Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae Bjørn Altermark 1 , Laila Niiranen 2 , Nils P. Willassen 1,2 , Arne O. Smala ˚ s 1 and Elin Moe 1 1 Norwegian Structural Biology Centre, Faculty of Science, University of Tromsø, Norway 2 Department of Molecular Biotechnology, Faculty of Medicine, University of Tromsø, Norway The marine and estuarine environment harbors a vast diversity of bacteria. Some of the most extensively studied marine or estuarine bacteria belong to the genus Vibrio, with Vibrio cholerae being the most notorious species as it is the cause of cholera in humans. V. cholerae is found in tropical and temper- ate areas, and can be classified as a mesophilic bac- terium with growth optimum around 37 °C. It prefers estuarine waters, is halotolerant, and does not require NaCl for growth [1,2]. The bacterium with one of the lowest growth optimum temperatures found in the genus Vibrio is the fish pathogen Vibrio salmonicida. It has an optimal growth temperature of % 15 °C and requires NaCl for growth [3]. It can therefore be classified as a psychrophilic and mildly halophilic bacterium. A living cell can be considered as a chemical factory which produces many substances. The speed of pro- duction is limited by reaction rates. The reaction rates are in turn limited by, among other things, environ- mental factors such as pH, salinity, pressure and tem- perature. Temperature is a very important factor for growth and proliferation of the cells. At high tempera- tures, at which thermophiles thrive, chemical reaction rates are very high, and the main challenge for cells is to adapt their enzymes, membranes and molecules to cope with the heat. At low temperatures, the chemical reaction rates are lower, and hence, in order to be competitive and grow fast at low temperatures, evolu- tionary pressure favors enzymes that are more efficient than their high-temperature counterparts. This higher efficiency at low temperatures is believed to be caused Keywords cold adaptation; endonuclease I; psychrophilic enzymes; salt adaptation; stability Correspondence E. Moe, Norwegian Structural Biology Centre, Faculty of Science, University of Tromsø, N-9037 Tromsø, Norway Fax: +47 77644765 Tel: +47 77646473 E-mail: elin.moe@chem.uit.no (Received 14 September 2006, revised 2 November 2006, accepted 9 November 2006) doi:10.1111/j.1742-4658.2006.05580.x Endonuclease I is a periplasmic or extracellular enzyme present in many different Proteobacteria. The endA gene encoding endonuclease I from the psychrophilic and mildly halophilic bacterium Vibrio salmonicida and from the mesophilic brackish water bacterium Vibrio cholerae have been cloned, over-expressed in Escherichia coli, and purified. A comparison of the enzy- matic properties shows large differences in NaCl requirements, optimum pH, temperature stability and catalytic efficiency of the two proteins. The V. salmonicida EndA shows typical cold-adapted features such as lower unfolding temperature, lower temperature optimum for activity, and higher specific activity than V. cholerae EndA. The thermodynamic activation parameters confirm the psychrophilic nature of V. salmonicida EndA with a much lower activation enthalpy. The optimal conditions for enzymatic activity coincide well with the corresponding optimal requirements for growth of the organisms, and the enzymes function predominantly as DNases at physiological concentrations of NaCl. The periplasmic or extra- cellular localization of the enzymes, which renders them constantly exposed to the outer environment of the cell, may explain this fine-tuning of bio- chemical properties. Abbreviations DSC, differential scanning calorimetry; VcEndA, recombinant Vibrio cholerae endonuclease I; VsEndA, recombinant Vibrio salmonicida endonuclease I. 252 FEBS Journal 274 (2007) 252–263 ª 2006 The Authors Journal compilation ª 2006 FEBS by a more flexible structure, and the increased flexi- bility is thought to be the reason for the lower thermo- stability of cold-adapted enzymes [4]. Endonuclease I is a periplasmic or extracellular enzyme known to cleave both RNA and DNA at unspecific internal (endo) sites. It also cleaves plasmids and single-stranded DNA [5]. The enzyme cleaves at the 3¢ side of the phosphodiester bond, leaving prod- ucts with 5¢ phosphate ends. A histidine functions as a general base, which activates a water molecule for an in-line attack on the scissile phosphate in the DNA substrate. The role of the active-site magnesium ion is to stabilize the phosphoanion transition state and make a proton available for the 3¢-oxygen leaving group, via a bound water molecule. An arginine is believed to stabilize the product via a hydrogen bond to the phosphate, which also decelerates the reverse reaction [6]. A chloride atom is found buried in the structure of V. cholerae endonuclease I and probably also in the Vibrio vulnificus endonuclease I structure [7]. Orthologues of endonuclease I from many bacterial species are described in the literature [5,8–13], but there seems to be an uncertainty about the main func- tion of this enzyme in vivo. It is well known for its ability to reduce the level of transformation [14–16], but appears to have no effect on conjugation [5]. The enzyme is shown not to be involved in the patho- genicity of V. cholerae [15], V. vulnificus [5] or Erwinia chrysanthemi [17]. Most of the bacteria that harbor the gene live in close contact with eukaryotic hosts, which may provide nutritious DNA and RNA through their mucus barriers. The mucus itself becomes less viscous if the DNA is broken down, and this may facilitate the movement of the bacterium through the mucus layer [15]. The enzyme is reported to be constitutively expressed in V. vulnificus [5] and Erwinia chrysanthemi [18]. Here we report the cloning, expression and purifica- tion