Characterization of promoter of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity Adrian T Coyle and B Therese Kinsella Department of Biochemistry, Conway Institute of Biomolecular and Biomedical Research, University College Dublin, Belfield, Dublin, Ireland Keywords AP-1; gene expression; isoforms; Oct; promoter; splicing; thromboxane receptor Correspondence B T Kinsella, Department of Biochemistry, Conway Institute of Biomolecular and Biomedical Research, University College Dublin, Belfield, Dublin 4, Ireland Fax: +353 2837211 Tel: +353 7166727 E-mail: Therese.Kinsella@ucd.ie (Received 18 October 2004, revised December 2004, accepted 20 December 2004) doi:10.1111/j.1742-4658.2004.04538.x The TPa and TPb isoforms of the human thromboxane A2 receptor (TP) arise by differential splicing but are under the transcriptional control of two distinct promoters, termed Prm1 and Prm3, respectively (Coyle et al 2002 Eur J Biochem 269, 4058–4073) The aim of the current study was to determine the key factors regulating TPb expression by functionally characterizing Prm3, identifying the core promoter and the cis-acting elements regulating basal Prm3 activity Hence, the ability of Prm3 and a series of Prm3 deleted ⁄ mutated subfragments to direct reporter gene expression in human erythroleukemia 92.1.7 and human embryonic kidney 293 cells was investigated It was established that nucleotides )118 to +1 are critical for core Prm3 activity in both cell types Furthermore, three distinct regulatory regions comprising of an upstream repressor sequence, located between )404 to )320, and two positive regulatory regions required for efficient basal gene expression, located between )154 to )106 and )50 to +1, were identified within the core Prm3 Deletion and site-directed mutagenesis of consensus Oct-1 ⁄ and AP-1 elements within the latter )154 to )106 and )50 to +1 regions, respectively, substantially reduced Prm3 activity while mutation of both elements abolished Prm3 activity Electromobility shift and supershift assays confirmed the specificity of nuclear factor binding to the latter Oct-1 ⁄ and AP-1 elements Moreover, herein it was established that the core AP-1 element mediates phorbol myristic acid-induction of Prm3 activity hence providing a mechanistic explanation of phorbol ester up-regulation of TPb mRNA expression The prostanoid thromboxane (TX)A2 induces activation and aggregation of platelets, constriction of vascular (V) and bronchial smooth muscle (SM) and of renal mesangial cells [1–4], and may induce other diverse cellular responses including mitogenic and ⁄ or hypertrophic growth of VSM [5,6], inhibition of angiogenesis ⁄ neo-vascularization [7] and apoptosis of +⁄ CD4 ⁄ CD8+ – thymocytes [8] Alterations in the level of this potent autocoid, or of its specific synthase or its receptor (TP) are widely implicated in a variety of vascular diseases including thrombosis, unstable angina, asthma, systemic and pregnancy-induced hypertension, and glomerulonephritis [9–12] Moreover, mice deficient in the TXA2 receptor (TP– ⁄ –) display increased bleeding and altered hemodynamic properties, highlighting the essential role of TXA2 and its Abbreviations AP-1, activator protein-1; EMSA, electromobility shift assay; FBS, fetal bovine serum; HEK, human embryonic kidney; HEL, human erythroleukemia; I, intron; NT, nucleotide; PMA, phorbol myristic acid; Prm, promoter; RLU, relative luciferase units; TP, thromboxane receptor; TI, transcription initiation; TXA2, thromboxane A2; UAS, upstream activation sequence; URS, upstream repressor sequence; UTR, untranslated region 1036 FEBS Journal 272 (2005) 1036–1053 ª 2005 FEBS A T Coyle and B T Kinsella receptor in the dynamic regulation of haemostasis [13,14] As a member of the G protein coupled receptor (GPCR) superfamily, the TXA2 receptor or TP is primarily coupled to Gq-dependent activation of phospholipase (PLC) Cb isoforms [1,3] In humans, but not in nonprimates, TXA2 signals through two TP isoforms referred to as TPa and TPb that are encoded by a single TP gene located on chromosome 19p13.3 and that arise through a novel differential splicing mechanism involving retention of bifunctional intronic ⁄ exonic sequences within the TPa mRNA [15–17] TPa and TPb are identical for their N-terminal 328 amino acids but differ exclusively in their C-terminal domains [16,17] Whilst TPa and TPb mediate almost identical PLCb effector activation, they differentially couple to adenylyl cyclase via Gas and Gai, respectively [18], and TPa, but not TPb, couples to the novel high molecular weight G-protein Gh [19] TPa and TPb also undergo differential homologous (agonist-dependent) and heterologous desensitization For example, TPb, as opposed to TPa, undergoes tonic and agonist induced-internalization [20,21] On the other hand, TPa, but not TPb, undergoes inhibitory cross-talk or heterologous desensitization of its signaling in response to the potent anti-aggregatory ⁄ vasodilatory autocoids prostaglandin (PG) I2 (prostacyclin) and nitric oxide (NO) through mechanisms involving direct cAMP- and cGMPdependent protein kinase phosphorylation, respectively, of TPa within its unique C-tail domain [22,23] Hence, whilst the biological significance for the existence of two TP receptors in humans is indeed unclear, there is mounting evidence that they undergo differential signaling and regulation, strengthening the viewpoint that TPa and TPb may have distinct physiologic ⁄ pathophysiologic roles Consistent with this, TPa and TPb are also subject to differential expression and gene regulation [24,25] Whilst TPa and TPb mRNAs are coexpressed in a range of cell ⁄ tissue types of relevance to TXA2 biology, there are extensive differences in the relative levels of expression of TPa: TPb mRNA in several tissues [24] Moreover, recent studies have confirmed that TPa and TPb expression are under the genetic control of distinct promoters within the single human TP gene located on chromosome 19 [16,25] Whilst the originally identified promoter (Prm) directs TPa expression, a novel promoter (Prm3) was identified within the human TP gene that exclusively directs TPb expression [25] Similar to that of the previously characterized Prm1 and Prm2, Prm3 lacks a consensus TATA box or initiator element and, hence, the transcription factor elements directing basal Prm3activity remain to be identified [25] FEBS Journal 272 (2005) 1036–1053 ª 2005 FEBS Thromboxane A2 receptor gene expression The aim of the current study was to define the core promoter and to identify the cis-acting elements regulating basal Prm3 activity with the view to determining the key factors that regulate TPb expression in human subjects Through 5¢- and 3¢-deletion analyses it was found that the nucleotides between )118 to +1 were required for core Prm3 activity, where +1 represents the translational ATG start codon and the transcription initiation of the TPb mRNA was previously identified at )12 [25] Furthermore, three distinct regulatory regions were identified, the first of which was an upstream repressor sequence (URS) located between )404 and )320 and was found to have a repressive effect on the basal Prm3 activity in both cell types Two additional regions that positively regulate or are required for efficient basal Prm3-directed gene expression were also identified within the core Prm3 Detailed characterization of the consensus transcription factor elements within these latter sites revealed a crucial role for both an Oct-1 ⁄ and an activator protein-1 (AP-1) element in the regulation of basal Prm3 activity It is anticipated that the functional characterization of Prm3 reported herein should provide critical knowledge of the modes of regulation of TPb expression and hence may shed further insights as to the physiologic requirement for two TP receptors, namely TPa and TPb, in humans Results Functional analysis of promoter of the human TXA2 receptor (TP) gene We have previously identified a novel promoter (Prm)3 within the human TXA2 receptor (TP) gene that directs expression of TPb in HEL92.1.7 and HEK293 cells [25] A schematic of the human TP gene highlighting the positions of the previously identified Prm1, Prm2 [16,25] and the novel Prm3 [25] relative to its translational start site (ATG, designated +1) is presented in Fig In order to gain further insights into the modes of regulation of TPb, the aim of the current study was to map the minimal transcriptional unit and to identify the key regulatory elements within Prm3 directing basal gene expression The recombinant pGL3Basic encoding Prm3 directed 3.65 ± 0.23 RLU and 3.0 ± 0.25 RLU of luciferase activity in HEL (Fig 1A) and HEK293 (Fig 1C) cells, respectively, whilst the empty pGL3 Basic vector directed minimal activity in either cell type (Fig 1A,C) Progressive 5¢ deletion of Prm3 sequences in pGL3Basic to generate )975 and )404 subfragments did not significantly affect luciferase 1037 Thromboxane A2 receptor gene expression A T Coyle and B T Kinsella B A Prm1 E1 -5895 -8500 Prm2 E1b Prm3 -1979 -1394 -3308 E2 Prm1 +786 +1 +1 Luc -1394 -106 -50 +786 +1 Luc -404 +1 Luc -320 +1 Luc -154 E2 +1 +1 Luc -975 +1 Luc -320 Prm3 -1979 -1394 +1 Luc +1 Luc -404 Prm2 E1b -3308 -1394 +1 Luc -975 E1 -5895 -8500 +1 Luc -154 +1 Luc -106 +1 Luc -50 pGL3Basic +1 Luc +1 Luc +1 Luc pGL3Enhancer +1 Luc Luciferase Activity (RLU) C D Prm1 -8500 Prm2 E1b E1 -5895 Prm3 -1979 -1394 -3308 -106 -50 pGL3Basic 10 12 E2 +786 +1 +1 Luc +1 Luc -404 +1 Luc -320 +1 Luc -154 Luc -154 +1 Luc +1 Luc -320 Prm3 -1979 -1394 -975 +1 Luc -404 Prm2 E1b -3308 -1394 +1 Luc -975 E1 -5895 -8500 +786 +1 Luc -1394 Prm1 E2 +1 Luciferase Activity (RLU) +1 Luc -106 -50 +1 Luc Luc +1 Luc pGL3Enhancer +1 Luc +1 Luc Luciferase Activity (RLU) 10 15 20 25 Luciferase Activity (RLU) Fig Effect of 5¢-deletion mutagenesis on Prm3-directed luciferase expression (A–D) A schematic figure of the human TP genomic region spanning nucleotides )8500 to +786 encoding promoter (Prm) 1, Prm2 and Prm3, in addition to exon (E) 1, E1b and E2, which are illustrated above each panel Nucleotide +1 corresponds to the translational start site (ATG) and nucleotides 5¢ of that site are given a – designation DNA fragments corresponding to Prm3 ()1394 to +1) and its successive deletion fragments Prm3b ()975 to +1), Prm3a ()404 to +1), Prm3ab ()320 to +1), Prm3aa ()154 to +1), Prm3aab ()106 to +1) and 3aaa ()50 to +1) were subcloned into pGL3Basic (A and C) or pGL3Enhancer (B and D) Resulting recombinant plasmids or, as controls, pGL2Basic ⁄ pGL3Enhancer empty vectors were cotransfected with pRL-TK into HEL92.1.7 (A and B) and HEK293 (C and D) cells Firefly and renilla luciferase activity was assayed 48 h post-transfection; results are presented as mean firefly relative to renilla luciferase activity, expressed in arbitrary relative luciferase units (RLU ± SEM; n ¼ 5) expression in either HEL (Fig 1A) or HEK293 (Fig 1C) cells Similarly, whilst the overall levels of Prm3-luciferase activity directed by the pGL3Enhancer plasmids, containing an SV40 enhancer element downstream of the luciferase gene, were generally two- to three-fold higher than by the equivalent pGL3Basic plasmids in both HEL (7.57 ± 0.53 RLU; Fig 1B) and HEK (9.60 ± 0.41 RLU; Fig 1D) cells, there was no significant difference in luciferase expression directed by the corresponding )1394, )975 or )404 fragments cloned into pGL3Enhancer in either HEL (Fig 1C) or HEK293 (Fig 1D) cells Moreover, the empty pGL3Enhancer vector yielded minimal luciferase activity in either cell type (Fig 1B,D) Hence, deletion of sequences between )1394 and )404 of Prm3 does not affect Prm3-directed basal gene expression 1038 However, further 5¢ deletion of Prm3 from a )404 bp to a )320 bp fragment expressed in either pGL3Basic or pGL3Enhancer yielded approximately two-fold increases in luciferase activity in both HEL (Fig 1A,B) and HEK293 (Fig 1C,D) cells Moreover, further 5¢ deletion of the )320 bp to a )154 bp fragment did not significantly affect the level of luciferase expression in either pGL3Basic or pGL3Enhancer vectors expressed in either HEL (Fig 1A,B) or in HEK293 (Fig 1C,D) cells Hence, deletion of nucleotides between )404 and )320 removes a gene segment that has a repressive effect on Prm3 activity in both HEL and HEK293 cells whilst further deletion of nucleotides between )320 and )154 had no additional effect on luciferase expression in either cell type Further 5¢ deletion of nucleotides )154 to )106 resulted in between two- and eight-fold decreases in FEBS Journal 272 (2005) 1036–1053 ª 2005 FEBS A T Coyle and B T Kinsella Thromboxane A2 receptor gene expression luciferase expression in HEL (Fig 1A,B) and HEK293 (Fig 1C,D) cells indicating that the )154 to )106 sequence contains positive regulatory element(s) required for efficient basal Prm3 activity Moreover, 5¢ deletion of the )106 bp to a )50 bp fragment did not further reduce the level of luciferase expression in either pGL3Basic or pGL3Enhancer plasmids in either HEL (Fig 1A,B) or in HEK293 (Fig 1C,D) cells It was noteworthy that plasmids containing the )50 to +1 bp subfragment of Prm3 retained low though significant promoter activity relative to the empty pGL3Basic (P £ 0.05) and pGL3Enhancer (P £ 0.05) vectors, respectively, when expressed in both HEL (Fig 1A,B) and HEK293 (Fig 1C,D) cells Hence, these data suggest that Prm3 contains positive regulatory DNA sequences between )50 and +1 in addition to sequences between )154 and )106 required for efficient basal Prm3 activity To test this hypothesis, 3¢ deletion of nucleotides )118 to +1 abolished Prm3-directed luciferase activity when expressed in HEL cells (Fig 2A,B) such that the level of luciferase activity directed by the respective recombinant plasmids was not substantially different from that of the corresponding empty pGL3Basic (compare 0.35 ± 0.08 RLU vs 0.11 ± 0.03 RLU) or pGL3Enhancer (compare 0.84 ± 0.11 RLU vs 0.32 ± 0.01 RLU) vectors Similar data were observed in HEK293 cells (data not shown) Moreover, the possible requirement for regulatory DNA sequences 3¢ of the +1 translational start site was investigated by A -1394 -404 comparing luciferase activity of the previously characterized )404 to +1 fragment to that of a )404 to +119 fragment, containing an additional 119 bp of TP genomic sequence downstream of the translational start site (Fig 2A,B) However, the level of )404 to + 119 directed luciferase activity was not significantly different from that of the Prm3-directed luciferase activity (e.g )404 to +1) expressed in HEL cells irrespective of whether recombinant pGL3Basic (Fig 2A) or pGL3Enhancer (Fig 2B) based-vectors were used Similar data were observed in HEK293 cells (data not shown) In summary, we have identified three regulatory regions within Prm3 that contribute to basal promoter activity, one that negatively ()404 to )320) regulates the action of Prm3 while two of which positively ()154 to )106, )50 to +1) regulate basal Prm3 activity Moreover, we have confirmed that nucleotides )118 to +1 are essential for the core Prm3 Identification of a functional Oct-1 ⁄ element within promoter In order to further localize and identify the positive regulatory element(s) positioned between )154 to )106 of Prm3, additional 5¢ deletions were generated in pGL3Basic Successive 5¢ deletion of nucleotides between )154 and )119 did not significantly affect the level of luciferase activity in HEL cells (Fig 3A) suggesting that the latter gene segment is not required for efficient basal Prm3 activity In contrast, further 5¢ -118 +1 + 119 +786 E2 +1 Luc -118 Luc +119 Luc 10 Luciferase Activity (RLU) B -1394 -404 -118 +1 +1 19 +786 E2 +1 Luc **** FEBS Journal 272 (2005) 1036–1053 ª 2005 FEBS **** **** **** Fig Localization of the core Prm3 by 5¢- and 3¢-deletion analysis (A and B) The TP genomic region spanning nucleotides )1394 to +786, and encoding Prm3 ()1394 to +1) in addition to exon (E) 2, is illustrated above each panel Recombinant pGL3Basic (A) or pGL3Enhancer (B) plasmids encoding Prm3a ()404 to +1), Prm3f ()404 to )118) and Prm3e ()404 to +119) were cotransfected with pRL-TK into HEL92.1.7 cells Firefly and renilla luciferase activity was assayed 48 h post-transfection; mean firefly relative to renilla luciferase activity are expressed in arbitrary relative luciferase units (RLU ± SEM; n ¼ 5) The asterisks (*) indicate that the level of Prm3f-directed luciferase activity was significantly reduced relative to Prm3a-directed luciferase expression, where ****P £ 0.0001 -118 Luc +119 Luc Luciferase Activity (RLU) 1039 Thromboxane A2 receptor gene expression A Oct1 (-123) Oct1 /2 (-105) A T Coyle and B T Kinsella AP-1 (-27) +1 -1394 -154 +1 Luc -140 +1 Luc -119 -106 +1 Luc +1 Luc Luciferase Activity (RLU) B Oct1 (-123) AP-1 Oct1 /2 (-27) (-105) +1 -1394 +1 Luc -404 +1 Luc -404 +1 Luc +1 Luc -320 +1 Luc -320 +1 Luc **** -320 **** **** **** **** **** -404 Luciferase Activity (RLU) deletion of a 13 bp gene segment between )119 and )106 led to a 2.5-fold decrease in luciferase expression (Fig 3A), confirming that this sequence contains positive regulatory element(s) required for basal Prm3 activity Bioinformatic analysis of Prm3, using the matinspectorTM program [26], for transcription factor elements between )154 and )106 identified three consensus transcription factor binding sites including a putative Oct-1 site centered at )123, a Oct-1 ⁄ site at )105 and an adjacent AP-1 element at )27 (Fig 3) Hence, to investigate the role of these elements in regulating basal Prm3 activity, site-directed mutagenesis was used to disrupt the putative Oct elements located between )154 and )106 (Fig 3B) Mutation of the consensus Oct-1 site (GCATTTCA to GCTTCCCA) had no effect on luciferase activity directed by the )404 or )320 subfragments of Prm3 suggesting that the putative Oct-1 site centered at )123 is not required for basal Prm3 activity (Fig 3B) Conversely, mutation of the consensus Oct-1 ⁄ site (AAGCAAAT to AAGCAAGT) centered at )105 significantly reduced 1040 Fig Identification of a functional Oct-1 ⁄ site within Prm3 (A and B) Scheme of the TP genomic region spanning Prm3 ()1394 to +1) in addition to the relative positions of putative Oct-1, Oct-1 ⁄ and AP-1 elements is illustrated above each panel Recombinant pGL3Basic plasmids encoding Prm3aa ()154 to +1), Prm3ax ()140 to +1), Prm3ac ()119 to +1) and Prm3aab ()330 to +1) (A) or Prm3a ()404 to +1) or Prm3ab ()320 to +1) and their site-directed variants Prm3aOct-1* and Prm3abOct-1*, Prm3aOct-1 ⁄ 2* and Prm3aOct-1 ⁄ 2* (B) were cotransfected with pRL-TK into HEL92.1.7 Firefly and renilla luciferase activity was assayed 48 h posttransfection; mean firefly relative to renilla luciferase activity are expressed in arbitrary relative luciferase units (RLU ± SEM; n ¼ 5) The star symbol indicates mutated transcription factor elements The asterisks (*) indicate that either deletion or site-directed mutagenesis of Prm3 sequences significantly reduced luciferase expression in HEL cells, where **** indicates P £ 0.0001 luciferase activity directed by the )404 and )320 subfragments of Prm3 approximately 2.5- to threefold (Fig 3B) Hence, these data suggest that the latter putative Oct-1 ⁄ element at )105 may be critical for basal Prm3 activity in HEL cells Similar data were observed in HEK293 cells (data not shown) To confirm the presence of nuclear ⁄ transcription factors capable of binding to the latter Oct-1 ⁄ site centered at )105, electromobility shift assays (EMSAs) were carried out using a radiolabeled double-stranded DNA probe spanning nucleotides )115 to )92 (Oct1 ⁄ 2WT; Kin195) and nuclear extract prepared from HEL cells Incubation of the radiolabeled Oct-1 ⁄ 2WT probe with HEL nuclear extract resulted in the appearance of a single-labeled DNA–protein band (Fig 4A, lane 2) that was efficiently inhibited by an excess of the corresponding nonlabeled double-stranded Oct1 ⁄ 2WT oligonucleotide (Fig 4A, lane 3) or by a double-stranded oligonucleotide containing a recognized consensus Oct-1 ⁄ (Fig 4A, lane 5) The specificity of nuclear factor binding to the latter Oct-1 ⁄ site was also verified by the failure of excess double-stranded FEBS Journal 272 (2005) 1036–1053 ª 2005 FEBS A T Coyle and B T Kinsella A Thromboxane A2 receptor gene expression B C D E Fig Demonstration of nuclear factor binding to an Oct-1 ⁄ Site within Prm3 A 32P-labeled double-stranded Oct-1 ⁄ 2WT DNA probe (Kin195 and its complement corresponding to nucleotides )115 to )92 of Prm3) was used in EMSAs (A) or in supershift assays (B) using nuclear extracts from HEL92.1.7 cells (A) 32P-labeled Oct-1 ⁄ 2WT probe was incubated: without nuclear extract (lane 1); with nuclear extract alone (lane 2); with nuclear extract in the presence of excess nonlabeled double-stranded specific competitor Oct-1 ⁄ 2WT oligonucleotide (Kin195 and its complement, lane 3); with nuclear extract in the presence of excess nonlabeled double-stranded noncompetitor Oct-1 ⁄ 2* oligonucleotide (Kin193 and its complement, lane 4); with nuclear extract in the presence of excess nonlabeled double-stranded consensus Oct-1 ⁄ oligonucleotide (Kin340 and its complement, lane 5); with nuclear extract in the presence of excess nonlabeled double-stranded Ap-1 noncompetitor oligonucleotide (Kin189 and its complement, lane 6) (B) 32P-labeled Oct-1 ⁄ 2WT probe was incubated without nuclear extract (lane 1); with nuclear extract alone (lane 2); with nuclear extract preincubated for 30 with anti-(Oct-1) IgG (sc-232x; lane 3); with nuclear extract preincubated for 30 with anti-(Oct-1) IgG in the presence of excess nonlabeled double-stranded consensus Oct-1 ⁄ 2WT oligonucleotide (Kin340 and its complement, lane 4); with nuclear extract preincubated for 30 with anti-(Oct-2) IgG (sc-233x; lane 5); with nuclear extract preincubated for 30 with anti-(Oct-2) IgG in the presence of excess nonlabeled double-stranded consensus Oct-1 ⁄ 2* oligonucleotide (Kin340 and its complement, lane 6) The arrow indicates the supershifted transcription factor: DNA complex detected in the presence of the anti-(Oct-2) IgG (lane 5) DNA–protein complexes were subject to PAGE followed by autoradiography, as outlined (C and D) Western blot analysis of Oct-1 (C) and Oct-2 (D) expression in whole cell protein (60 lgỈ lane)1) prepared from HEL (C and D; lane 1) and HEK293 (C and D; lane 2) cells The positions of the molecular size markers (kDa) are indicated to the left and right of the (C) and (D), respectively, whilst the position of the Oct-1 (98 kDa approximately) and the two major forms of Oct-2 (75–80 and 55–60 kDa) detected in HEK293 and HEL cells, respectively, are indicated by arrows in (C) and (D) (E) To investigate the effect of Oct-1 or Oct-2 on Prm3-directed luciferase gene expression, HEK293 cells were transiently cotransfected with pGL3b:Prm3ab plus pRL TK in the presence of pcDNA3: HaOct-1 (Oct-1), pcDNA3:HaOct-2 (Oct-2) or, as a control, with pcDNA3 (Control) Firefly and renilla luciferase activity was assayed 48 h post-transfection; mean firefly relative to renilla luciferase activity are expressed in arbitrary relative luciferase units (RLU ± SEM; n ¼ 6) The asterisks (*) indicate that over-expression of Oct-1 and Oct-2 significantly increased Prm3ab-directed luciferase expression in HEK293 cells, where * and ** indicate P £ 0.05 and 0.01, respectively oligonucleotides containing a mutated Oct-1 ⁄ 2* sequence (Kin193) or an AP-1 consensus sequence to effectively inhibit nuclear factor- DNA complex FEBS Journal 272 (2005) 1036–1053 ª 2005 FEBS formation (Fig 4A, lanes and 6, respectively) Western blot analysis of whole cell lysates confirmed the presence of Oct-2, but not Oct-1, in HEL cells 1041 Thromboxane A2 receptor gene expression (Fig 4C,D, lane 1) while Oct-1, but not Oct-2, expression was readily detected in HEK293 cells (Fig 4C,D, lane 2) Moreover, electromobility supershift assays employing anti-Oct selective antibodies demonstrated the direct binding of Oct-2, but not Oct-1, to the Oct-1 ⁄ element of Prm3 within HEL cells (Fig 4B, lane 5) Oct nuclear factor–DNA complexes (Fig 4B, lanes and 6) and anti-Oct-2 supershifted complexes (Fig 4B, lane 6) were efficiently competed by an excess of a non-labeled doublestranded oligonucleotide containing a consensus Oct1 ⁄ site Failure to observe an anti Oct-1 supershift is consistent with the absence of Oct-1 in HEL cells but did not exclude the possibility that Oct-1 may regulate Prm3 activity in cell types where Oct-1 is abundantly expressed Consistent with this, heterologous over-expression of both Oct-1 and Oct-2 significantly increased Prm3-directed luciferase activity in HEK293 (Fig 4E) and HEL (data not shown) cells Hence, we have identified a consensus Oct-1 ⁄ transcription factor site centered at )105 that is critical for efficient basal Prm3-directed gene expression and have confirmed the ability of both Oct-1 and Oct-2 to bind and regulate Prm3-directed gene expression Identification of a functional AP-1 element within promoter To further investigate the positive regulatory element(s) located between )50 to +1 of Prm3 that directs low, though significant, luciferase activity in both HEL and HEK293 cells (Fig 1), matinspectorTM analysis [26] of Prm3 revealed the presence of a high consensus AP-1 element centered at )27 (Fig 4) located some 15 bp 5¢ of the previously identified transcription initiation site within the TPb mRNA [25] Hence, to ascertain the functional role of this AP-1 site in mediating basal Prm3 activity, its consensus core sequence was disrupted by site directed mutagenesis (GTGACT to GATCCT) in a range of 5¢-deletion subfragments and the ability of the mutated AP-1 (AP-1*) relative to the AP-1WT Prm3 subfragments to direct luciferase activity in HEL (Fig 5A,B) and HEK293 (Fig 5C,D) cells was investigated Following transfection into HEL cells, in general the 5¢-deletion fragments containing the mutated AP-1* site yielded approximately 2.5-fold reductions in luciferase activity relative to that of the corresponding subfragments containing an intact AP-1 site in either pGL3Basic (Fig 5A) or pGL3Enhancer (Fig 5B) Consistent with this, mutation of the AP-1* element within the smallest )50 bp fragment almost abolished luciferase 1042 A T Coyle and B T Kinsella activity indicating an essential role for the AP-1 element in mediating basal Prm3 gene expression Similarly, transfection of HEK293 cells with the various 5¢-deletion fragments containing the mutated AP-1* site yielded between four- and five-fold reductions in luciferase activity relative to that of the corresponding subfragments containing an intact AP-1 site in either pGL3Basic (Fig 5C) or pGL3Enhancer (Fig 5D) whilst mutation of the AP-1* element within the smallest )50 bp fragment almost completely abolished luciferase activity also, similar to that observed in HEL cells Hence, whilst disruption of the AP-1 element centered at )27 significantly reduces basal Prm3 activity and this effect appears to be independent of the presence or absence of the previously identified negative regulatory element located between )404 and )320 in either cell type, Prm3directed gene expression shows a greater sensitivity to AP-1 disruption in HEK293 cells than in HEL cells Moreover, the absence of any discernable Prm3 activity directed by the )50 bp subfragment containing the AP-1* mutation confirms that there are no other regulatory elements within the )50 to +1 bp region required for basal Prm3 activity To confirm the presence of nuclear ⁄ transcription factors capable of binding to the latter AP-1 site centered at )27, EMSAs were carried out using a radiolabeled double-stranded oligonucleotide probe spanning nucleotides )32 to )10 (AP-1WT) of Prm3 and nuclear extracts prepared from HEL92.1.7 cells Incubation of the radiolabeled AP-1WT probe (Kin189; Fig 6) with HEL nuclear extract resulted in the formation of a single radiolabeled nuclear factor–DNA complex (Fig 6, lane 2) that was efficiently competed by an excess of the corresponding nonlabeled doublestranded AP-1WT oligonucleotide (Fig 6, lane 3) or by a double-stranded oligonucleotide containing a recognized consensus AP-1 sequence (Fig 6, lane 5) The specificity of nuclear factor binding to the radiolabeled AP-1WT probe was further confirmed by the failure of both a double-stranded oligonucleotide spanning nucleotides )32 to )10 but containing a mutated AP-1* site (Kin162; Fig 6, lane 4) and a double-stranded oligonucleotide based on the previously identified Oct-1 ⁄ (Oct-1 ⁄ 2WT, Kin195, Fig 6, lane 6) to interfere with nuclear factor: DNA complex formation Similar data were generated in HEK293 cells (data not shown) Hence, we have identified a consensus