Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress Anne-Leila Meistertzheim 1 , Arnaud Tanguy 2 , Dario Moraga 1 and Marie-The ´ re ` se The ´ bault 1 1 Laboratoire des Sciences de l’Environnement Marin, Institut Universitaire Europe ´ an de la Mer, Universite ´ de Bretagne occidentale, Plouzane ´ , France 2 Laboratoire Adaptation et Diversite ´ en Milieu Marin, Station Biologique, Roscoff, France The fluctuating thermal nature of the marine environ- ment induces physiological changes in ectotherms that require molecular and gene expression adjustments [1]. Comparative gene expression studies can be used to characterize these adjustments and lead to a better understanding of organismal responses to environmen- tal change. Gene expression datasets can be clustered into groups of genes that represent different compart- ments of cellular function, and changes in the expres- sion of genes from these clusters can be used to formulate hypotheses as to how different tissues and whole organisms respond to particular biotic or abiotic stresses. Few studies have addressed changes in gene expression in response to temperature variation on marine organisms. Alterations in gene expression have been observed in fish acclimated to constant tempera- tures and then exposed to daily temperature fluctua- tions [2] or to a strong heat stress [3]. However, few molecular investigations have focused on the thermal stress response in marine invertebrates [4,5], particu- larly in the context of global changes and the potential effects on marine invertebrates [6,7]. The Pacific oyster Crassostrea gigas is a eurythermic bivalve mollusc that colonizes most of the western coast of Europe. This species prefers sheltered estua- rine waters, where it is found in intertidal and shallow subtidal zones. Within their geographic range, oysters typically experience and respond to seasonal tempera- tures ranging from 4 to 24 °C [8]. In the coldest regions inhabited by C. gigas, such as Brittany, Keywords climate; Crassostrea gigas; gene expression; heat stress; prolonged thermal stress Correspondence M. T. The ´ bault, Laboratoire des Sciences de l’Environnement Marin, UMR-CNRS 6539, Institut Universitaire Europe ´ en de la Mer, Universite ´ de Bretagne Occidentale, Place Nicolas Copernic, 29280 Plouzane ´ , France Fax: +33 2 98 49 86 45 Tel: +33 2 98 49 86 12 E-mail: marie-therese.thebault@univ-brest.fr (Received 5 April 2007, revised 17 October 2007, accepted 19 October 2007) doi:10.1111/j.1742-4658.2007.06156.x Groups of oysters (Crassostrea gigas) were exposed to 25 °C for 24 days (controls to 13 °C) to explore the biochemical and molecular pathways affected by prolonged thermal stress. This temperature is 4 °C above the summer seawater temperature encountered in western Brittany, France where the animals were collected. Suppression subtractive hybridization was used to identify specific up- and downregulated genes in gill and mantle tissues after 7–10 and 24 days of exposure. The resulting libraries contain 858 different sequences that potentially represent highly expressed genes in thermally stressed oysters. Expression of 17 genes identified in these libraries was studied using real-time PCR in gills and mantle at differ- ent time points over the course of the thermal stress. Differential gene expression levels were much higher in gills than in the mantle, showing that gills are more sensitive to thermal stress. Expression of most transcripts (mainly heat shock proteins and genes involved in cellular homeostasis) showed a high and rapid increase at 3–7 days of exposure, followed by a decrease at 14 days, and a second, less-pronounced increase at 17–24 days. A slow-down in protein synthesis occurred after 24 days of thermal stress. Abbreviations CTSL, cathepsin L; EST, expressed sequence tag; HYPK, Huntingtin-interacting protein K; HSP, heat shock protein; LDH, lactate dehydrogenase; MTA-1, metastasis-associated protein 1; SSH, suppression substractive hybridization. 