of the endonuclease I enzymes from the psychro- phile V. salmonicida (VsEndA) and the mesophile V. cholerae (VcEndA). The two orthologous enzymes have been biochemically and biophysically character- ized to reveal possible differences related to environ- mental adaptation. Results Sequence similarity and composition VsEndA and VcEndA show 71% identity and 80% similarity (Blosum62) at the amino acid level, when the active enzymes are compared without their N-terminal signal peptide. A sequence alignment of VcEndA and VsEndA is shown in Fig. 1. The first two amino acids at the N-terminus (Thr and Met) are encoded by the expression vector. An analysis of the amino-acid composition shows that VsEndA contains 13 more lysines and two fewer arginines than Vc EndA, resulting in a very high R ⁄ K ratio for the mesophilic enzyme (1.6 versus 0.6, respectively). In addition VsEndA contains two less D + E than VcEndA. However all the cysteines involved in disulfide bridge formation in VcEndA are also found in the sequences of VsEndA (Fig. 1). The theoretical pI was 9.61 for VsEndA and 8.62 for VcEndA. Expression and purification From 7 L Escherichia coli culture, a total of 24 and 50 mg pure recombinant VsEndA and VcEndA pro- teins, respectively, were obtained (Fig. 2). The final NaCl concentration after cation-exchange chromato- graphy was estimated to 0.8 m for VsEndA and 0.65 m for VcEndA. Fig. 1. Sequence alignment showing the amino acids of VsEndA and Vc EndA. Numbers indicate cysteines involved in disulfide bridges; stars indicate Mg 2+ -co-ordinating residues, triangles indicate the catalytically important His80 and Arg99, and squares indicate Cl ) -co-ordinating residues. The sequence numbering is according to the structure of V. vulnificus endonuclease I in complex with a DNA octamer, PDB id. 1OUP [6]. B. Altermark et al. Endonuclease I from V. salmonicida and V. cholerae FEBS Journal 274 (2007) 252–263 ª 2006 The Authors Journal compilation ª 2006 FEBS 253 The calculated molecular masses were 25.0 and 24.7 kDa for VsEndA and VcEndA, respectively, which is in agreement with the results from the SDS ⁄ PAGE analysis shown in Fig. 2. Enzyme properties To find the optimal buffer conditions for the biochemi- cal characterization of the enzymes, we carried out an analysis of the NaCl requirements and pH optimum of VsEndA and VcEndA. The optimum NaCl concen- trations for activity were found to be 425 mm for VsEndA and 175 mm for VcEndA, respectively (Fig. 3). The optimum pH for activity of VsEndA and VcEndA was % 8.5–9.0 and 7.5–8.0, respectively, when measured in Tris ⁄ HCl and diethanolamine ⁄ HCl buffers as shown in Fig. 4. The pH optimum was unaffected by the NaCl concentration in the buffers. When tested in glycine buffer at pH 9.0, the enzymes showed very low activity compared with that in diethanolamine and Tris buffers at the same pH, indicating that glycine inhibits the enzymes. VcEndA activity decreases stee- ply below pH 6.5 (measured in Bis-Tris buffer, data not shown). The optimum temperature for activity was deter- mined using a modified Kunitz assay. The results showed optimum activity at % 45 °C for VsEndA and 50 °C for VcEndA, as shown in Fig. 5. Kinetic constants for VsEndA and VcEndA were measured by incubating the enzymes in the presence of substrate with different concentrations and at different temperatures. The kinetic constants for the two enzymes at 5, 15, 25, 30 and 37 °C are shown in 200 116.3 97.4 66.3 55.4 36.5 31.0 21.5 14.4 6.0 3.5 Fig. 2. SDS ⁄ PAGE. Lane 1, Mark12 MW ladder; lane 2, % 5 lg VcEndA; lane 3, % 5 lg VsEndA. The relative molecular masses of the standard are shown on the left. 0 200 400 600 800 0 25 50 75 100 VsEndA VcEndA [NaCl] (mM) Activity (%) Fig. 3. Optimum NaCl concentration for DNase activity. DNaseAlert was used as substrate, and activity was measured in increasing amounts of NaCl. Each replicate is plotted and the mean values are drawn. pH optimum VsEndA A 6.5 7.0 7.5 8.0 8.5 9.0 9.5 10.0 10.5 0.0 0.5 1.0 1.5 2.0 2.5 3.0 Tris DEA pH Activity (Rfu/s) B pH optimum VcEndA 6.5 7.0 7.5 8.0 8.5 9.0 9.5 10.0 10.5 1.0 1.5 2.0 2.5 3.0 Tris DEA pH Activity (Rfu/s) Fig. 4. Optimum pH for activity. (A) VsEndA; (B) VcEndA. Buffers used are 75 m M Tris ⁄ HCl, pH 7–9, and 75 mM diethanolamine ⁄ HCl, pH 8–10. DNaseAlert was used as a substrate in the assay. Each replicate is plotted and the mean values are drawn. Endonuclease I from V. salmonicida and V. cholerae B. Altermark et al. 254 FEBS Journal 274 (2007) 252–263 ª 2006 The Authors Journal compilation ª 2006 FEBS Table 1. VsEndA possesses a higher k cat than VcEndA at all temperatures, and the K m values of VcEndA are slightly lower than for VsEndA at all temperatures. The physiological efficiency is highest for VsEndA, but the difference decreased with concomitant increase in temperature. As determined from Arrhenius plots, the energy of activation (E a ) is 35.7 kJÆmol )1 for VsEndA and 76.3 kJÆmol )1 for Vc EndA. The calculations of the enthalpy (DH # ) and entropy (DS # ) of activation revealed much lower values for VsEndA as shown in Table 2. Also note that TDS # values for VsEndA were negative, whereas those from VcEndA were positive (Table 2). Temperature stability was analyzed by evaluating thermal unfolding using differential scanning calorime- try (DSC). The results revealed a T m of 44.8 °C for VsEndA and 52.8 °C for VcEndA as shown in Fig. 6. The calorimetric enthalpy (area under the transition) is also much lower for VsEndA (328 kJÆmol )1 ) than for VcEndA (480 kJÆmol )1 ). The rate of irreversible unfolding was analyzed by incubating both enzymes at 70 °C. Samples were removed after 10 min and incubated for 1 h on ice 0 102030405060 0 25 50 75 100 VsEndA VcEndA Temperature (°C) Activity (%) Fig. 5. Optimum temperature for activity. The enzymes were assayed