AP-1 transcription factor site centered at )27 that is critical for efficient basal Prm3-directed gene expression and have confirmed the presence and specificity of nuclear factors in HEL and HEK293 cells that specifically bind to the latter AP-1 site FEBS Journal 272 (2005) 1036–1053 ª 2005 FEBS A T Coyle and B T Kinsella Thromboxane A2 receptor gene expression A B AP-1 -1394 Promoter AP-1 A +1 +786 -1394 E2 +786 E2 +1 Luc +1 Luc *** +1 Luc +1 Luc -404 +1 Luc ** -404 *** +1 Luc -404 +1 -1394 +1 Luc -404 -1394 +1 Luc -1394 - *** -1394 P Promoter +1 Luc +1 Luc +1 Luc +1 Luc -154 -50 +1 Luc +1 Luc +1 Luc -50 +1 Luc ** ** +1 Luc -50 *** -50 **** +1 Luc -154 +1 Luc -154 *** -154 **** +1 Luc -320 -320 -320 *** -320 Luciferase Activity (RLU) C 10 12 D AP-1 +1 Promoter Luciferase Activity (RLU) AP-1 -1394 +786 -1394 E2 -1394 +1 Luc -1394 +1 Luc -1394 +1 Luc **** +1 Luc +786 E2 *** -1394 +1 Promoter -404 +1 Luc +1 Luc -154 +1 Luc +1 Luc -154 +1 Luc -154 +1 Luc +1 Luc -50 +1 Luc -50 +1 Luc **** **** -50 +1 Luc *** *** *** -50 +1 Luc **** **** +1 Luc -320 -320 **** -154 +1 Luc **** **** -320 +1 Luc -404 Luc **** -320 -404 **** +1 Luc **** -404 Luciferase Activity (RLU) 10 15 20 Luciferase Activity (RLU) Fig Identification of a functional AP-1 element within Prm3 (A–D) The TP genomic region spanning nucleotides )1394 to +786 encoding Prm3 ()1394 to +1), a putative AP-1 element in addition to exon (E) are illustrated above each panel Recombinant pGL3Basic (A and C) or pGL3Enhancer (B and D) plasmids encoding Prm3 ()1394 to +1), Prm3a ()404 to +1), Prm3ab ()320 to +1), Prm3aa ()154 to +1), Prm3aaa ()50 to +1) or their respective site-directed variants Prm3AP)1*, Prm3aAP)1*, Prm3abAP)1*, Prm3aaAP)1* and Prm3aaaAP)1*, where the AP-1 element centered at )27 was mutated, were cotransfected with pRL-TK into HEL92.1.7 (A and B) and HEK293 (C and D) cells Firefly and renilla luciferase activity was assayed 48 h post-transfection; results are presented as mean firefly relative to renilla luciferase activity, expressed in arbitrary relative luciferase units (RLU ± SEM; n ¼ 5) The asterisks (*) indicate that mutation of the AP-1 element significantly reduced Prm3-directed luciferase activity in HEL and HEK293 cells, where *, **, ***, **** indicate P £ 0.05, P £ 0.02, P £ 0.001, P £ 0.0001, respectively Examination of the coordinate regulation of promoter basal activity by the AP-1 and Oct-1/2 transcription factors To determine the combined contribution of the AP-1 and Oct-1 ⁄ cis-acting elements in directing basal Prm3 activity, the effect of collectively mutating the FEBS Journal 272 (2005) 1036–1053 ª 2005 FEBS latter sites (AP-1*, Oct-1 ⁄ 2*) within the )320 bp Prm3 subfragment subcloned into pGL3Basic (Fig 7A) or pGL3Enhancer (Fig 7B) on luciferase activity was compared to the corresponding subfragment containing the wild-type AP-1 and Oct-1 ⁄ elements Following transfection into HEL92.1.7 cells, recombinant pGL3Basic (Fig 7A) or pGL3Enhancer 1043 Thromboxane A2 receptor gene expression A T Coyle and B T Kinsella level of luciferase activity directed by the AP-1*, Oct-1 ⁄ 2* subfragment in either pGL3Basic or pGL3 Enhancer was not substantially greater than that level found in cells transfected with the equivalent promoter-less empty vectors (Fig 7A,B) Similar data were generated in HEK293 cells (data not shown) These data strongly indicate that the Oct-1 ⁄ and AP-1 elements independently regulate Prm3 activity and that disruption of both sites obliterates basal Prm3 activity Investigation of the role of the AP-1 site at -27 in phorbol myristic acid (PMA) induction of promoter Fig Demonstration of nuclear factor binding to a putative AP-1 element within Prm3 by electromobility shift assay A 32P-labeled double-stranded AP-1WT DNA probe (Kin189 and its complement) was used in electromobility shift assays (EMSAs) using nuclear extracts prepared from HEL92.1.7 cells 32P-labeled AP-1WT probe was incubated: without nuclear extract (lane 1); with nuclear extract (lane 2); with nuclear extract in the presence of excess of nonlabeled specific double-stranded competitor AP-1WT oligonucleotide (Kin189 and its complement; lane 3); with nuclear extract in the presence of excess nonlabeled double-stranded AP-1* noncompetitor oligonucleotide (Kin162 and its complement where the putative AP-1 element centered at )27 was mutated, lane 4); with nuclear extract in the presence of excess nonlabeled consensus doublestranded AP-1 oligonucleotide (Kin338 and its complement, lane 5); with nuclear extract in the presence of excess nonlabeled doublestranded Oct-1 ⁄ noncompetitor oligonucleotide (Kin195 and its complement, lane 6) DNA–protein complexes were subject to PAGE followed by autoradiography, as outlined in Experimental procedures (Fig 7B) plasmids containing these mutations resulted in a complete loss in Prm3-directed luciferase expression More specifically, there was a 10- to 16-fold reduction in luciferase activity directed by the Prm3 subfragment containing the mutated AP-1*, Oct-1 ⁄ 2* sites relative to the corresponding subfragments containing the wild-type sequences in either pGL3Basic (Fig 7A) or pGL3Enhancer (Fig 7B) In fact, the 1044 Previous studies have shown that TPb mRNA and Prm3-directed luciferase activity in HEL92.1.7 cells is up-regulated in response to phorbol myristic acid (PMA) [25] Moreover, AP-1 elements have a well-established role in the transduction of PMAmediated gene expression and mitotic signaling in a number of cell models [27] Hence, in the current study, we examined the effect of PMA on luciferase expression directed by Prm3 containing either the wild-type AP-1 element or its mutated AP-1* equivalent Following transfection into HEL92.1.7 cells, consistent with previous data, Prm3 containing the mutated AP-1* site yielded approximately 2.0-fold reductions in basal luciferase activity relative to that of the corresponding Prm3 subfragments containing the wild-type AP-1 sequence in pGL3Basic (Fig 8A) Whilst preincubation of cells with PMA (100 nm, 16 h) yielded a 1.5-fold increase in Prm3 directedluciferase activity, PMA did not significantly increase luciferase activity directed by Prm3 subfragments containing the AP-1* mutation Moreover, preincubation of HEL cells with PMA resulted in a 2.3-fold increase in nuclear factor binding to the consensus AP-1 element centered at )27 within Prm3 relative to vehicle-treated cells, as determined in EMSAs (Fig 8B) Nuclear factor–DNA complex formation was efficiently competed by an excess of a doublestranded oligonucleotide containing a consensus AP-1 site, regardless of preincubation of cells with PMA or not (Fig 8B) Hence, to conclude, Prm3 contains an AP-1 and Oct-1 ⁄ element centered at )27 and )105 within the core promoter, respectively, that are critical for basal Prm3 activity and the AP-1 element mediates PMA-induction of Prm3 expression In addition, we have identified the presence of a negative regulatory region between )404 and )320 upstream of the core promoter that acts as an upstream repressor sequence FEBS Journal 272 (2005) 1036–1053 ª 2005 FEBS A T Coyle and B T Kinsella Thromboxane A2 receptor gene expression A -1394 -404 -320 -320 +1 Luc -320 +1 Luc **** pGL3Basic +1 Luc Luciferase Activity (RLU) B -1394 -404 -320 Oct (-123) AP-1 Oct 1/2 (-27) (-105) +1 -320 +1 Luc -320 +1 Luc Discussion In humans, TXA2 signals through two receptor isoforms termed TPa and TPb Although the physiologic requirement for two TXA2 receptors in humans is unclear, alterations in TP expression are implicated in a range of vascular diseases [9–12] Whether TPa and ⁄ or TPb independently or differentially contribute to those disease processes in human subjects is currently unknown but in view of the extensive differences between the TP isoforms in terms of their mechanisms of signaling [18,19], modes of regulation ⁄ desensitization [20–23] and patterns of expression [24], this represents a question of potentially immense importance The fact that TPa and TPb are differentially expressed and are under the transcriptional control of two distinct promoters, Prm1 and Prm3, respectively [25], greatly adds to the complexity of TXA2 signaling and provides an additional critical mechanism whereby the effects of TXA2 can be modulated in an isoform and ⁄ or cell ⁄ tissue specific manner The overall aim of the current study was to carry out a detailed functional characterization of Prm3, identifying the cis-acting elements regulating basal Prm3 activity with a view to defining the key factors that direct TPb expression under normal cellular conditions Similar to that of the previously characterized Prm1, Prm3 belongs to the class of TATA-less promoters FEBS Journal 272 (2005) 1036–1053 ª 2005 FEBS **** Fig Effect of mutation of the Oct-1 ⁄ and AP-1 sites on Prm3-directed luciferase expression (A and B) The TP genomic region spanning Prm3 ()1394 to +1) in addition to the relative positions of putative Oct1, Oct-1 ⁄ and AP-1 elements are illustrated above each panel Recombinant pGL3Basic (A) or pGL3Enhancer (B) plasmids encoding Prm3ab ()320 to +1) or its respective sitedirected variant Prm3abOct1 ⁄ 2*,AP)1*, where both the Oct-1 ⁄ and AP-1 elements centered at )105 and )27 of Prm3, respectively, was disrupted by site-directed mutagenesis were cotransfected with pRL-TK into HEL92.1.7 Firefly and renilla luciferase activity was assayed 48 h posttransfection; results are presented as mean firefly relative to renilla luciferase activity, expressed in arbitrary relative luciferase units (RLU ± SEM; n ¼ 5) The asterisks (*) indicate that either deletion or site-directed mutagenesis of Prm3 sequences significantly reduced luciferase expression in HEL cells, where **** indicates P £ 0.0001 Oct (-123) AP-1 Oct 1/2 (-27) (-105) +1 pGL3Enhancer +1 Luc 10 12 Luciferase Activity (RLU) [16,25] In TATA-less promoters, assembly of the preinitiation complex relies on binding of multiple general transcription factors, such as SP-1, in proximity to the transcription initiation site [28] Herein, successive 5¢-deletion of Prm3 to either 106 bp ()106 to +1) or 50 bp ()50 to +1) yielded a subfragment that retained a significant, albeit reduced, ability to direct reporter gene expression in both HEL and HEK293 cells whilst deletion of the 3¢-terminal 118 bp of Prm3 ()118 to +1) led to a complete loss of promoter activity in both cell types Collectively these data established that the critical core element(s) are located within the )118 to +1 region of Prm3 Upstream activation sequences (UAS) and upstream repressor sequences (URS) are gene-specific sequences controlling the rate of transcription initiation [29] Negative regulatory elements in particular have been identified in a number of TATA-less promoters [30,31] Consistent with this, successive 5¢-deletion of nucleotides between )404 and )320 removed a URS that has a repressive effect (two-fold) on Prm3 activity in both HEL and HEK293 cells Further deletion of nucleotides between )320 and )154 had no additional effect in either cell type suggesting that )320 to )154 region does not contribute to basal Prm3 activity The identity of the transcription factors element(s) regulating the URS is unknown but will be a subject of further characterization of Prm3 1045 Thromboxane A2 receptor gene expression A T Coyle and B T Kinsella A AP-1 +1 -1394 +786 E2 Luc -1394 ** -1394 +1 Luc Vehicle PMA +1 -404 *** -404 +1 Luc Luc Luciferase Activity (RLU) B Fig Effect of PMA on Prm3-directed luciferase expression and nuclear factor binding (A) The TP genomic region spanning nucleotides )1394 to +786 encoding Prm3 ()1394 to +1) in addition to an AP-1 element and exon (E) are illustrated above the panel Recombinant pGL3Basic plasmids encoding Prm3 ()1394 to +1), Prm3a ()404 to +1) or their respective site-directed variants Prm3AP)1* Prm3aAP)1*, where the AP-1 element centered at )27 of Prm3 was mutated, were cotransfected with pRL-TK into HEL92.1.7 cells Thirty-six hours posttransfection, cells were incubated with either 100 nM PMA or the vehicle (0.1% dimethylsulfoxide) for 16 h Thereafter, firefly and renilla luciferase activity was assayed; results are presented as mean firefly relative to renilla luciferase activity, expressed in arbitrary relative luciferase units (RLU ± SEM; n ¼ 4) The asterisks (*) indicate that luciferase expression in HEL cells was significantly altered in PMAtreated cells relative to vehicle treated cells, where **, *** indicates P £ 0.02, P £ 0.001, respectively (B) A 32P-labeled double-stranded AP-1WT DNA probe (Kin189 and its complement) was used in EMSAs using nuclear extracts prepared from vehicle- (lanes 2–4) or PMA(lanes 5–7) treated HEL92.1.7 cells 32P-labeled AP-1WT probe was incubated: without nuclear extract (lane 1); with nuclear extract (lanes and 5); with nuclear extract in the presence of excess nonlabeled consensus double-stranded AP-1 oligonucleotide (Kin338 and its complement, lanes and 5); with nuclear extract in the presence of excess nonlabeled double-stranded AP-1*noncompetitor oligonucleotide (Kin162 and its complement where the AP-1 sequence centered at )27 was mutated, lanes and 6) DNA–protein complexes were subject to PAGE followed by autoradiography, as outlined in Experimental procedures The octamer sequence element (consensus 5¢-ATGC AAAT-3¢) present in promoters of immunoglobulin and numerous ubiquitously expressed genes [32–35] can facilitate functional preinitiation complex assembly [36] Amongst the key members, Oct-1 is ubiquitous [37,38] while Oct-2 is mainly expressed in B lymphocytes, neuronal cells [39–42], and in megakaryocytes [43,44] In the current study, 5¢-deletion of nucleotides )154 to )106 within Prm3 yielded two to eightfold reductions in luciferase expression in HEL and HEK293 cells indicating that the latter region contains positive regulatory element(s) required for efficient 1046 basal Prm3 activity Whilst successive 5¢-deletion of nucleotides between )154 and )119 did not significantly affect luciferase expression, further 5¢-deletion of the 13 bp gene segment between )119 and )106 led to a 2.5-fold decrease in luciferase expression confirming that this sequence contains the positive regulatory elements Bioinformatic analysis revealed the presence of a putative Oct-1 site centered at )123 and an adjacent Oct-1 ⁄ element at )105 within this sequence Whilst the putative Oct-1 site at )154 does not closely resemble a consensus octamer element, its complementary sequence (5¢-TGAAATGC-3¢) shows some homology FEBS Journal 272 (2005) 1036–1053 ª 2005 FEBS A T Coyle and B T Kinsella to known Oct elements, for example to that of the bovine alpha s2-casein gene [45], and hence was predicted by the matinspector program [26] to potentially serve as an Oct element While deletion or mutation of the former Oct-1 site at )154 did not affect Prm3 activity, site-directed mutagenesis of the putative Oct1 ⁄ site at )105 resulted in 2.5- to three-fold reductions in luciferase expression in both HEL and HEK293 cells Hence, these data indicate that the Oct1 ⁄ element at )105 may be critical for basal Prm3 activity Noteworthy, our mutagenesis data are in full agreement with previous studies demonstrating the critical role of adenosine (A) at position within the octamer motif (AAGCAAAT to AAGCAAGT) whereby an A ⁄ G mutation severely affected Oct-1 or Oct-2 binding in vitro [46] Furthermore, EMSAs confirmed the presence of transcription factors capable of binding to a doublestranded DNA probe ()115 to )92; Oct-1 ⁄ 2WT) spanning the Oct-1 ⁄ site at )105 in nuclear extracts from HEL92.1.7 cells Nuclear factor ⁄ DNA complex formation was efficiently competed by an excess of the corresponding nonlabeled double-stranded Oct-1 ⁄ 2WT oligonucleotide but was not competed by the equivalent double-stranded oligonucleotide harboring the A ⁄ G mutation within the core Oct-1 ⁄ 2* site Western blot analysis confirmed abundant expression of Oct-2, but not Oct-1, in HEL cells and supershift assays employing anti-(Oct-2) IgG further confirmed Oct-2 binding to the Oct-1 ⁄ site of Prm3 Owing to the absence of Oct-1 expression in HEL cells, these data did not rule out the possibility that Oct-1 may regulate Prm3-directed gene expression in other cell types, such as in HEK293 cells where it is abundantly expressed Consistent with this, heterologous over-expression of both Oct-1 and Oct-2 significantly increased Prm3directed luciferase activity in HEK293 and HEL cells Hence, it is evident that Oct-2 can function as a transacting element capable of regulating Prm3 and TPb expression in megakaryocytic HEL92.1.7 cells In addition Oct-1 can also regulate Prm3 activity in other cell types, such as HEK293 cells, where Oct-1 is also abundantly expressed The AP-1 transcription factor complex participates in the control of cellular responses to stimuli that regulate proliferation, differentiation, immunity, cell death and stress but may also play a critical role in the assembly of the preinitiation complex within TATA-less promoters [47] The AP-1 complex is comprised of a group of proteins encoded by the jun (c-Jun, JunB, JunD) and fos (c-Fos, FosB, Fra1 and Fra2) gene families which can bind the AP-1 consensus sequence either as homo- or heterodimers [27] In FEBS Journal 272 (2005) 1036–1053 ª 2005 FEBS Thromboxane A2 receptor gene expression the current study, the role of the consensus AP-1 site, located at )27, in mediating basal Prm3 activity was investigated by mutating its core sequence (GTGACT to GATCCT) in a range of 5¢-deletion subfragments of Prm3 site In general, Prm3 subfragments harboring the mutated AP-1* site yielded approximately 2.5to five-fold reductions in luciferase activity in HEL and HEK293 cells relative to corresponding subfragments containing the intact AP-1 element whilst mutation of the AP-1* element within the smallest )50 bp fragment practically abolished luciferase activity The ability of nuclear factors to bind to this consensus AP-1 element within Prm3 was demonstrated by EMSAs using nuclear extract from HEL cells Nuclear factor–DNA complex formation was sequence specific requiring the presence of the ‘core AP-1 element’ and was efficiently competed by an excess of the corresponding nonlabeled double-stranded AP-1 oligonucleotide but not by the corresponding doublestranded oligonucleotide containing the mutated AP-1* element Moreover, EMSAs employing a panJun antibody confirmed binding of Jun protein to the AP-1 element that was specifically competed by the nonlabeled double-stranded AP-1wt but not by the AP-1* oligonucleotide (data not shown) The combined contribution of the AP-1 and Oct-1 ⁄ cis-acting elements were confirmed whereby mutation of both the AP-1* and Oct-1 ⁄ 2* elements yielded 10- to 16-fold reductions in luciferase expression, effectively abolishing Prm3 activity in both HEL and HEK293 cells Consistent with our observations, both AP-1 and Oct members can bind and direct transcription from a number of TATA-less promoters [48–51] In addition, although both the AP-1 complex and certain Oct family members are ubiquitously expressed, they can also regulate