6392 FEBS Journal 274 (2007) 6392–6402 Journal compilation ª 2007 FEBS. No claim to original French government works France, summer water temperatures only occasionally reach 21 °C for short periods of up to a few days. Recent studies on C. gigas suggest that complex inter- actions between temperature and food quality and quantity affect gametogenesis [9,10]. Reproductive development is temperature dependent in C. gigas and typically occurs between February and September along the western Atlantic coast of France [11]. Spawning occurs at a minimum seawater temperature of $ 19 °C [12,13]. One study focused on the expres- sion of heat shock proteins (HSPs) in C. gigas, at the molecular and physiological level, in response to heat stress throughout the year [7]. The aim of this study was to improve our knowledge of differentially expressed genes in C. gigas exposed to a temperature slightly above the upper natural water temperature in the area. Our study is the first to apply an overall genomic approach to the study of the response of C. gigas to prolonged heat stress. We used animals outside the season of reproductive develop- ment and spawning in order to measure temperature stress without the onset of reproduction. Using sup- pression substractive hybridization (SSH), we identified genes that were up- and downregulated 7–10 and 24 days after transfer from 13 to 25 °C. Subsequently, genes likely to be associated with thermal stress were quantified using quantitative real-time PCR. Results Suppression subtractive hybridization SSH libraries were constructed from pooled gills and mantle of C. gigas after 7–10 and 24 days of exposure to different temperature treatments. The search for homology using the blastx program revealed 858 different sequences, of which 536 ($ 62%) remain unidentified. Expressed sequence tags (ESTs) similar to genes potentially involved in a thermal response were subsequently clustered into 15 distinct functional cate- gories: cell differentiation (including cell migration, adhesion, proliferation and apoptosis), cellular com- munication (including signal transduction), cellular stress (including inflammation and immune response), cytoskeleton and cell structure (including cellular matrix and cellular trafficking), detoxification, ener- getic metabolism, lipid metabolism, receptors and channels, regulation of nucleosides, nucleotides and acid nucleic metabolism, reproduction, respiratory chain, transcriptional processing, translational and post-translational processing, general metabolism and other functions and ribosomal proteins (Fig. 1 and supplementary Tables S1–S4). Among the 322 recognized protein-coding genes, 191 new sequences were obtained in C. gigas and 131 had been identified previously, of which 88 genes encode ribosomal pro- teins in both forward and reverse libraries. Among the newly known sequences, only one corresponded to a gene specific for mantle (mantle gene 4). No cellular signalling genes were identified in samples taken after 24 days. Cytoskeletal genes, translation and ribosomal genes were less abundant on warming. Only respira- tory genes were more abundant on warming. Gene expression patterns from different functional categories during temperature acclimation Using real-time PCR we conducted a time-course study to compare transcript expression in oysters exposed to thermal stress at 25 °C relative to control animals maintained at 13 °C. Seventeen transcripts analysed after 0, 3, 7, 14, 17 and 24 days of exposure (Fig. 2) belonged to categories previously implicated in the stress response: (a) cell proliferation and differenti- ation: metastasis-associated protein 1 (MTA-1), Hun- tingtin-interacting protein K (HYPK), cystatin B, cathepsin L (CTSL, EC 3.4.22.15) (these proteins are known tumor markers) [14,15], QM protein (transcrip- tional control of cell differentiation and proliferation) [16,17], Ras family GTP-binding protein Rho1p (dif- ferentiation); (b) cellular stress: HSP70, HSP70 kDa protein 12A, HSP23, chaperonin-containing TCP1 (alternative name CCT) subunit 7, isoform b (chaper- ones), inhibitor of kappa light polypeptide (inflamma- tion); (c) antioxidant defense: non-selenium glutathione peroxidase (EC 1.11.1.7); (d) metabolism of nitrogen and ammonia detoxification: glutamine synthetase (EC 1.4.1.13); (e) membrane fluidity: D9 desaturase (EC 1.14.19.1); (f) energetic metabolism: d-lactate dehydrogenase (d-LDH, EC 1.1.1.28, anaerobic metab- olism), citrate synthase (EC 2.3.3.1, aerobic metabo- lism); and (g) translational processing (translation initiation factor eIF-2B delta subunit). Normalized expression data are summarized in Table 1. In the gills, all transcripts selected in the forward SSH library at 25 °C, except citrate synthase, showed an initial expression peak at days 3–7, followed by a decrease at day 14, and then a smaller increase at days 17–24 at 25 °C compared with controls (13 °C) (Fig. 2A and Table 1). The most differentially expressed transcripts at 25 °C were HSPs, MTA-1 pro- tein, chaperonin-containing TCP1 subunit 7, isoform b and d-LDH. Gene expression was less pronounced in mantle relative to the gills (Fig. 2). In the mantle, some transcripts (HSP70, HSP23, MTA-1 protein, Rho1p, A L. Meistertzheim et al. Thermal stress-induced gene expression in C. gigas FEBS Journal 274 (2007) 6392–6402 Journal compilation ª 2007 FEBS. No claim to original French government works 6393 D9-desaturase and glutamine synthetase) showed a peak of overexpression at days 14 and ⁄ or 17. In con- trast to observations on gill tissue, mantle levels of HSP12A, MTA-1 protein, Rho1p, D9-desaturase and citrate synthase transcripts were significantly lower at 25 °C on day 3. Variation in the expression of d-LDH and chaperonin-containing TCP1 subunit 7, isoform b genes was not significant. Different profiles were observed for transcripts selected from the reverse SSH library at 13 °C (Fig. 2B and Table 1). In gill tissue, inhibitor of kappa light polypeptide, non-selenium glutathione peroxidase, CTSL and translation initiation factor eIF-2B were highly expressed at days 3 and ⁄ or 7 at 25 °C relative to control (13 °C). CTSL, non-selenium glutathione peroxidase and translation initiation factor eIF-2B were downregulated at day 24 in gills at 25 °C. Expres- sion of the HYPK gene did not show much variation, although it increased significantly from the beginning to the end of the experiment. Cystatin B, inhibitor of kappa light polypeptide and QM protein (60S ribo- somal protein) showed a biphasic expression pattern. In mantle cells, variation in expression levels of CTSL and inhibitor of kappa light polypeptide genes was not significant. Overexpression of cystatin B, non-selenium glutathione peroxidase and translation initiation factor eIF-2B transcripts was limited to a relatively short time-window at days 14 and ⁄ or 17. HYPK and QM protein were underexpressed at days 3, 7 and 24 and day 7, respectively. Discussion Of 322 genes identified in this study, 191 partial sequences had not been identified previously in C. gigas. Of the 131 known genes, 88 encode ribo- somal proteins and had been identified previously in C. gigas responding to environmental stresses such as hydrocarbons, pesticides and hypoxia [18–20]. Thus, their gene products appear to be important for Cell differentiation, migration, adhesion, proliferation, apoptosis Cellular communication, signal transduction Cellular stress, inflammation, immune function Cytoskeleton, structure, matrix and cellular trafficking Detoxification Energetic metabolism General metabolism, others functions Lipid metabolism Receptors and channel Regulation of nucleoside, nucleotide and nucleic acid metabolism Reproduction Respiratory chain Transcriptional processing Translational and post-translational processing Ribosomal proteins A1 A2 B1 B2 3% 10% 9% 1% 5% 6% 2% 9% 4% 1% 11% 5% 6% 26% 11% 8% 6% 12% 3% 9% 2% 9% 3% 35% 2% 5% 5% 15% 1% 7% 5% 8% 6% 17% 32% 6% 8% 11% 3% 3% 14% 17% 28% 8% 5% 3% Fig. 1. Functional classification of the sequences identified in SSH libraries which matched known genes corresponding to the 100% value. SSH were made from pooled gills and mantle of C. gigas. Genes were clustered into 15 categories according to their putative biological function. A1 and A2, 25 and 13 °C at 7–10 days; B1 and B2, 25 and 13 °C at 24 days. Thermal stress-induced gene expression in C. gigas A L. Meistertzheim et al. 6394 FEBS Journal 274 (2007) 6392–6402 Journal compilation ª 2007 FEBS. No claim to original French government works Relative expression * 0 5 10 0 5 Heat shock protein 12A 10 0 5 10 Heat shock protein 23Heat shock protein 70 0 5 037141724 0 5 037141724 0 5 0371417 24 * * * * * * * * * * * * * * * * * * 0 5 10 0 5 10 Metastasis associated protein1 Ras family GTP- binding protein Rholp 0 5 037141724 0 5 037141724 * * * * * * Chaperonin containing TCP1, sub. 7 0 0 5 037141724 5 10 * * * * * * * * * * 0 5 10 0 5 10 Glutamine synthetase D-lactate dehydrogenase 0 5 037141724 0 5 037141724 0 5 037141724 0 5 10 9 desaturase * * * * * * * * * * * * * * Exposure duration (days) Exposure duration (days) * Citrate synthase 0 5 10 0 5 037141724 * * 10 * * Huntingtin interacting protein K Inhibitor of kappa light polypeptide 0 5 0 5 10 0 5 037141724 0 5 037141724 * * * * * * * * * * ** * 0 5 037141724 QM Protein 0 5 10 * * * * * * * Non-selenium glutathione