using the modified Kunitz assay. Each replicate is plotted and the mean values are drawn. Table 1. Kinetic constants for VsEndA and VcEndA at 5, 15, 25, 30 and 37 °C. T(°C) VsEndA VcEndA VsEndA ⁄ VcEndA K m (nM) 5 246 ± 15 118 ± 13 2.1 15 202 ± 9.6 131 ± 10 1.5 25 169 ± 20 156 ± 17 1.1 30 208 ± 14 161 ± 12 1.3 37 181 ± 10 174 ± 10 1.0 k cat (s )1 ) 5 9.41 1.03 9.1 15 14.7 3.10 4.7 25 18.5 7.18 2.6 30 32.8 15.6 2.1 37 48.4 32.1 1.5 k cat ⁄ K m (s )1 ÆnM )1 ) 5 0.0383 0.00873 4.4 15 0.0728 0.0237 3.1 25 0.109 0.0461 2.4 30 0.158 0.0972 1.6 37 0.268 0.185 1.4 Table 2. Activation energy parameters were calculated (kJÆmol )1 ) for the psychrophilic VsEndA (p) and mesophilic VcEndA (m). The differ- ences in values (p ) m) is also shown. T (°C) Enzyme DG # DH # TDS # D(DG # ) p-m D(DH # ) p-m TD(DS # ) p-m 5 p 62.8 33.4 ) 29.4 ) 5.1 ) 40.6 ) 35.4 m 67.9 74.0 6.1 15 p 64.0 33.3 ) 30.7 ) 3.7 ) 40.6 ) 36.8 m 67.8 73.9 6.1 25 p 65.8 33.2 ) 32.6 ) 2.3 ) 40.6 ) 38.2 m 68.1 73.8 5.7 30 p 65.5 33.2 ) 32.3 ) 1.9 ) 40.6 ) 38.7 m 67.4 73.7 6.4 37 p 66.1 33.1 ) 32.9 ) 1.1 ) 40.6 ) 39.5 m 67.1 73.7 6.6 B. Altermark et al. Endonuclease I from V. salmonicida and V. cholerae FEBS Journal 274 (2007) 252–263 ª 2006 The Authors Journal compilation ª 2006 FEBS 255 before being assayed. Figure 7 shows that the rate of irreversible unfolding for VsEndA is higher than for Vc EndA, with a half-life of % 13 and 33 min, respectively. Substrate specificity analysis An analysis of the substrate specificity for DNA of the enzymes shows that they both cleave plasmid DNA, dsDNA and ssDNA as shown in Fig. 8. To test the RNA specificity of the enzymes, we used the RNaseAlert assay and compared the results with those obtained using the DNaseAlert assay. VsEndA has over 900-fold higher preference for DNA than RNA when measured in buffer with NaCl concentra- tion optimal for DNase activity. The RNase activity is inhibited in the presence of NaCl as shown in Fig. 9, and at 425 mm NaCl the VsEndA is predominantly a DNase. The VcEndA shows the same trend, with very low RNase activity at NaCl concentration optimal for DNase activity. Discussion The choices of enzyme orthologues, and their phylo- genetic relationship, which has been investigated in order to elucidate the cold-adapted properties of the enzymes, have previously been criticized [19]. Here, orthologue monomeric enzymes from species within the same genus are studied to minimize other adapta- tional strategies that may have affected these enzymes differently. When the amino acid compositions of VsEndA and VcEndA are compared, a remarkably low R ⁄ K ratio in VsEndA is found. In addition, there is a slight decrease in D + E. The difference in pI reflects this substitution of charged residues, by being one unit higher for VsEndA. VsEndA also binds much more strongly to the SP Sepharose column because of its higher positive charge compared with VcEndA. The primary structure of VsEndA also contains an extra lysine (Lys52a) which creates a gap in the alignment in Fig. 1. The differences in charge between the two enzymes may be involved in temperature adaptation; however, two properties, which are not related to tem- perature adaptation, clearly distinguish these enzymes. The two enzymes respond notably differently to varia- tions in both NaCl concentration and pH. A notable increase in activity against the DNase- Alert substrate was observed for the two enzymes when NaCl was added to the assay buffer. The optimal NaCl concentrations coincide with the salinities encountered by the bacteria in their natural habitats. Seawater at 3.5% salinity is composed of about 470 mm Na + ions and 540 mm Cl – ions [20]. The 30 40 50 60 0 10 20 30 40 50 60 VsEndA VcEndA Temperature (°C) Cp (kJ mol -1 K -1 ) Fig. 6. DSC endotherms of VsEndA and VcEndA. Baseline subtrac- ted data have been normalized for protein concentration. 0102030405060 1 10 100 VsEndA VcEndA Time (min) Residual activity (%) Fig. 7. Kinetic stability of VsEndA and VcEndA. Enzyme was incu- bated at 70 °C. Samples were removed after 10 min and incubated for 1 h on ice before being assayed using the DNaseAlert QC sys- tem kit. Each replicate is plotted and the mean values are drawn. AB Fig. 8. Cleavage of plasmid, dsDNA and ssDNA. (A) 14 nM VcEndA incubated at 23 °C for 5 min with plasmid (lane 2), dsDNA (lane 4) and ssDNA (lane 6). Substrate incubated without enzyme is in lanes 1, 3 and 5, respectively. (B) Substrate incubated with and without 14 n M VsEndA, as explained for VcEndA. Endonuclease I from V. salmonicida and V. cholerae B. Altermark et al. 256 FEBS Journal 274 (2007) 252–263 ª 2006 The Authors Journal compilation ª 2006 FEBS optimum NaCl concentration found for VsEndA cor- responds quite well to this. V. cholerae resides in more brackish water with lower salinity, and the lower [NaCl] optimum of VcEndA reflects this. The optimal salt concentrations were measured in a 75 mm Tris buffer. The optima may be higher in a Tris buffer of lower ionic strength, but this was not tested. Two terrestrial orthologous endonucleases, one from the plant pathogen Erwinia chrysanthemi and one from the ruminal bacterium Fibrobacter succinogenes, are also described in the literature [11,21]. The optimum concentrations of NaCl for these enzymes are 0– 75 mm and 10 mm, respectively, with DNA as sub- strate. It seems that the salt optima of the enzymes are fine-tuned to match the salinity of their environment. The outer membrane and cell wall of Gram-negative bacteria do not restrict passage of ions, and the peri- plasmic proteins are, like the extracellular proteins, constantly exposed to the salinity of the surrounding water. Knowledge on cold adaptation is in many cases based on marine secreted enzymes. Detailed data on salt adaptation of marine cold-adapted secreted enzymes is lacking and may be a source