transcription in a cell type-specific manner through the recruitment of cell specific transcription factors and coregulators [52] The AP-1 binding sequence was originally identified as a tetradecanoyl phorbol myristic acid (TPA) ⁄ phorbol myristate acetate (PMA) response element (TRE) and treatment of cultured cells with PMA results in a strong increase in AP-1 binding to TREs [53] Prm1and Prm3- reporter gene expression and TPa and TPb mRNA expression are up-regulated by PMA in HEL cells [25] While the site of action of PMA within Prm1 has been localized to an SP-1 element [54], the PMA-responsive element(s) within Prm3 has, as yet, to be identified Hence, herein, we investigated whether the AP-1 site at )27 mediates PMA increases in Prm3 activity Consistent with previous reports [25], stimulation of HEL cells with PMA led to a 1.5-fold increase in Prm3-directed gene expression In contrast, Prm3 1047 Thromboxane A2 receptor gene expression subfragments containing the mutated AP-1* element yielded 2.0-fold reductions in basal luciferase activity relative to corresponding Prm3 subfragments containing the wild-type AP-1 and PMA did not significantly increase luciferase activity by those Prm3 subfragments containing the AP-1* mutation Moreover, EMSAs confirmed that PMA significantly increased nuclear factor binding to the AP-1 element relative to vehicle treated HEL cells Similar data were generated in HEK293 cells (data not shown) Hence, the AP-1 element mediates PMA induction of Prm3 and thereby provides a mechanism, at least in part, to account for the previously reported PMA up-regulation of TPb expression in HEL cells [25] Taken together, these latter observations point to further differences in the modes of regulation of TPa and TPb expression through SP-1 [54] and AP-1 elements within Prm1 and Prm3, respectively, such as during megakaryocyte differentiation for example, that can be readily induced experimentally in response to PMA In conclusion, Prm3 contains an AP-1 and Oct-1 ⁄ core promoter elements that are critical for basal Prm3 activity and the AP-1 element mediates PMA-induction of Prm3 activity In addition, we have identified a negative URS between )404 and )320 Collectively, these data provide valuable insights into the factors determining both the basal and PMA up-regulation of TPb expression and may provide a platform to determine the relative contributions of differentially regulated expression of TPa and TPb to haemostasis and possibly to vascular disease Experimental procedures Materials pGL3Basic, pGL3Enhancer, pRL-Thymidine Kinase (pRL-TK) and Dual LuciferaseÒ Reporter Assay System were obtained from Promega Corporation (Madison, WI, USA) DMRIE-CÒ was from Invitrogen Life Technologies (CA, USA) EffecteneÒ was from Qiagen Ltd (Crawley, UK) [32P]ATP[cP] (6000 CiỈmmol)1 at 10 mCiỈ mL)1) was from Valeant Pharmaceuticals (ICN; Costa Mesa, USA) All other reagents were molecular biology grade Anti-(Oct-1) (sc-232x), anti-(Oct-2) (sc-233x), anti-(cjun) (sc-44x) Igs were obtained from Santa Cruz Biotechnology Construction of luciferase-based genetic reporter plasmids To identify sequence elements required for promoter (Prm) activity, a range of 5¢- and 3¢-deletion fragments were 1048 A T Coyle and B T Kinsella subcloned into pGL3Basic and ⁄ or pGL3Enhancer genetic reporter vectors Gene fragments were amplified by the polymerase chain reaction (PCR) using as template pGL3b:Prm3 [25] containing Prm3 (1394 bp) cloned into pGL3Basic Specifically, for all 5¢ deletions, PCR fragments were generated using the antisense primer Kin113 (5¢-dAGAGACGCGTGGCTCCGGAGCCCTGAGGGA TC-3¢, complementary to nucleotides )19 to +1 where the underlined sequence corresponds to the Mlu1 cloning site) in combination with specific sense primers designed to amplify progressively shorter regions of Prm3 The following lists the identities of the Prm3 gene fragments and corresponding plasmids generated in either pGL3Basic (pGL3b) or pGL3Enhancer (pGL3e) vectors and the identity of the specific sense oligonucleotide primer, its sequence and corresponding nucleotides (NTs) where, in each case, the – designation indicates NTs 5¢ of the translational ATG start codon (designated +1) and underlined sequences represent the Kpn1 cloning site (1) Prm3b; pGL3b:Prm3b & pGL3e:Prm3b (Primer Kin142; 5¢-dGAGAGGTACCACTTCACTCATCACACC TGGCCC-3¢, corresponding to NTs )975 to )952) (2) Prm3a; pGL3b:Prm3a & pGL3e:Prm3a (Primer Kin143; 5¢-dGAGAGGTACCCTCACGCCTGTAATCCC AG-3¢, corresponding to NTs )404 to )386) (3) Prm3ab, pGL3b:Prm3ab & pGL3e:Prm3ab (Primer Kin146; 5¢-dGAGAGGTACCTGGGAGGCTGAGATGG3¢, corresponding to NTs )320–304) (4) Prm3aa, pGL3b:Prm3aa & pGL3e:Prm3aa (Primer Kin145; 5¢-dGAGAGGTACCTAGGAGTTCACCAGA GC-3¢, corresponding to NTs )154 to )137) (5) Prm3ax; pGL3b:Prm3ax & pGL3e:Prm3ax (Primer Kin177; 5¢-dGAGAGGTACCAGCTACTTACACTGAAA TGCAG-3¢, corresponding to NTs )140 to )118) (6) Prm3ac; pGL3b:Prm3ac & pGL3e:Prm3ac (Primer Kin188; 5¢-dGAGAGGTACCGAATTAATCACAAGCAA ATCTTCTC-3¢, corresponding to NTs )119 to )94) (7) Prm3aab; pGL3b:Prm3aab & pGL3e:Prm3aab (Primer Kin160; 5¢-dGAGAGGTACCGCAAATCTTCTCTCGCC TCC-3¢, corresponding to NTs )106 to )86) (8) Prm3aaa; pGL3b:Prm3aaa & pGL3e:Prm3aaa (Primer Kin161, 5¢-dGAGAGGTACCGCAGCATCGGCCTGATG GG-3¢, corresponding to NTs )50 to )31) The gene fragment Prm3e ()404 to +119 of Prm3) was amplified by PCR using pWE15:TXR [55] as template and primers Kin143 (5¢-dGAGAGGTACCCTCACGCCTGTA ATCCCAG-3¢, corresponding to NTs )404 to )385) and Kin245 (5¢-dAGAGACGCGTGCCAGGCCCACCACGC AG-3¢, corresponding to NTs +1 to +119) and was subcloned into the Kpn1–Mlu1 sites of pGL3Basic to generate the plasmid pGL3b:Prm3e The 3¢-deletion Prm3f (nucleotide )404 to )118) was amplified by PCR using pGL3b:Prm3 as template and the primers Kin143 (5Â-dGAGAGGTACCCTCACGCCTGTA FEBS Journal 272 (2005) 10361053 ê 2005 FEBS A T Coyle and B T Kinsella ATCCCAG-3¢, corresponding to NTs )404 to )385) and Kin263 (5¢dAGAGACGCGTGAGAAGATTTGCTTGTG ATTAATTC-3¢, corresponding to NTs )143 to )118) and was subcloned into the Kpn1–Mlu1 sites of pGL3Basic to generate the plasmid pGL3b:Prm3f The identity and fidelity of all Prm3 gene fragments in the latter recombinant plasmids was verified by doublestranded DNA sequencing Site-directed mutagenesis Site-directed mutagenesis was carried out using the QuikChangeTM (Stratagene, Amsterdam, the Netherlands) method Specifically, mutation of the AP-1 element with the sequence ggTGACtg to ggATCCtg (core bases shown in uppercase) centered at )27 within Prm3 was performed using mutator primers Kin162 (5¢-dCGGCCTGATGGG GTGGATCCTGATCCCTCAGGGCTC-3¢; sense primer) vs its complement generating pGL3b:Prm3AP)1*, pGL3e: Prm3AP)1*, pGL3b: Prm3aAP)1*, pGL3e:Prm3aAP)1*, pGL3b:Prm3abAP)1*, pGL3e: Prm3abAP)1*, pGL3b: Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) centered at )123 within Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC-3¢; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and pGL3e:Prm3aOCT)1*, OCT)1 * pGL3e:Prm3ab Mutation of the Oct-1 ⁄ element with the sequence aGCAAAtc to aGCAAGtc (core bases shown in uppercase letters) centered at )105 within Prm3 was performed using the mutator primers Kin193 (5¢-dGAATTAATCACAAGC AAGTCTTCTCTCGCCTCCCAG-3¢; sense primer) vs its complement generating pGL3b:Prm3aOCT1 ⁄ 2*, pGL3e:Prm3aOCT1 ⁄ 2*, pGL3b:Prm3aOCT1 ⁄ 2* and pGL3e:Prm3aOCT1 ⁄ 2* Mutation of both the consensus Oct-1 ⁄ and AP-1 elements centered at )105 and )27, respectively, was performed using the mutator primers Kin162 (5¢-dCGGCCTG ATGGGGTGGATCCTGATCCCTCAGGGCTC-3¢; sense primer) vs its complement generating pGL3b: Prm3abOct1 ⁄ 2*,AP)1* and pGL3e:Prm3ab Oct1 ⁄ 2*,AP)1* In each case, mutated bases within the mutator primers are highlighted in bold type Cell culture All mammalian cells were grown at 37 °C in a humid environment with 5% CO2 Human erythroleukemic (HEL) 92.1.7 cells and human embryonic kidney (HEK) 293 cells were cultured in RPMI 1640, 10% fetal bovine serum and in Eagle’s minimal essential medium (MEM), 10% fetal bovine serum, respectively FEBS Journal 272 (2005) 1036–1053 ª 2005 FEBS Thromboxane A2 receptor gene expression Assay of luciferase activity HEK293 cells were plated in MEM, 10% FBS in six well dishes at · 105 cells per well At 70–80% confluence, cells were cotransfected with control ⁄ recombinant pGL3Basic or pGL3Enhancer vectors (0.4 lg per well), encoding firefly luciferase, along with pRL TK (50 ng per well), encoding renilla luciferase, using effectene as recommended by the supplier To investigate the effect of Oct-1 or Oct-2 on Prm3-directed luciferase expression, the previously described pcDNA3:HaOct-1 or pcDNA3:HaOct-2 plasmids [46] encoding Oct-1 and Oct-2, respectively, were transiently over-expressed in HEK293 cells along with recombinant pGL3Basic vectors encoding Prm3ab Briefly, pGL3b:Prm3ab (0.2 lg per well) plus pRL TK (50 ng per well) plasmids were transiently cotransfected along with either pcDNA3:HaOct-1 (0.2 lg per well), pcDNA3:HaOct-2 (0.2 lg per well) or, as a negative control, pcDNA3 (0.2 lg per well) using Effectene Forty-eight hours post transfection, cells were washed in phosphate-buffered saline (NaCl ⁄ Pi), were lysed and harvested by scraping in 350 lL Reporter Lysis Buffer (Promega) and centrifuged at 14 000 g for at room temperature HEL92.1.7 cells were transfected using DMRIE-C Briefly, per transfection, 0.5 mL of serum free RPMI 1640 medium was dispensed into a six-well dish and lL of DMRIE-C reagent was added Thereafter, 0.5 mL of serum-free RPMI 1640 medium containing lg of