfec- tion of cells kept with Dulbecco’s modified Eagle’s medium, supplemented with 10% (v ⁄ v) fetal bovine serum. Cells expressing Ga q or Ga 16 were incubated for 1 h in methion- ine-free DMEM in absence of serum and then incubated for 30 min in this medium supplemented with 50 lCiÆmL )1 of [ 35 S]methionine labeling mixture. The cell monolayers were washed with phosphate-buffered saline (NaCl ⁄ P i ) and chased for indicated times in DMEM containing an excess of cold methionine. To determine the effect of various pro- tease inhibitors, cells were treated with inhibitors for 3 h before the chase and were present throughout the chase at the following concentrations: leupeptin 100 lgÆmL )1 , ALLN 1 lm, MG132 50 lm and lactacystin 30 lm. All protease inhibitors, except leupeptin, were dissolved in dimethylsulfoxide, and control cells were treated with equal amounts of dimethylsulfoxide alone. In the experiments with cells expressing Ga q or Ga 16 in presence or absence of M2R ⁄ C5aR or M1R, respectively, the ligand was added at the beginning of the chase (t ¼ 0 min) at concentrations of 10 lm carbachol or 100 nm C5a, respectively. Immunoprecipitation After the chase, cells were washed and lysed in RIPA buffer [50 mm Tris pH 7.5, 300 mm NaCl, 1% (w ⁄ v) n-dodecyl- b-d-maltoside, 0.1% (w ⁄ v) sodium dodecyl sulfate and 0.5% (w ⁄ v) deoxycholate, with protease inhibitors] for 1 h at 4 °C with continuous rocking. In early experiments, the total pro- tein content in the samples was estimated before immuno- precipitation by using Bradford analysis, later this step was omitted due to good reproducibility of the samples. Protein extracts (900 lg of total protein for endogenous Ga q samples and 100 lg for Ga q and Ga 16 transfected cells) sup- plemented with 1 lgÆlL )1 BSA were immunoprecipitated overnight at 4 °C with the specific Ga q or Ga 16 antibodies, followed by incubation with protein A-sepharose beads for 1.5 h. Immune complexes were then washed four times with NaCl ⁄ P i , pH 7.2. Following SDS ⁄ PAGE resolution, the gel was dried and later analyzed by phosphoimaging in a BAS 5000 system from Fuji (Fuji Foto Film, Tokyo, Japan). The background level was subtracted from the values registered for each band. As the background of some of the lanes was variable some experiments were done with subtraction of the background of the corresponding band, with no differ- ences in the overall result. Every experiment was performed with triplicate samples of each time point. The average value of each time point was normalized with the average value at 0 h. A minimum of three independent experiments showed similar results. Determination of total inositol phosphate levels Total inositol phosphate formation was measured essen- tially as described previously [50]. Briefly, 1 · 10 5 cells were seeded in 12-well plates and transfected after 24 h with 1 lg of total plasmid DNA. Cells were prelabeled with 10 lCiÆmL )1 [ 3 H]inositol for 24 h in inositol-free medium containing 10% (v ⁄ v) dialyzed fetal bovine serum. Cells were then washed and incubated in NaCl ⁄ P i containing 20 mm Li + with the agonist at 37 °C for 20 min. Cells were then treated with 100 lL of 10% (v ⁄ v) perchloric acid and 10 lL of phytic acid (20 mgÆ mL )1 ) for 10 min. The mixture was centrifuged and neutralized. After centrifugation, the supernatants were subjected to anion exchange chromato- graphy. The final eluant was dissolved in scintillation liquid and counted in a scintillation counter. Western blotting For total G protein content analysis, cell extracts were pre- pared by lysis in a hypotonic buffer (50 mm Hepes, 0.2 mm EDTA, 1 mm dithiotreitol, pH 7.4) and cleared by centri- fugation at 500 g for 5 min. Supernatants were boiled in Lae- mmli sample buffer and resolved by SDS ⁄ PAGE. Proteins were transferred to a nitrocellulose membrane and probed with either Ga 16 or Ga q antibodies, respectively. Blots were developed using a chemiluminiscence assay method. Subcellular fractionation Cells (1.5 · 10 6 ) were seeded for transfection of cells with Ga q and G a 16 , and 5 · 10 6 cells were used for studying endogenously expressed Ga q . Cells were metabolically labe- led as described. After the chase, the cells were harvested in hypotonic buffer (50 mm Hepes, 0.2 mm EDTA, 1 mm, pH 7.4) and lysed by several cycles of freezing and thawing. Proteasome degradation of G q proteins B. B. Johansson et al. 5374 FEBS Journal 272 (2005) 5365–5377 ª 2005 FEBS [...]