of error in the conclusions drawn [22]. For the endonuclease I enzymes studied here, the effect of NaCl is very prom- inent and underlines the need to dissect the different adaptational strategies in future studies. The differ- ences observed in the number of charged residues, especially lysine, are probably related to adaptation to both salinity and temperature. The K m of VsEndA is higher than that of VcEndA; therefore, the more posit- ive surface of VsEndA does not seem to significantly increase the affinity for the negatively charged sub- strate, and is apparently not a factor that aids VsEndA in improving its catalytic efficiency. It is possible that the K m is highly affected by the NaCl concentration in the buffer, but this is not tested. Halophilic enzymes have been reported to be more enriched in negatively charged amino acids than their nonhalophilic counter- parts [23,24]. This is the opposite to that found for the enzymes studied here, in which the number of posi- tively charged amino acids is increased. The chloride atoms probably position themselves around the posit- ive charges and make electrostatic interactions between surface amino acids and between surface amino acids and the substrate weaker. To counteract this, the VsEndA may have developed a more positively charged surface. It is possible that the surface charges of the two enzymes are similar at their respective phy- siological salt concentrations. The higher number of lysines seen in VsEndA may result in increased flexibil- ity, if the extra lysines repel other parts of the enzyme and do not form stabilizing salt bridges or hydrogen bonds. This may also lower the stability of the enzyme. The Na + ions may affect the solvation of the phos- phate groups in the DNA substrate, and it is possible that the enzymes also have adapted strategies to remove Na + around the phosphates of DNA before catalysis can take place. It seems clear that the salt- adapted and cold-adapted properties of VsEndA are intertwined. The differences in optimum pH for activity were % 0.5–1 unit between the two enzymes as shown in Fig. 4, with the optimum for VsEndA being shifted to VsEndA A 0 125 250 375 500 0.0 0.3 0.6 0.9 1.2 1.5 1.8 RNase DNase [NaCl] (mM) Rfu/s B VcEndA 0 50 100 150 200 0.0 0.3 0.6 0.9 1.2 1.5 1.8 DNase RNase [NaCl] (mM) Rfu/s Fig. 9. DNase and RNase activity with increasing amounts of NaCl. (A) VsEndA; (B) VcEndA. Enzyme was assayed using the DNase- Alert and RNaseAlert QC system kits. Each replicate is plotted and the mean values are drawn. B. Altermark et al. Endonuclease I from V. salmonicida and V. cholerae FEBS Journal 274 (2007) 252–263 ª 2006 The Authors Journal compilation ª 2006 FEBS 257 a higher pH. The pH optima for endonuclease activity show a similar trend to that for growth of the corres- ponding organisms. Activity in glycine buffer was very low compared with that in Tris buffer at the same pH. Citrate buffer has been shown to be inhibitory to Pro- teus mirabilis endonuclease I [13]. Citrate and perhaps also glycine may act as chelators that bind Mg 2+ and thereby inhibit enzymatic activity, similarly to EDTA. The carboxy group of the small amino-acid, glycine, may also replace water molecules, which are bound around the Mg 2+ ion of the enzyme and thereby inhi- bit activity. The kinetic analysis performed under optimal condi- tions for each enzyme (Table 2) shows that VsEndA is a better catalyst than VcEndA at all temperatures, and the differences in catalytic efficiency (k cat ⁄ K m ) increase with concomitant decrease in temperature. K m values for VcEndA are lower than for VsEndA, indicating that the former has slightly greater affinity for the sub- strate. However, k cat is very different for the two enzymes, especially at low temperatures, being 9 times higher for VsEndA than for VcEndA. It is clear that VsEndA adapts to lower temperatures by increasing the k cat . The similar K m values of the two enzymes may indicate that VsEndA is meant to function at high substrate concentrations, at which the increase in k cat is more important for adaptation to low temperatures [25]. The k cat values associated with both VsEndA and VcEndA increase exponentially at temperatures between 5 °C and 37 °C in accordance with the Arrhenius equation: k ¼ Ae ÀE a =RT ð1Þ According to Eqn (1), there is an exponential decrease in reaction rates (k) with decreasing temperature (T), and the extent of this decrease depends on the activa- tion energy, E a . The less steep slope for VsEndA when the temperature is lowered in the temperature opti- mum curve shown in Fig. 5 is a direct consequence of the lower energy of activation. Results from the thermodynamic calculations (Table 2) reveal that there is a slight difference in the free energy of activation between the two enzymes ori- ginating from both the lower activation enthalpy (DH # ) and activation entropy (TDS # )ofVsEndA. The TDS # values for VcEndA are positive, and, if we assume that VcEndA is more rigid than VsEndA, binding of substrate will not decrease the entropy of activation to the same extent as in the psychrophilic (and flexible) VsEndA. However, the method of calcu- lation, especially for DS # , must be carefully interpreted as stated by Cornish-Bowden [26]. Enthalpy calcula- tions based on the experimentally determined values of E a give more precise information, and it is clear that VsEndA has adapted to low temperatures by lowering the enthalpy of activation. DSC measurements show that VsEndA is less ther- mostable than VcEndA with an unfolding temperature that is 8 °C lower. This is in agreement with results from stability analysis of other cold-adapted enzymes, which show reduced temperature stability compared with their mesophilic homologues [27,28]. The results support the theory of increased structural flexibility