peroxidase 10 Cathepsin L Cystatin B 0 5 0 5 10 0 5 10 15 0 5 0371417 24 0 5 03714 17 24 0 5 037141724 * * * * * * * * * * * Translation initiation factor eIF-2B 0 5 10 0 5 037141724 * * * * A B Fig. 2. Results from real-time RT-PCR showing temporal expression patterns of some representative cDNA transcripts over a 24-days period from the 25 °C (A) and 13 °C (B) SSH libraries. Relative expression levels were normalized to 18S RNA. Bars represent the mean of three replicates per sampling point and the error bars correspond to the SD (black, gills; grey, mantle). Hatched and solid bars represent the relative amount of expression at 13 °C (control group) and 25 °C (treated group), respectively. Comparison between control and treated groups was made using Student’s t-test. *Significant at the 5% level. A L. Meistertzheim et al. Thermal stress-induced gene expression in C. gigas FEBS Journal 274 (2007) 6392–6402 Journal compilation ª 2007 FEBS. No claim to original French government works 6395 metabolic adjustments during stress in general. How- ever, the expression patterns observed were tissue spe- cific with gills being more responsive than mantle. We hypothesize that the observed patterns reflect func- tional differences between these two tissues. A number of genes that were highly expressed in gills showed a biphasic expression pattern, consisting of a strong short- and a moderate long-term response. Moreover, after 7–10 days of exposure, we detected differential expression of a number of genes that encode elements of the transcription and translation machinery, includ- ing transcription factors, ribosomal proteins and elon- gation factors. After 24 days of exposure to elevated temperature, the differential expression profile was Table 1. Expression patterns in gills (G) and mantle (M) throughout the experiment at 25 versus 13 °C. For each gene, + (or –) represents significant relative upregulation (or downregulation): + ⁄ ) from 1.2- to 2-fold; ++ ⁄ )) from 2- to 5-fold; +++ ⁄ )) from 5- to 10-fold; ++++ > 10-fold. NS, not significant. *P < 0.05, **P < 0.01, ***P < 0.001. Days of exposure Tissue 3 7 14 17 24 G MG MGM GMGM Cell proliferation and differentiation MTA-1 + ++ NS NS NS +++ NS NS ++ NS ** * ** HYPK ++ ) + )) +++ ++ ++)) *** ** *** *** * *** *** *** *** *** Ras family GTP-binding protein Rho1p ++ )) NS NS + ++ + + ++ NS *** ** * ** ** ** *** Cystatin B + NS ) NS NS ++ NS NS ++ NS ** * ** ** CTSL NS NS ++++ ** NS NS NS NS NS )) * NS QM protein ++ NS + )) ) +++ NS + ++ NS *** * ** * *** *** *** Cellular stress HSP70 ++ NS + NS NS ++ ++ NS ++ NS ** * * * ** Heat shock 70 kDa protein 12A ++ )) ++ NS ++ NS ++ NS + NS *** * *** ** ** ** HSP23 ++ NS +++ NS NS ++++ ++ ++ NS NS *** *** ** * ** Chaperonin containing TCP1, subunit 7, isoform b, isoform 1 ++ NS ++ NS ++ NS ++ NS ++ NS *** *** ** ** ** Inhibitor of kappa light polypeptide enhancer in B cells, kinase complex ++ NS +++ NS + NS + NS + NS *** *** * * * Antioxidant defeNSe Non-selenium glutathione peroxidase ++++ )) ++ NS )) NS NS ++ )) NS *** ** *** *** ** *** Metabolism of nitrogen and ammonia detoxification Glutamine synthetase + NS + NS NS +++ + ++ ++ NS * * ** * ** *** Membrane fluidity Delta-9-desaturase +++ )) + NS NS ++ + +++ ++ NS *** ** * ** ** *** *** Energetic metabolism Citrate synthase +++ )) ++ NS NS NS NS NS NS NS *** ** *** D-LDH +++ NS ++ NS NS NS ++ NS ++ NS *** *** ** ** Translational processing Translation initiation factor eIF-2B delta subunit +NSNSNSNS++++NS)) NS *** ** ** ** Thermal stress-induced gene expression in C. gigas A L. Meistertzheim et al. 6396 FEBS Journal 274 (2007) 6392–6402 Journal compilation ª 2007 FEBS. No claim to original French government works dominated by strong downregulation of genes involved in protein synthesis, such as the translation initiation factor eIF-2B delta subunit, suggesting a slowing of protein synthesis. These findings may suggest that transcription factors are regulated though a feedback mechanism, inducing their own inactivation [21]. Changes in gene expression of organisms subjected to thermal stress are known to involve major adjustments in the expression of ribosomal genes and genes coding for proteins involved in RNA metabolism and protein synthesis. In fact, protein synthesis in marine snails was inactivated at temperatures approaching lethal values [22]. Under mild thermal stress at 25 °C, genes coding for antistress proteins were differentially expressed. Protec- tion