recombinant ⁄ control pGL3Basic or pGL3Enhancer plasmids and 200 ng of pRL-TK was added and DNA ⁄ DMRIE-C reagent was complexed at room temperature for 30 Thereafter, 0.2 mL of serum free RPMI 1640 medium containing · 106 HEL cells were added and incubated for h at 37 °C in a CO2 incubator, after which mL of RPMI 1640 containing 15% fetal bovine serum was added Forty-eight hours after transfection, cells were washed in ice-cold NaCl ⁄ Pi and harvested at 1200 g for at °C Where relevant, 36 h prior post-transfection HEL cells with incubated with PMA (100 nm) or, as controls, with an equivalent volume of the vehicle (0.1% dimethylsulfoxide) and cells were further incubated for 16 h prior to harvesting Cell pellets were resuspended in reporter lysis buffer (100 lL) and were lysed by repeated trituration Cell lysates were prepared by centrifugation at 14 000 g for at room temperature To investigate the effect of Oct-1 or Oct-2 on Prm3-directed luciferase expression, pcDNA3:HaOct-1 or pcDNA3:HaOct-2 plasmids [46] were transiently over-expressed in HEL cells along with recombinant pGL3Basic vectors encoding Prm3 or its subfragments Briefly, recombinant pGL3b:Prm3ab (1.0 lg per well) plus pRL TK (200 ng per well) plasmids were transiently cotransfected along with either pcDNA3: HaOct-1 (1.0 lg per well), pcDNA3:HaOct-2 (1.0 lg per well) or, as a negative control, pcDNA3 (1.0 lg per well) using DMRIE-C Cells were harvested 48 h post-transfec- 1049 Thromboxane A2 receptor gene expression tion and cells lysed and prepared for luciferase assays as described above HEK293 and HEL cell supernatants were assayed for both firefly and renilla luciferase activity using the Dual Luciferase Assay SystemTM, essentially as previously described [25] Relative firefly to renilla luciferase activities (arbitrary units) were calculated as a ratio and were expressed in relative luciferase units (RLU) Preparation of nuclear extracts Nuclear extracts were prepared from both untreated and phorbol myristic acid (PMA) treated (100 nm, 16 h) HEL92.1.7 cells (as previously described with minor modifications [56] Specifically, HEL cells (1.6–2 · 106) were pelleted at 717 g for at °C and lysed by triturating 6–8 times on ice in 1.5 mL cell lysis buffer (1.5 mm Hepes, pH 7.9., mm KCl, 0.2 mm EDTA, 50 lm spermine, 1% glycerol, 0.5 mm dithiothreitol, 1% NP40, 10 lm sodium orthovandadate, 40 mm NaFl, 0.1 mm phenylmethylsulfonyl fluoride, mm leupeptin, 0.7 mgỈmL)1 pepstatin) using 21 and 26 gauge needles, respectively Nuclei were isolated and lysed [56] and nuclear extracts were dialysed vs 20 mm Hepes, pH 7.9, 20% glycerol, 100 mm KCl, 0.4 mm PMSF, 0.5 mm EDTA, 0.2 mm EGTA and 0.2 mm EGTA Following dialysis, nuclear debris was pelleted at 16 000 g for 10 and the protein concentration of nuclear extracts were determined using the Bradford assay [57] For electrophoretic mobility supershift assays, nuclear extracts were prepared under identical conditions except that dithiothreitol was excluded from the various isolation buffers Electrophoretic mobility shift and supershift assays Oligonucleotides corresponding to the sense and antisense strands of each probe (0.35 lm of each) were annealed in 1· T4 polynucleotide kinase (PNK) buffer (70 mm Tris ⁄ HCl, pH 7.6.,10 mm MgCl2, mm dithiothreitol; lL) by heating at 95 °C for followed by slow cooling to room temperature for 30 The resulting doublestranded probes were then radiolabeled in 10 lL reactions containing 0.35 lm double-stranded oligonucleotide, lL [32P]ATP[cP] (6000 CiỈmmol)1 at 10 mCiỈmL)1; ICN) and lL T4 PNK (10 lL)1) at 37 °C for 30 Following labeling, the reactions were diluted : 10 with 10 mm Tris ⁄ HCl, pH 8.0.,1 mm EDTA (TE, pH 8.0) buffer to achieve a final concentration of 32P-radiolabeled labeled of 0.035 lm The unincorporated [32P]ATP[cP] was removed by gel filtration chromatography using preprepared Sephadex G25 spin columns (Roche) Nuclear extract (4 lg total protein) was incubated for 15 at room temperature with ⁄ without a 57-fold molar excess of unlabeled double-stranded competitor ⁄ noncompetitor oligonucleotide (2 lm) in 1· Binding Buffer (20 mm 1050 A T Coyle and B T Kinsella Hepes, pH 7.9., 50 mm KCl, 0.1 mm EDTA, 0.1 mm EGTA, 0.5 mm dithiothreitol, 4% Ficoll, 50 lgỈmL)1 poly (dI-dC; Sigma) The appropriate 32P-radiolabeled doublestranded oligonucleotide (0.035 lm; lL per reaction) was then added and reactions were incubated for 20 at room temperature Following incubation, binding reactions were subjected to electrophoresis through a 4% polyacrylamide gel (20 cm · 20 cm) in 89 mm Tris borate, mm EDTA buffer for h at room temperature; thereafter, gels were dried and analyzed by autoradiography The sequences of the competitor ⁄ noncompetitor oligonucleotides used were as follows: (a) Oct-1 ⁄ 2WT (Kin195; 5¢-dTAATCACAAGCAAATCTTCTCTC-3¢; corresponding to NTs )115 to )92 of Prm3); (b) mutated Oct-1 ⁄ 2* (Kin193; 5¢-dGAATTAATCACAAGCAAGTCTTCTCTC GCCTCCCAGTC-3¢; corresponding to NTs )119 to )83 of Prm3 where bases mutated from the wild-type Prm3 sequence are in bold italics); (c) AP-1WT(Kin189; 5¢-dGGTGGTGAC TGATCCCTCAGGGC-3¢; corresponding to NTs )32 to )10 of Prm3); (d) mutated AP-1* (Kin162; 5¢-dCGGCCT GATGGGGTGGATCCTGATCCCTCAGGGC-3¢; corresponding to NTs )46 to )7 of Prm3 where bases mutated from the wild-type Prm3 sequence are in bold italics); (e) SP1 consensus site (Promega) with the sequence: 5¢-dATTCG ATCGGGGCGGGGCGAG-3¢; (f) AP-1 consensus site (Promega; Kin338; 5¢ dCGCTTGATGAGTCAGCCGGAA3¢); (g) octamer (Oct) consensus site (Promega; Kin340; 5¢-dTGTCAGATGCAAATCACTAGAA-3¢) Note, only forward oligonucleotides are given and sequences of the corresponding complementary strands are omitted For electrophoretic mobility supershift assays, nuclear extracts (4 lg total protein) was preincubated with lL for either anti-(Oct-1) (sc-232x; mgỈmL)1 stock concentration), anti-(Oct-2) (sc-233x; mgỈmL)1 stock concentration), anti-(c-jun) (sc-44x; mgỈmL)1 stock concentration) for 30 at °C Thereafter, nuclear extract ⁄ antibody mixtures were incubated for 15 at room temperature with ⁄ without a 57-fold molar excess of unlabeled doublestranded competitor ⁄ noncompetitor oligonucleotide (2 lm) in 1· binding buffer followed by the addition of the appropriate 32P-radiolabeled double-stranded oligonucleotide (0.035 lm; lL per reaction), as described above Western blot analysis Levels of Oct-1 and Oct-2 were determined by Western blot analysis Briefly, 60 lg of whole cell protein from HEL or HEK293 cells were resolved by SDS ⁄ PAGE (10% gels) and transferred to polyvinylidene difluoride membrane according to standard methodology Membranes were screened using anti-(Oct-1) (sc-232x) or anti-(Oct-2) (sc-233x) at 0.2 lg polyvinylidene difluoride per mL in 5% non fat dried milk in 1· TBST (0.01 m Tris ⁄ HCl, 0.1 m NaCl, 0.1% Tween 20; pH 7.5) for h at room temperature followed by washing and screening using FEBS Journal 272 (2005) 1036–1053 ª 2005 FEBS A T Coyle and B T Kinsella goat anti-rabbit horseradish peroxidase (HRP; sc-2204) and detection using BM Chemiluminesence Western blotting Kit (Roche, E Sussex, UK) as described by the manufacturer Statistical analysis Statistical analyses of differences were analyzed using the two-tailed Student’s unpaired t-test All values are expressed as mean ± standard error of the mean (SEM) P-values £ 0.05 were considered to indicate statistically significance differences Thromboxane A2 receptor gene expression 10 11 Acknowledgements 12 This work was supported by grants from The Wellcome Trust, The Health Research Board and Enterprise Ireland We are grateful to Dr Harinder Singh, Department Molecular Genetics and Cell Biology, University of Chicago for the gifts of pcDNA3:HaOct1 and pcDNA3:HaOct2 13 References 14 Narumiya S, Sugimoto Y & Ushikubi F (1999) Prostanoid receptors: structures, properties, and functions Physiol Rev 79, 1193–1226 Breyer RM, Bagdassarian CK, Myers SA & Breyer MD (2001) Prostanoid receptors: subtypes and signalling Annu Rev Pharmacol Toxicol 41, 661–690 Kinsella BT (2001) Thromboxane A2 signalling in humans: a ‘Tail’ of two receptors Biochem Soc Trans 29, 641–654 Lianos EA & Bresnahan BA (1999) Effect of thromboxane A2 inhibition and antagonism on prostaglandin and leukotriene synthesis in glomerular immune injury J Lab Clin Med 134, 478–482 Dorn GW, 2nd Becker MW & Davis MG (1992) Dissociation of the contractile and hypertrophic effects of vasoconstrictor prostanoids in vascular smooth muscle J Biol Chem 267, 24897–24905 Ali S, Davis MG, Becker MW, Dorn GW & 2nd (1993) Thromboxane A2 stimulates vascular smooth muscle hypertrophy by up-regulating the synthesis and release of endogenous basic fibroblast growth factor J Biol Chem 268, 17397–17403 Ashton AW, Yokota R, John G, Zhao S, Suadicani SO, Spray DC & Ware JA (1999) Inhibition of endothelial cell migration, intercellular communication, and vascular tube formation by thromboxane A(2) J Biol Chem 274, 35562–35570 Ushikubi F, Aiba Y, Nakamura K, Namba T, Hirata M, Mazda O, Katsura Y & Narumiya S (1993) Thromboxane A2 receptor is highly expressed in mouse FEBS Journal 272 (2005) 1036–1053 ª 2005 FEBS 15 16 17 18 19 20 immature thymocytes and mediates DNA fragmentation and apoptosis J Exp Med 178, 1825–1830 Oates JA, FitzGerald GA, Branch RA, Jackson EK, Knapp HR & Roberts LJ 2nd (1988) Clinical implications of prostaglandin and thromboxane A2 formation (1) N Engl J Med 319, 689–698 Fitzgerald DJ, Rocki W, Murray R, Mayo G & FitzGerald GA (1990) Thromboxane A2 synthesis in pregnancy-induced hypertension Lancet 