leading to lower thermostability in cold-adapted enzymes. The NaCl concentrations in which the ther- mal scans were performed mimic the physiological con- ditions that each of the enzymes face in their natural environments. Thermal scans of VcEndA at [NaCl] optimal for VsEndA (425 mm) revealed a higher T m , and a thermal scan performed on VsEndA at [NaCl] optimal for VcEndA (175 mm) revealed a lower T m than those found in optimal buffers (data not shown). This highlights again that it is crucial to perform the comparative analysis under physiological conditions for each enzyme, as salt interferes with both the activ- ity and stability of enzymes. Reversibility could be detected by DSC, but the signal was very weak for both proteins, probably because of aggregation and destruction caused by the relatively long period at elevated temperatures. As shown in Fig. 7, VsEndA transforms into an irreversible unfolded state much faster than VcEndA. However, a half-life of 13 min at 70 °C for VsEndA is substantially higher than that of other cold-adapted enzymes [22]. Endonuclease I is located in the periplasmic or extracellular space, and the selective pressure to maintain stability must there- fore be high. It would be a waste of energy to secrete enzymes that denature quickly, so it is in the bacter- ium’s interest for the secreted enzymes to be long lived. However, it seems that, in order to achieve appropriate activity at low temperatures, the enzyme must sacrifice some of its stability. It has previously been suggested that the lower thermal stability of cold-adapted enzymes is simply a consequence of the lack of select- ive pressure for stability [29]. A lack of selective pres- sure for stability is not the case for this periplasmic ⁄ extracellular protein, and our results indi- cate that in order for it to be active at low tempera- tures, its stability must be reduced. The enzymes did not show any apparent difference in ability to degrade plasmid DNA, dsDNA or ssDNA. However, both VsEndA and VcEndA dis- played decreasing activity against the RNaseAlert sub- strate with concomitant increase in [NaCl], as shown in Fig. 9. At physiological NaCl concentration, the two enzymes have extremely low RNase activity and may be Endonuclease I from V. salmonicida and V. cholerae B. Altermark et al. 258 FEBS Journal 274 (2007) 252–263 ª 2006 The Authors Journal compilation ª 2006 FEBS considered solely as DNases. The highest RNase activity is in buffer without added NaCl, but it is still % 3.5 times (VsEndA) and 14 times (VcEndA) lower than the DNase activity in the same buffer. The opposite effect that NaCl addition seems to have on the RNase activity of the enzymes may be linked to an increase in Na + around the phosphate groups and the 2¢-OH, which reduces the negative charge, and hence the affinity of the enzyme decreases with increasing NaCl concentration. However, it seems clear that both VsEndA and VcEndA are intended to function purely as DNases in vivo. Conclusion Endonuclease I from the psychrophilic bacterium V. salmonicida is an enzyme that shows cold-adapted features, such as lower thermal stability, lower tem- perature optimum, and higher catalytic efficiency, when compared with the corresponding enzyme from the related mesophilic bacterium V. cholerae. The peri- plasmic or extracellular localization of these enzymes means that they are constantly exposed to the external environment of the bacterium. Their differences in enzymatic properties, such as pH optimum, salt opti- mum and catalytic efficiency, seem to be fine-tuned to match their respective environments. The salt-sensitive and relatively low RNase activity of the enzymes indi- cates that their physiological substrate is DNA. To our knowledge, VsEndA is the first endonuclease described that displays more than 90% activity against DNA in 0.5 m NaCl. This unique property in combination with high activity at low temperatures and low RNase acti- vity may be advantageous for future commercial exploitation. Determination of the crystal structure of VsEndA is in progress and will facilitate a detailed explanation of the mechanisms behind the observed cold-adapted properties, in addition to interesting dif- ferences in pH and salt optima. Experimental procedures Bacterial strains and molecular biology materials Genomic DNA from V. cholerae ATCC14035 and V. salm- onicida LFI1238 was extracted using the Wizard Genomic DNA Purification kit from Promega (Madison, WI, USA) according to the manufacturer’s protocol for Gram-nega- tive bacteria. The expression vector pBAD ⁄ gIII and chem- ically competent E. coli TOP10 cells were purchased from Invitrogen (Carlsbad, CA, USA). Oligonucleotide primers (Table 3) were purchased from Invitrogen and Sigma- Aldrich Co. (St Louis, MO, USA). Phusion DNA polym- erase from Finnzymes (Espoo, Finland) and Vent and Taq polymerase from Promega were used in the PCRs. Restric- tion enzymes NcoI and SalI were purchased from New England Biolabs (Ipswich, MA, USA), and T4 DNA ligase was purchased from Sigma-Aldrich. DNaseAlert TM and RNaseAlert TM QC System kit was purchased from Ambion Inc. (Austin, TX, USA) and Integrated DNA Technologies (Coralville, IA, USA). Construction of the expression plasmids The nucleotide sequences of VsEndA and VcEndA have the GenBank accession nos. DQ263597 and DQ263605, respectively. To facilitate cloning of the VsEndA gene into the pBAD ⁄ gIII b vector, a restriction site for SalI was first removed by point mutation using the overlap extension procedure [30]. PCR was conducted using primers 3 +4 and 1 +4 (Table 3), with genomic DNA from V. salmonicida as a template. In a 0.2-mL PCR tube, a total of 50 lL reaction mix containing 37.5 lL water, 5 lL10· ThermoPol reaction buffer, 3 lL 25 mm MgCl 2 ,1lL10mm dNTP, 1 lL each primer (10 lm), 1 lL template, and 