against cellular stress, inflammation and stimula- tion of immune function appear to be important components of responses to thermal stress. HSPs play an essential role in maintaining protein homeostasis during exposure to proteotoxic stressors [23]. They function by interacting with stress-denatured proteins and preventing their aggregation and ⁄ or degradation [24]. HSP induction may therefore have an adaptative value for organisms facing thermal stress and signifi- cant ecological and biogeographical implications for species distribution and their thermotolerance limits [22,25]. Tissue-specific de novo HSPs synthesis was induced in C. gigas following exposure to 25 °C, which is 4 °C higher than the highest sea surface tempera- tures recorded in its distribution range. Two HSPs (HSP70 and HSP23) were greatly and rapidly upregu- lated in gills but slightly less and later in mantle. One inducible and two constitutive isoforms of HSP70 are synthesized in the gills and mantle of C. gigas [26]. The expression level of the constitutive forms increases after thermal stress, whereas the inducible one is expressed only after exposure to 32 °C [7]. These results suggest that the overexpression of HSP70 we observed might correspond to the constitutive form. HSP23 is a small heat shock protein highly induced following stress. Small HSPs are differentially expressed between tissues and through the different stages of development [27]. A third HSP, HSP12A (alternative name 150 kDa oxygen-regulated protein; ORP150), was induced in gill tissue only. This chaper- one, located in the endoplasmic reticulum, plays an important role in maintaining cell viability in response to stress [28]. Among other chaperones, the chapero- nin-containing TCP1 (subunit 7, isoform b) presented the same expression pattern in response to heat stress in our study. This complex, involved in folding actin, tubulin and cyclin E, among other proteins [29], is also upregulated in response to chemical stress [30]. Hence TCP1 may play an important role in the recovery of cells after protein damage, by assisting the folding of cytoskeletal proteins that are actively synthesized and ⁄ or renatured under these conditions. The upregu- lation of all of these chaperones confirms the severity of the thermal stress under our experimental condi- tions. A number of genes encoding structural components of the cytoskeleton and proteins involved in contractile functions (including actin, tubulin myosin and profilin) were differentially expressed in C. gigas in response to prolonged heat stress, some were induced and some repressed. Rho1p, for example, encodes for a protein involved in numerous processes including actin fila- ment organization and is expressed in response to envi- ronmental changes [31]. In this study, Rholp was rapidly upregulated in gills and later in mantle during warming. These results suggest that extensive cytoskel- etal reorganization occurs in response to heat stress, as reported for fish gills [3]. Furthermore, several genes associated with the regu- lation of cell homeostasis were differentially expressed in our study. Some genes were differentially expressed in both tissues, showing increased apoptotic ⁄ autopha- gic activity. Among these genes, MTA-1 was strongly expressed in gills during warming, whereas it was ini- tially downregulated in mantle. CTSL, a highly potent endoprotease involved in lysosomal bulk proteolysis, was strongly expressed, but only in gills. The upregula- tion of CTSL, combined with the downregulation of its reversible binding inhibitor cystatin B, implies that active protein degradation was taking place in the gills upon warming to 25 °C. Two less well-known genes, putatively involved in proliferation and apoptosis, QM protein and HYPK were both differentially expressed between the tissues. QM protein, also known as ribo- somal protein L10, is a transcription cofactor that inhibits activation of AP-1 transcription factors. QM protein is implicated in the conversion of a broad vari- ety of extracellular signals generated by growth factors, tumour promoters or genotoxic drugs [16,32]. In the sponge, Suberites domuncula, QM protein expression was significantly higher in tissues undergoing induced apopotosis [33]. On warming to 25 °C, upregulation of QM protein occurred rapidly in gills and later in man- tle. HYPK, identified as a antiapoptotic protein [34], displayed the same expression pattern as QM protein