... Milligan G (1993) Enhanced degradation of the phosphoinositidase C-linked guanine-nucleotide-binding protein Gq alpha ⁄ G11 alpha following activation of the human M1 muscarinic acetylcholine receptor expressed in CHO cells Biochem J 293, 495–499 44 Shah BH, MacEwan DJ & Milligan G (1995) Gonadotrophin-releasing hormone receptor agonist-mediated down-regulation of Gq alpha ⁄ G11 alpha (pertussis toxin-insensitive)... Parenti M & Milligan G (1995) The role of palmitoylation of the guanine nucleotide binding protein G11 alpha in defining interaction with the plasma membrane Biochem J 310, 1021–1027 Evanko DS, Thiyagarajan MM & Wedegaertner PB (2000) Interaction with Gbetagamma is required for membrane targeting and palmitoylation of Galpha(s) and Galpha(q) J Biol Chem 275, 1327– 1336 Evanko DS, Thiyagarajan MM, Siderovski... kinase 2: direct interaction of kinase N terminus with activated galphaq Mol Pharmacol 57, 826–831 19 Usui H, Nishiyama M, Moroi K, Shibasaki T, Zhou J, Ishida J, Fukamizu A, Haga T, Sekiya S & Kimura S (2000) RGS domain in the amino-terminus of G protein-coupled receptor kinase 2 inhibits Gq- mediated signaling Int J Mol Med 5, 335–340 20 Chen CA & Manning DR (2001) Regulation of G proteins by covalent... Functional importance of the amino terminus of Gq alpha J Biol Chem 271, 496–504 Edgerton MD, Chabert C, Chollet A & Arkinstall S (1994) Palmitoylation but not the extreme amino-terminus of Gq alpha is required for coupling to the NK2 receptor FEBS Lett 354, 195–199 Hughes TE, Zhang H, Logothetis DE & Berlot CH (2001) Visualization of a functional Galpha q-green fluorescent protein fusion in living cells: association... (1997) Angiotensin II-induced down-regulation of inositol trisphosphate receptors in WB rat liver epithelial cells: evidence for involvement of the proteasome pathway J Biol Chem 272, 12454– 12461 FEBS Journal 272 (2005) 5365–5377 ª 2005 FEBS Proteasome degradation of Gq proteins 10 Oberdorf J, Webster JM, Zhu CC, Luo SG & Wojcikiewicz RJ (1999) Down-regulation of types I, II and III inositol 1,4,5-trisphosphate... proteins: barbarians at the gate J Biol Chem 273, 1269– 1272 14 Ross EM & Wilkie TM (2000) GTPase-activating proteins for heterotrimeric G proteins: regulators of G protein signaling (RGS) and RGS-like proteins Annu Rev Biochem 69, 795–827 15 Hollinger S & Hepler JR (2002) Cellular regulation of RGS proteins: modulators and integrators of G protein signaling Pharmacol Rev 54, 527–559 16 Berstein G,... Ubiquitin and the control of protein fate in the secretory and endocytic pathways Annu Rev Cell Dev Biol 14, 19–57 2 Chaturvedi K, Bandari P, Chinen N & Howells RD (2001) Proteasome involvement in agonist-induced down-regulation of mu and delta opioid receptors J Biol Chem 276, 12345–12355 3 Obin MS, Jahngen-Hodge J, Nowell T & Taylor A (1996) Ubiquitinylation and ubiquitin-dependent proteolysis in vertebrate... Activation of the alpha subunit of Gs in intact cells alters its abundance, rate of degradation, and membrane avidity J Cell Biol 119, 1297–1307 42 Mullaney I, Caulfield MP, Svoboda P & Milligan G (1996) Activation, cellular redistribution and enhanced degradation of the G proteins Gq and G11 by endogenously expressed and transfected phospholipase C-coupled muscarinic m1 acetylcholine receptors Prog Brain Res... mediated by the ubiquitin ⁄ proteasome pathway Biochem J 339, 453– 461 11 Wojcikiewicz RJ, Xu Q, Webster JM, Alzayady K & Gao C (2003) Ubiquitination and proteasomal degradation of endogenous and exogenous inositol 1,4,5-trisphosphate receptors in alpha T3–1 anterior pituitary cells J Biol Chem 278, 940–947 12 Wojcikiewicz RJ (2004) Regulated ubiquitination of proteins in GPCR-initiated signaling pathways... ubiquitin ligase that interacts with RGS-GAIP Proc Natl Acad Sci USA 100, 8270–8275 47 Oh P & Schnitzer JE (2001) Segregation of heterotrimeric G proteins in cell surface microdomains: G(q) binds caveolin to concentrate in caveolae, whereas G(i) and G(s) target lipid rafts by default Mol Biol Cell 12, 685–698 48 Yamazaki J, Katoh H, Yamaguchi Y & Negishi M (2005) Two G(12) family G proteins, Galpha(12) . or maturation of the protein. An increase was also observed in the rate of degradation of the remaining mutant protein (20% left of the protein) vs. the wild type. Proteasome involvement in the degradation of the G q family of Ga subunits Bente B. Johansson, Laura Minsaas and Anna M. Aragay Department of Biomedicine,