1 U Vent polymerase was sub- jected to PCR using a DNA Engine (PTC-200) Peltier Ther- mal Cycler from Bio-Rad (Hercules, CA, USA). Thermal cycling conditions were 3 min at 94 °C followed by 30 cycles of 30 s at 94 °C, 30 s at 50 °C and 90 s at 72 °C. The pro- gram was ended by an extension step at 72 °C for 5 min, and then cooled to 4 °C. This PCR yielded one 656-bp and a 254- bp product when run on a 1% agarose gel. The 656-bp frag- ment was used as a template in a second PCR conducted under the same conditions as above, but with primers 3 +2. This PCR yielded a product of 423 bp. Purified 254-bp and 423-bp fragments were then used as a template in a third PCR using primers 3 +4. Thermal cycle conditions were the same as above except for an annealing temperature of 55 °C and use of 1 U Taq polymerase instead of Vent polymerase. The two primers 3 +4 contain restriction sites for SalI and NcoI, respectively, and the primers were created so that the gene would be amplified without the native N-terminal peri- plasmic signal. Instead, the periplasmic signal incorporated into the pBAD ⁄ gIII b vector would be used to transport the recombinant enzyme into the periplasmic space. The final PCR product was analyzed on an agarose gel and purified using the Qiaquick gel extraction kit from Qiagen (Hilden, Table 3. List of PCR primers. Restriction sites are underlined. No Sequence 1 GCTTTTAAAGTTGACTTCAAAG 2 CTTTGAAGTCAACTTTAAAAGC 3 CTA CCATGGCACCTCCTTCTTCTTTCTCAA 4 GCT GTCGACTTATTTAGTGCATGCTTTATAAACAA 5 CTA CCATGGCCCCCATCTCTTTTAGTCAT 6 GCT GTCGACTCAGTTCGGGCATTGCTCAC B. Altermark et al. Endonuclease I from V. salmonicida and V. cholerae FEBS Journal 274 (2007) 252–263 ª 2006 The Authors Journal compilation ª 2006 FEBS 259 Germany). The DNA fragment and the pBAD ⁄ gIII b vector were then digested with SalI and NcoI. The insert and vector were purified from a 1% agarose gel using the Qiaquick gel extraction kit. Vector and insert were ligated overnight at 16 °C using T4 DNA ligase before transformation into E. coli Top10 cells using the heat shock method. Positive col- onies resistant to ampicillin were selected and used for expression. The VcEndA was cloned using the same proce- dure as for VsEndA, but no mutation was necessary. The clo- ning primers for VcEndA are listed in Table 3. The plasmids were thereafter sequenced using the PE Biosystems BigDye Terminator Cycle Sequencing kit, ABI 377 Genetic Analyzer and ABI Sequence Analysis software according to the proto- col supplied by Applied Biosystems (Foster City, CA, USA). Enzyme expression and purification A Chemap CF 3000 fermentor (Chemap AG, 1 Volketswil, Switzerland) was used for production of the recombinant nucleases. First 7 L 2 · Luria–Bertani medium supplemen- ted with 60 mL 20% glucose was inoculated with a 200-mL overnight preculture and grown at 22 °C. The enzyme pro- duction was induced by adding 50 mL 14.5% l-arabinose when the glucose was depleted. The pH was held constant at 7.4 by addition of 1 m NaOH or 2 m H 2 SO 4 . Oxygen levels were automatically adjusted by increasing agitation speed when the level went below 20% of maximum. The cells were harvested 7 h after induction by centrifugation at 4225 g for 15 min at 4 °C. The cells were subjected to a combined lysozyme ⁄ osmotic shock treatment [31] to separ- ate the periplasmic fraction containing the recombinant protein. Harvested cells were resuspended in 800 mL of a fractionation buffer containing 20% sucrose, 1 mm EDTA and 100 mm Tris ⁄ HCl, pH 7.4. Lysozyme (Sigma) was added to a final concentration of 500 lgÆmL )1 , and the cell suspension was incubated for % 20 min at room tempera- ture. After centrifugation at 8281 g for 20 min, the superna- tant was collected as the periplasmic fraction and frozen at )80 °C. The thawed periplasmic fraction was centrifuged at 13 180 g for 20 min before application on a SP Sepharose FF column (2.6 ⁄ 10 cm; Amersham Pharmacia Biotech, Uppsala, 2 Sweden) pre-equilibrated with 100 mL buffer A (20 mm Tris ⁄ HCl, 5 mm MgCl 2 pH 8.3). The enzyme was eluted using a linear gradient from 0 to 100% buffer B (buffer A + 1 m NaCl). Fractions containing nuclease activity were pooled and concentrated using Centriprep Centrifugal Filter Units (molecular mass cut off, 10 kDa) from Millipore at 3000 g at 4 °C. Enzyme analysis The enzyme purity was analyzed by applying 5 lg protein to a 4–12% NuPAGE Novex Bis-Tris SDS ⁄ PAGE gel (In- vitrogen). The gel was stained with Simply Blue Safe Stain (Invitrogen) according to the manufacturer’s protocol. The protein concentration was determined using Bio-Rad Pro- tein Assay based on the method of Bradford [32] and according to the microtiter plate protocol described by the manufacturer using BSA as standard. N-Terminal signal sequence cleavage sites were predicted using the SignalP server [33]. Sequence alignment was performed using BioEdit [34], and the alignment was visualized using the ESPript server [35]. Theoretical isoelectric point, molecular mass and sequence composition were calculated using the protparam web-tool at ExPASy [36]. Enzyme assay The DNaseAlert TM QC System kit was used in the deter- mination of kinetic constants, pH optimum and optimum NaCl concentration of the two enzymes. The DNase- Alert TM substrate is a synthetic DNA oligonucleotide that has a HEX TM reporter dye (hexachlorofluorescein) on one end and a dark quencher on the other end. In all reactions, except for the kinetic measurements, 200 nm substrate was used. The reaction volumes were adjusted to 90 lL with nuclease-free water. Reactions were started by pipetting 10 lL of the diluted enzyme solution into eight wells with a multichannel pipette to a total reaction volume of 100 lL. Non-binding 1.5-mL tubes from Eppendorf (Hamburg, Germany) were used for enzyme dilution. New dilutions were made before