in both tissues. These results suggest that, in C. gigas, these proteins are induced to prevent pathologies such as inflammation and tumorigenesis during prolonged thermal stress. The cellular stress response has an energetic cost and control of the balance between ATP supply and A L. Meistertzheim et al. Thermal stress-induced gene expression in C. gigas FEBS Journal 274 (2007) 6392–6402 Journal compilation ª 2007 FEBS. No claim to original French government works 6397 demand in the ciliated gill may become altered during thermal stress. In C. gigas, stressors such as hydro- carbons, herbicides, parasite infection or hypoxia [18–20,35], affect the expression of genes involved in energetic metabolism and our results show that changes in transcript levels of a number of genes involved in metabolic regulation also occur in response to temperature. In gill tissue, prolonged heat stress resulted in the rapid induction of several ATP-generat- ing enzymes including the tricarboxylic acid cycle citrate synthase, suggesting that there was a need for rapid aerobic ATP production. In the early phase of warming, the rapid induction of LDH in gills may indicate that anaerobic metabolism is required. The LDH that we identified was d-specific. Many system- atic studies have shown that d-orl-specific LDHs are present in all invertebrate groups [36]. We also observed that the glutamine synthetase gene was up- regulated in both tissues, as previously observed in response to hydrocarbons, herbicides or hypoxia [18–20]. In vertebrates, glutamine synthetase occupies a central position in nitrogen metabolism and is linked to amino acid turnover, nitrogen detoxification, nucleotide biosynthesis and more generally to growth [37]. Although the capacity for glutamine biosynthesis is generally weak or absent in molluscs [38], a recent study reported the accumulation of glutamine associ- ated with an upregulation of glutamine synthetase in a bivalve species in response to aerial exposure [39]. Glutamine synthesis may also be an ammonia detoxifi- cation mechanism in invertebrates. Genes involved in fatty acid metabolism are expected to be affected by temperature. Among these, D9 desaturase has been extensively studied in numer- ous animal groups including mammals, chicken, fish and insects [40,41]. High temperatures typically increase membrane fluidity in temperate eurytherms [42]. The upregulation of D9 desaturase that we observed in gills, and later in mantle, agrees with this pattern. A similar pattern was previously observed in C. gigas in response to experimental hypoxia, suggest- ing that the regulation of this enzyme may be affected primarily by oxidative stress [24]. Recent studies on intertidal bivalves show that critical warming may exacerbate cellular oxidative stress [43]. In many spe- cies, the increase in lipid peroxidation and reactive oxygen species concentration in cells following heat stress has already been shown to modify the activity of antioxidant enzymes such as GPx [44]. Non-selenium glutathione peroxidase is involved in detoxification by reducing fatty acid hydroxyperoxides and H 2 O 2 [45]. In our study, the level of the non-selenium glutathione peroxidase transcript appears strongly upregulated in gills during the first week of thermal exposure. A simi- lar thermal stress response, associated with oxidative stress, has also been observed in other marine poikilo- thermic species including molluscs [43,46–48]. Our results represent the first stages of investigation into the molecular response of oysters to high tempera- tures, focusing on early winter, outside the gametogen- esis period. Future efforts will focus on the search for functional polymorphism in some of the genes poten- tially regulated by temperature in oyster populations located at the limits of the species distribution area. Experimental procedures Thermal acclimation and experimental design Adult oysters (length 85 ± 5 mm) were collected from La Pointe du Chaˆ teau (Brittany, France) in November 2004 (seawater temperature 13 °C) and kept constantly immersed at ambient temperature ($ 13 °C) in aerated 0.22-lm fil- tered seawater tanks for 21 days. Groups of oysters were then exposed to two laboratory-controlled temperature regimes in 40 L tanks: 60 oysters were acclimated for 4 weeks to 25 °C(4°C above the temperature of seawater encountered in summer in southern Brittany), and a control group of 70 oysters was maintained in seawater at 