335, 751–754 Neri Serneri GG, Gensini GF, Masotti G, Abbate R, Morettini A, Poggesi L & Fortini A (1984) Role of prostacyclin and thromboxane A2 in ischaemic heart disease Adv Exp Med Biol 164, 175–185 Hirata T, Kakizuka A, Ushikubi F, Fuse I, Okuma M & Narumiya S (1994) Arg60 to Leu mutation of the human thromboxane A2 receptor in a dominantly inherited bleeding disorder J Clin Invest 94, 1662–1667 Thomas DW, Mannon RB, Mannon PJ, Latour A, Oliver JA, Hoffman M, Smithies O, Koller BH & Coffman TM (1998) Coagulation defects and altered hemodynamic responses in mice lacking receptors for thromboxane A2 J Clin Invest 102, 1994–2001 Cheng Y, Austin SC, Rocca B, Koller BH, Coffman TM, Grosser T, Lawson JA & FitzGerald GA (2002) Role of prostacyclin in the cardiovascular response to thromboxane A2 Science 296, 539–541 Hirata M, Hayashi Y, Ushikubi F, Yokota Y, Kageyama R, Nakanishi S & Narumiya S (1991) Cloning and expression of cDNA for a human thromboxane A2 receptor Nature 349, 617–620 Nusing RM, Hirata M, Kakizuka A, Eki T, Ozawa K & Narumiya S (1993) Characterization and chromosomal mapping of the human thromboxane A2 receptor gene J Biol Chem 268, 25253–25259 Raychowdhury MK, Yukawa M, Collins LJ, McGrail SH, Kent KC & Ware JA (1994) Alternative splicing produces a divergent cytoplasmic tail in the human endothelial thromboxane A2 receptor J Biol Chem 269, 19256–19261 Hirata T, Ushikubi F, Kakizuka A, Okuma M & Narumiya S (1996) Two thromboxane A2 receptor isoforms in human platelets: opposite coupling to adenylyl cyclase with different sensitivity to Arg60 to Leu mutation J Clin Invest 97, 949–956 Vezza R, Habib A & FitzGerald GA (1999) Differential signaling by the thromboxane receptor isoforms via the novel GTP-binding protein, Gh J Biol Chem 274, 12774–12779 Parent JL, Labrecque P, Orsini MJ & Benovic JL (1999) Internalization of the TXA2 receptor alpha and beta isoforms: role of the differentially spliced COOH terminus in agonist-promoted receptor internalization J Biol Chem 274, 8941–8948 1051 Thromboxane A2 receptor gene expression 21 Parent JL, Labrecque P, Driss Rochdi M & Benovic JL (2001) Role of the differentially spliced carboxyl terminus in thromboxane A2 receptor trafficking: identification of a distinct motif for tonic internalization J Biol Chem 276, 7079–7085 22 Walsh MT, Foley JF & Kinsella BT (2000) The alpha, but not the beta, isoform of the human thromboxane A2 receptor is a target for prostacyclin-mediated desensitization J Biol Chem 275, 20412–20423 23 Reid HM & Kinsella BT (2003) The alpha, but not the beta, isoform of the human thromboxane A2 receptor is a target for nitric oxide-mediated desensitization: independent modualtion of Tp alpha signaling by nitric oxide and prostacyckin J Biol Chem 278, 51190–51202 24 Miggin SM & Kinsella BT (1998) Expression and tissue distribution of the mRNAs encoding the human thromboxane A2 receptor (TP) alpha and beta isoforms Biochim Biophys Acta 1425, 543–559 25 Coyle AT, Miggin SM & Kinsella BT (2002) Characterization of the 5¢ untranslated region of alpha and beta isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms Eur J Biochem 269, 4058–4073 26 Quandt K, Frech K, Karas H, Wingender E & Werner T (1995) MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data Nucleic Acids Res 23, 4878–4884 27 Mechta-Grigoriou F, Gerald D & Yaniv M (2001) The mammalian Jun proteins: redundancy and specificity Oncogene 20, 2378–2389 28 Zhang Y & Dufau ML (2003) Dual mechanisms of regulation of transcription of luteinizing hormone receptor gene by nuclear orphan receptors and histone deacetylase complexes J Steroid Biochem Mol Biol 85, 401–414 29 Struhl K (1995) Yeast transcriptional regulatory mechanisms Annu Rev Genet 29, 651–674 30 Hata K & Mizuguchi J (2004) Genomic organization and characterization of the promoter for the E2A gene Gene 325, 53–61 31 van Rietschoten JG, Smits HH, van de Wetering D, Westland R, Verweij CL, den Hartog MT & Wierenga EA (2001) Silencer activity of NFATc2 in the interleukin-12 receptor beta proximal promoter in human T helper cells J Biol Chem 276, 34509–34516 32 Zhao FQ, Adachi K & Oka T (2002) Involvement of Oct-1 in transcriptional regulation of beta-casein gene expression in mouse mammary gland Biochim Biophys Acta 1577, 27–37 33 Strom AC, Forsberg M, Lillhager P & Westin G (1996) The transcription factors Sp1 and Oct-1 interact physically to regulate human U2 snRNA gene expression Nucleic Acids Res 24, 1981–1986 34 Das G & Herr W (1993) Enhanced activation of the human histone H2B promoter by an Oct-1 variant 1052 A T Coyle and B T Kinsella 35 36 37 38 39 40 41 42 43 44 45 46 47 generated by alternative splicing J Biol Chem 268, 25026–25032 Verrijzer CP & Van der Vliet PC (1993) POU domain transcription factors Biochim Biophys Acta 1173, 1–21 Arnosti DN, Merino A, Reinberg D & Schaffner W (1993) Oct-2 facilitates functional preinitiation complex assembly and is continuously required at the promoter for multiple rounds of transcription EMBO J 12, 157– 166 Singh H, Sen R, Baltimore D & Sharp PA (1986) A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes Nature 319, 154–158 Staudt LM, Clerc RG, Singh H, LeBowitz JH, Sharp PA & Baltimore D (1988) Cloning of a lymphoid-specific cDNA encoding a protein binding the regulatory octamer DNA motif Science 241, 577–580 Clerc RG, Corcoran LM, LeBowitz JH, Baltimore D & Sharp PA (1988) The B-cell-specific Oct-2 protein contains POU box- and homeo box-type domains Genes Dev 2, 1570–1581 Scheidereit C, Cromlish JA, Gerster T, Kawakami K, Balmaceda CG, Currie RA & Roeder RG (1988) A human lymphoid-specific transcription factor that activates immunoglobulin genes is a homoeobox protein Nature 336, 551–557 Hatzopoulos AK, Stoykova AS, Erselius JR, Goulding M, Neuman T & Gruss P (1990) Structure and expression of the mouse Oct2a and Oct2b, two differentially spliced products of the same gene Development 109, 349–362 He X, Treacy MN, Simmons DM, Ingraham HA, Swanson LW & Rosenfeld MG (1989) Expression of a large family of POU-domain regulatory genes in mammalian brain development Nature 340, 35–41 Cockerill PN & Klinken PS (1990) Octamer-binding proteins in diverse hemopoietic cells Mol Cell Biol 10, 1293–1296 Fujimori K, Kanaoka Y, Sakaguchi Y & Urade Y (2000) Transcriptional activation of the human hematopoietic prostaglandin D synthase gene in megakaryoblastic cells Roles of the oct-1 element in the 5¢-flanking region and the AP-2 element in the untranslated exon J Biol Chem 275, 40511–40516 Groenen MA, Dijkhof RJ, van der Poel JJ, van Diggelen R & Verstege E (1992) Multiple octamer binding sites in the promoter region of the bovine alpha s2-casein gene Nucleic Acids Res 20, 4311–4318 Shah PC, Bertolino E & Singh H (1997) Using altered specificity Oct-1 and Oct-2 mutants to analyze the regulation of immunoglobulin gene transcription EMBO J 16, 7105–7117 Becker JC, Nikroo A, Brabletz T & Reisfeld RA (1995) DNA loops induced by cooperative binding of transcriptional activator proteins and preinitiation complexes Proc Natl Acad Sci USA 92, 9727–9731 FEBS Journal 272 (2005) 1036–1053 ª 2005 FEBS A T Coyle and B T Kinsella 48 Wang F, Gao JX, Mimura J, Kobayashi A, Sogawa K & Fujii-Kuriyama Y (1998) Structure and expression of the mouse AhR nuclear translocator (mArnt) gene J Biol Chem 273, 24867–24873 49 Wolf I, Pevzner V, Kaiser E, Bernhardt G, Claudio E, Siebenlist U, Forster R & Lipp M (1998) Downstream activation of a TATA-less promoter by Oct-2, Bob1, and NF-kappaB directs expression of the homing receptor BLR1 to mature B cells J Biol Chem 273, 28831–28836 50 Sun Y, Jin P, Witte DP & Grabowski GA (1998) Isolation and characterization of the human prosaposin promoter Gene 218, 37–47 51 de Grazia U, Felli MP, Vacca A, Farina AR, Maroder M, Cappabianca L, Meco D, Farina M, Screpanti I, Frati L et al (1994) Positive and negative regulation of the composite octamer motif of the interleukin enhancer by AP-1, Oct-2, and retinoic acid receptor J Exp Med 180, 1485–1497 52 Chong T, Apt D, Gloss B, Isa M & Bernard HU (1991) The enhancer of human papillomavirus type 16: binding FEBS Journal 272 (2005) 1036–1053 ª 2005 FEBS Thromboxane A2 receptor gene expression 53 54 55 56 sites for the ubiquitous transcription factors oct-1, NFA, TEF-2, NF1, and AP-1 participate in epithelial cell-specific transcription J Virol 65, 5933–5943 Piette J, Hirai S & Yaniv M (1988) Constitutive synthesis of activator protein transcription factor after viral transformation of mouse fibroblasts Proc Natl Acad Sci USA 85, 3401–3405 D’Angelo DD, Oliver BG, Davis MG, McCluskey TS & Dorn GW (1996) Novel role for Sp1 in phorbol ester enhancement of human platelet thromboxane receptor gene expression J Biol Chem 271, 19696–19704 Kinsella BT, O’Mahony D, Lawson JA, Pratico D & Fitzgerald GA (1994) Cellular activation of thromboxane receptors Ann N Y Acad Sci 714, 270–278 Yamaguchi S, Murata Y, Nagaya T, Hayashi Y, Ohmori S, Nimura Y & Seo H (1999) Glucocorticoids increase retinoid-X receptor alpha (RXRalpha) expression and enhance thyroid hormone action in primary cultured rat hepatocytes J Mol Endocrinol 22, 81–90 1053 ... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3? ?; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and. .. Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) centered at )1 23 within... Prm3aab; pGL3b:Prm3aab & pGL3e:Prm3aab (Primer Kin160; 5¢-dGAGAGGTACCGCAAATCTTCTCTCGCC TCC -3? ?, corresponding to NTs )106 to )86) (8) Prm3aaa; pGL3b:Prm3aaa & pGL3e:Prm3aaa (Primer Kin161, 5¢-dGAGAGGTACCGCAGCATCGGCCTGATG