each measurement because of the sticky nature of the enzymes. Black 96-well, low-protein-binding trays from Corning (Corning, NY, USA) were used in com- bination with a Spectramax Gemini fluorimeter from Molecular Devices (Sunnyvale, CA, USA) to detect the emitted fluorescence. The wavelengths for excitation ⁄ emis- sion were 535 ⁄ 556 nm, respectively. The initial velocity was calculated from a minimum of three linear readings on the time versus fluorescence curve using the program softmax pro (Molecular Devices). The fluorimeter was set to auto- mix for 1 s before the first read. A minimum of two parallel readings were determined under each condition at 23 °C. [NaCl] optimum, pH optimum, temperature optimum The optimum concentration of NaCl was measured in 75 mm Tris buffer with various concentrations of NaCl (0– 750 mm). The pH optimum was measured in 75 mm dietha- nolamine ⁄ HCl, pH 8–10, and 75 mm Tris ⁄ HCl, pH 7–9. In addition, 175 and 425 mm NaCl were added to the solution when VcEndA and VsEndA, respectively, were assayed. A modified Kunitz DNase assay was used for measuring optimum endonuclease activity of the two enzymes at dif- ferent temperatures. In all reactions, 200 lg calf thymus DNA (Sigma) dissolved in diluted TE buffer (1 mm Tris ⁄ HCl, pH 8.0, 0.1 mm EDTA) was used as substrate. Reactions were performed in assay buffers that were opti- mal for each enzyme [VsEndA, 425 mm NaCl ⁄ 20 mm Endonuclease I from V. salmonicida and V. cholerae B. Altermark et al. 260 FEBS Journal 274 (2007) 252–263 ª 2006 The Authors Journal compilation ª 2006 FEBS Tris ⁄ HCl (pH 8.5) ⁄ 5mm MgCl 2 ; VcEndA, 175 mm NaCl ⁄ 20 mm Tris ⁄ HCl (pH 8.0) ⁄ 5mm MgCl 2 ], and the buffer pH was adjusted at the respective assay tempera- tures. The total reaction volume was 1 mL. Reaction mix- tures were preincubated for 5–10 min at the respective assay temperatures before the addition of enzyme. The same amount of enzyme (VsEndA 1.5 ng, VcEndA 4.2 ng) was used at each temperature. Reactions were allowed to proceed for 20 min and then stopped by adding 0.5 mL ice- cold 12% perchloric acid. For blank reactions, enzyme was added after the addition of perchloric acid. Quenched assay solutions were incubated on ice for 20 min, centrifuged for 10 min at 16 000 g, and the A 260 was measured for the supernatants in triplicate. Enzyme kinetic measurements Fixed amounts of enzyme were incubated at seven different substrate concentrations ranging from 23 to 1470 nm at 5, 15, 25, 30 and 37 °C in a total reaction volume of 100 lL. The amounts of VsEndA enzyme used were 0.69, 0.44, 0.21, 0.15 and 0.069 ng at 5, 15, 25, 30 and 37 °C, respect- ively. For VcEndA the amounts used at these temperatures were 4.2, 0.21, 0.56, 0.31 and 0.14 ng, respectively. Assay buffer was optimal for each enzyme [VsEndA, 425 mm NaCl ⁄ 75 mm diethanolamine (pH 8.5) ⁄ 5mm MgCl 2 ; VcEndA, 175 mm NaCl ⁄ 75 mm diethanolamine (pH 8.0) ⁄ 5mm MgCl 2 ]. The buffer pH was adjusted at the respective assay temperatures. The initial velocities were recorded and the program sigma plot (Systat 3 Software, Inc., San Jose, CA, USA) was used for estimation of the V max and K m for each enzyme by fitting the velocity data to the Michaelis– Menten equation using nonlinear regression. All measure- ments were performed in triplicate for each substrate concentration. The k cat values were calculated using the for- mula V max ⁄ [enzyme]. The amount of fluorescence emitted per nmol substrate was calculated from a standard curve obtained by measuring the maximum fluorescence emitted as a function of various substrate concentrations. By using this linear standard curve (slope, 0.88; intercept, 21.8), values of V max were converted from relative fluorescence unitsÆs )1 to nmolÆs )1 . The calculated molecular masses for VsEndA and VcEndA were 25005.41 gÆmol )1 and 24731.72 gÆmol )1 , respectively. Thermodynamic activation parameters were calculated as described by Lonhienne et al. [37]. Activation energy, E a , was extracted from the slope of the linear regression curve obtained from an Arrhenius plot of 1 ⁄ T versus lnk cat . Stability measurements DSC measurements were performed using the Nano-Differ- ential Scanning Calorimeter III, model CSC6300 (Calori- metry Sciences Corp., Lindon, UT, USA). The IUPAC (International Union of Pure and Applied Chemistry) recommendations for DSC measurements and analysis [38] were used as a guideline. The scan rate was set to 1 °CÆmin )1 , and the scans were performed from 25 to 85 °C at a constant pressure of 304 kPa. All samples were dia- lyzed overnight against 50 mm Hepes, pH 8.0, containing 5mm MgCl 2 and 175 mm NaCl or 425 mm NaCl at 4 °C. The dialysates were used in the reference cell and for buffer baseline determination. The thermograms obtained were analyzed using the computer program cpcalc (Calorimetry Sciences Corp.), and the T m (temperature corresponding to the maximum of the peak) was extracted. The exact protein concentrations (typically between 0.5 and 1 mgÆmL )1 ) were measured before DSC analysis. Reversibility of unfolding was checked by rapid cooling to 4 °C, waiting for 1 h, fol- lowed by a second scan. The molecular masses used to con- vert the DSC data to molar heat capacity are as described above. Kinetic stability was determined by incubating equal amounts of enzyme (dissolved in optimal buffer for activity as described above) in a PCR machine heated to 70 °C. Samples were removed after 10 min and incubated for 1 h on ice before being assayed using the DNaseAlert QC Sys- tem kit. Samples incubated for 1 h on ice only served as the 100% activity reference. Measurement of substrate specificity Enzyme specificity towards dsDNA, ssDNA and plasmid were analyzed using linearized pBAD ⁄ gIII plasmid, linea- rized and denatured plasmid and intact plasmid. The pBAD ⁄ gIII plasmid