13 °C. Oysters were fed three times a week with a microalgal sus- pension (containing Isochrysis galbana and Pavlova lutheri). No oysters died during the experiment. For each of the experimental conditions, oysters were sampled at 0, 3, 7, 10, 14, 17 and 24 days following the start of the treatments. Gill and mantle tissues were dis- sected, rapidly frozen in liquid nitrogen and stored at )80 °C until analysis. Pools of gill and mantle were pre- pared on these sampling dates by taking 50 mg of each tissue from each of 10 individuals. RNA extraction Total RNA was extracted using TRIzolÒ Reagent (Invitro- gen, Carlsbad, CA) with 1 mL ⁄ 50 mg of tissue. For SSH experiments, polyadenylated RNA was isolated using the PolyATtractÒmRNA Isolation System (Promega, Madison, WI) according to the manufacturer’s instructions. RNAs were resuspended in RNase-free water and their quantity was assessed by spectrophotometry. Suppression subtractive hybridization Messenger RNA was extracted from mantle and gills of oysters exposed to 13 or 25 °C after 7–10 and 24 days. Two micrograms of mRNA (1 lg from the gills and 1 lg from the mantle) were used as the template for SSH follow- ing the PCR-select cDNA subtraction kit procedure Thermal stress-induced gene expression in C. gigas A L. Meistertzheim et al. 6398 FEBS Journal 274 (2007) 6392–6402 Journal compilation ª 2007 FEBS. No claim to original French government works (Clontech, Palo Alto, CA). Hybridization and subtraction steps were carried out in both directions. For forward sub- traction, the 25 °C sample (tester) was subtracted with 13 °C sample (driver) and the opposite was done for reverse subtraction. Four libraries (two forward and two reverse) were thus constructed. PCR products were then purified and cloned into pGEM-T vector (Promega). Five hundred white colonies per library were grown on Luria–Bertani medium (with 100 mgÆL )1 ampicillin). A total of 2000 ran- domly selected clones were single-pass sequenced using an ABI 3730 sequencer with the sequencing kit ABI Big dye terminator version 3.1 at the Genoscope Sequencing Center (Evry, France). Sequences were then analyzed using BlastX algorithm available from the National Center for Biotech- nology Information (NCBI) and the EST sequences were then submitted to its dbEST and GenBank databases (see supplementary Tables S1–S4). Real-time PCR analyses Real-time PCR was used to analyse the expression profiles of some selected genes involved in cell proliferation and dif- ferentiation, cellular stress, antioxidant defence, metabolism of nitrogen and ammonia detoxification, membrane fluidity, energetic metabolism and translational processing. Total RNA was extracted from gills and mantle of 10 oysters exposed to 13 and 25 °C for 0, 3, 7, 10, 14, 17 and 24 days. A pool of the 10 RNA samples was made for each tissue at each sampling point in a proportional manner according to the amount of total RNA collected from each animal. Reverse transcription was performed on 20 l g RNA from each pool using the oligo(dT) anchor primer (5¢-GAC CACGCGTATCGATGTCGACT (16) V-3¢) and Moloney murine leukaemia virus (M-MLV) reverse transcriptase (Promega). Real-time PCR was performed in triplicate with Table 2. Combinations of primers used in real-time PCR expression analysis. Genes Primer sequences (5’- to 3’) MTA-1 AATGCTGGCTCTCCCTCGAT GCTTGGCTACTGGACCATCAA Ras family GTP-binding protein Rho1p GATACAGCAAACGGAAAGTCAACA CAGTTCCTCGGGCCAACA Cystatin B GCCCCCCTCCCACACA CATCTTCGGCCGTCTTTCC CTSL GTTCTTGTTCCTGCTCATCAGTATG TGGATCGCCAAAAACTCATG QM protein AATGCTGGCTCTCCCTCGAT GCTTGGCTACTGGACCATCAA HYPK GGAAATGGAAATAACAAGACAAATAGC GCGCAACTAATGCTTCCACAA HSP70 TGACCAAGGCAACAGAACCA AATCAGACGGCCGGTATGTG Heat shock 70 kDa protein 12A CGAAAAAGGACAGCAGTTGAAA CTCATCCTCCACCGGATTGT HSP23 CGTCCGATTTCTTCTCGTGTTT ACCAGAAGACATTACAGTGAAAATTGA Chaperonin-containing TCP1, subunit 7, isoform b, isoform 1 GGGAACCAGCAGTCGTCAAA CGTCCACTGAGAGGATGAGACA Inhibitor of kappa light polypeptide enhancer in B cells, kinase complex-associated protein AAAGCAGAGCAGAAAAAGTGGAA GGACAATGCCGCGATCAG Non-selenium glutathione peroxidase CAATGAACAAAAAAGTCGCAACA GGGATGGAGGGTAAGACCATACA Glutamine synthetase ACGGAGGTTGACGGGACTT GCTGGCACCACGATTGG Delta-9-desaturase ACGGTCGTTCCCTGTGTCTT CCGACCATGTGGCGTTTAGT Citrate synthase CCGCGCCGGGACCTCCGTCGGTGTTGTAG TTCGTCGGACACAGAGTCTCCCAATTCTC D-LDH TTCGTTTTTCCCTCAAAGCATT CGCCATATTGCTTGACAGCTACT Translation initiation factor eIF-2B delta subunit