was linearized using SalI and dena- tured by incubation at 98 °C in a PCR machine for 3 min, and then kept on ice. Approximately 300 ng of the various substrates was mixed with 30 ng enzyme in a total volume of 20 lL containing 1 mm MgCl 2 and 75 mm diethanolam- ine buffer with optimal [NaCl] and pH for each enzyme. After 5 min of incubation at 23 °C, the reaction was stopped by the addition of 5 lL 0.5 m EDTA. The samples were analyzed on a 1% agarose gel for 1 h at 90 V and visualized by ethidium bromide staining. The substrates were also incubated without enzyme as a reference. Activity towards RNA was measured using the RNase- Alert QC System kit with the same instrumental set up as for the DNaseAlert system mentioned above, except that the wavelengths used for excitation ⁄ emission were 490 ⁄ 520 nm, respectively. Measurements were taken every 64 s for 20 min. The effect of [NaCl] on the RNase activity was measured in 75 mm diethanolamine ⁄ HCl at pH 8.5 for VsEndA and pH 8.0 for VcEndA with increasing concen- trations of NaCl (0–425 mm for VsEndA, 0–175 mm for VcEndA) including 5 mm MgCl 2 per 100 lL reaction mix- ture. The maximum fluorescence obtained with 200 nm RNaseAlert and DNaseAlert was measured by adding 5 lL RNase A (0.01 UÆmL )1 ) to wells with RNaseAlert substrate after the initial measurements and 2 lL undiluted VcEndA to wells with DNaseAlert substrate. The initial velocities B. Altermark et al. Endonuclease I from V. salmonicida and V. cholerae FEBS Journal 274 (2007) 252–263 ª 2006 The Authors Journal compilation ª 2006 FEBS 261 [...]... proteins from the Escherichia coli periplasm Enzyme Microb Technol 19, 332–338 32 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72, 248–254 Endonuclease I from V salmonicida and V cholerae 33 Bendtsen JD, Nielsen H, von Heijne G & Brunak S (2004) Improved prediction of signal peptides:... DV (2001) Endonuclease from Proteus mirabilis Prikl Biokhim Mikrobiol 37, 43–47 14 Hanahan D (1983) Studies on transformation of Escherichia coli with plasmids J Mol Biol 166, 557–580 15 Focareta T & Manning PA (1991) Distinguishing between the extracellular DNases of Vibrio cholerae and development of a transformation system Mol Microbiol 5, 2547–2555 16 Kawagishi I, Okunishi I, Homma M & Imae Y (1994)... Alvheim K, Dommarsnes K, Syvertsen C & Sorum H (2002) Relevance of incubation temperature for Vibrio salmonicida vaccine production J Appl Microbiol 92, 1087–1096 4 Hochachka PW & Somero GN (1984) Biochemical Adaptation Princeton University Press, Princeton, NJ 5 Wu SI, Lo SK, Shao CP, Tsai HW & Hor LI (2001) Cloning and characterization of a periplasmic nuclease of Vibrio vulnificus and its role in preventing... deoxyribonuclease (DNase) together with its periplasmic localization in Escherichia coli K-12 Gene 53, 31–40 10 Lehman IR, Roussos GG & Pratt EA (1962) The deoxyribonucleases of Escherichia coli II Purification and properties of a ribonucleic acid-inhibitable endonuclease J Biol Chem 237, 819–828 262 11 MacLellan SR & Forsberg CW (2001) Properties of the major non-specific endonuclease from the strict... proteomics server for in-depth protein knowledge and analysis Nucleic Acids Res 31, 3784–3788 37 Lonhienne T, Gerday C & Feller G (2000) Psychrophilic enzymes: revisiting the thermodynamic parameters of activation may explain local flexibility Biochim Biophys Acta 1543, 1–10 38 Hinz HJ & Schwarz FP (2001) Measurement and analysis of results obtained on biological substances with differential scanning calorimetry... Phillips GN Jr (2004) Structures and analysis of highly homologous psychrophilic, mesophilic, and thermophilic adenylate kinases J Biol Chem 279, 28202–28208 28 Georlette D, Damien B, Blaise V, Depiereux E, Uversky VN, Gerday C & Feller G (2003) Structural and functional adaptations to extreme temperatures in psychrophilic, mesophilic, and thermophilic DNA ligases J Biol Chem 278, 37015–37023 29 Wintrode... SignalP 3.0 J Mol Biol 340, 783–795 34 Hall TA (1999) BioEdit: A user-friendly biological sequence alignment editor and analysis program for windows 95 ⁄ 98 ⁄ NT Nucleic Acids Symp Ser 41, 95–98 35 Gouet P, Courcelle E, Stuart DI & Metoz F (1999) ESPript: analysis of multiple sequence alignments in PostScript Bioinformatics 15, 305–308 36 Gasteiger E, Gattiker A, Hoogland C, Ivanyi I, Appel RD & Bairoch... anaerobe Fibrobacter succinogenes and evidence for disulfide bond formation in vivo Microbiology 147, 315–323 12 Nakasone K, Kato C & Horikoshi K (2002) Cloning and sequencing of the endA gene encoding deoxyribonuclease from a deep-sea piezophilic bacterium, Shewanella violacea strain DSS12 Reports of Japan 4 Marine Science and Technology Centre 45, 63–68 13 Salikhova ZZ, Sokolova RB, Ponomareva AZ & Iusupova... Robert-Baudouy J (1995) Purification and characterization of the nuclease NucM of Erwinia chrysanthemi Biochim Biophys Acta 1262, 133–138 22 Siddiqui KS & Cavicchioli R (2006) Cold-adapted enzymes Annu Rev Biochem 75, 403–433 23 Mevarech M, Frolow F & Gloss LM (2000) Halophilic enzymes: proteins with a grain of salt Biophys Chem 86, 155–164 24 Oren A, Larimer F, Richardson P, Lapidus A & Csonka LN (2005)... (1994) Removal of the periplasmic DNase before electroporation enhances efficiency of transformation in the marine bacterium Vibrio alginolyticus Microbiology 140, 2355– 2361 17 Moulard M, Condemine G & Robert-Baudouy J (1993) Search for the function of the nuclease NucM of Erwinia chrysanthemi FEMS Microbiol Lett 112, 99–103 18 Moulard M, Condemine G & Robert-Baudouy J (1993) Characterization of the nucM . Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae Bjørn Altermark 1 , Laila Niiranen 2 , Nils. and mildly halophilic bacterium Vibrio salmonicida and from the mesophilic brackish water bacterium Vibrio cholerae have been cloned, over-expressed in Escherichia