GGCTGGTATCCCTTGCTCCTA CACTTTAGTAGCCTCTTGCATTGC Ribosomal 18S GTCTGGTTAATTCCGATAACGAACGGAACTCTA TGCTCAATCTCGTGTGGCTAAACGCAACTTG A L. Meistertzheim et al. Thermal stress-induced gene expression in C. gigas FEBS Journal 274 (2007) 6392–6402 Journal compilation ª 2007 FEBS. No claim to original French government works 6399 5 lL cDNA (1 ⁄ 20 dilution) in a total volume of 20 lL, using a 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA). The concentrations of the reaction components were as follows: 1· Absolute QPCR SYBR Green ROX Mix (ABgene, Epsom, UK) and 70 nm of each primer. Oligonucleotide primer sequences used to amplify specific gene products are shown in Table 2. Reactions were realized with activation of Thermo-StartÒ DNA polymerase at 95 ° C for 15 min followed by ampli- fication of the target cDNA (45 cycles of denaturation at 95 °C for 30 s, annealing and extension at 60 °C for 1 min) and a melting curve programme from 95 to 70 °C decreasing by 0.5 °C every 10 s. Readings were taken at 60 °C. Each run included a positive cDNA control (one 13 °C sample from the present experiment analyzed in each amplification plate), a negative control (nonreverse- transcribed total RNA) and blank controls (water) for each primer pair. PCR products were then purified, cloned and sequenced for confirmation. For gene expression calculation, the threshold value (Ct) was determined for each target as the number of cycles at which the fluorescence rose appreciably above the background fluorescence. PCR efficiency (E) was cal- culated for each primer pair by determining the slope of standard curves obtained from serial dilution analysis of cDNA from different experimental samples (treatment and control), using the method described by Yuan et al.[49]. Individual real-time PCR efficiencies (E) for target or ref- erence genes were calculated according to: E ¼ 10 ()1 ⁄ slope) . Results are presented here as changes in relative expres- sion normalized to the reference gene (ribosomal 18S), using the method described by Pfaffl [50] and determined using the equation: Relative expression ¼½ðE target Þ DC ttargetðcontrolÀsampleÞ = ½ðE ref Þ DC trefðcontrolÀsampleÞ ; where E target is the amplification efficiency of the target or gene of interest, E ref is the amplification efficiency of the reference (ribosomal 18S) and C t is the crossing threshold. Statistical analysis The variations in gene expression were analyzed with Stu- dent’s t-tests between oysters exposed to 13 and 25 °C, using statistica software (Statsoft, Maison-Alfort, France). These statistical analyses were performed using the triplicate real- time PCR assay values obtained for each sample; the graphs (Fig. 2) present the mean values with standard deviations. Acknowledgements This research program was financially supported by the national program PROGIG (Prolife ´ ration de Crassostrea gigas, LITEAU II) and the PolyGIGAS program of the Bureau des Ressources Ge ´ ne ´ tiques (n°05 ⁄ 5210460 ⁄ YF). The authors are grateful to Helen McCombie and Carolyn Friedman for English correc- tions. References 1 Hochachka PW & Somero GN (2002) Biochemical Adaptation: Mechanism and Process in Physiological Evolution. Oxford University Press, Oxford. 2 Podrabsky JE & Somero GN (2004) Changes in gene expression associated with acclimation to constant tem- peratures and fluctuating daily temperatures in an annual killifish Austrofundulus limnaeus. J Exp Biol 207, 2237–2254. 3 Buckley BA, Gracey AY & Somero GN (2006) The cel- lular response to heat stress in the goby Gillichthys mir- abilis: a cDNA microarray and protein-level analysis. J Exp Biol 209, 2660–2677. 4 Voznesensky M, Lenz PH, Spanings-Pierrot C & Towle DW (2004) Genomic approaches to detecting thermal stress in Calanus finmarchicus (Copepoda: Calanoida). J Exp Mar Biol Ecol 311, 37–46. 5 Cadet P, Zhu W, Mantione KJ, Baggerman G & Stef- ano GB (2002) Cold stress alters Mytilus edulis pedal ganglia expression of mu opiate receptor transcripts determined by real-time RT-PCR and morphine levels. Brain Res 99, 26–33. 6 Buckley BA, Owen M-E & Hofmann GE (2001) Adjust- ing the thermostat: the threshold induction temperature for the heat-shock response in intertidal mussels (genus Mytilus) changes as a function of thermal history. J Exp Biol 204, 3571–3579. 7 Hamdoun AM, Cheney DP & Cherr GN (2003) Pheno- typic plasticity of HSP70 and HSP70 gene expression in the Pacific oyster (Crassostrea gigas): implications for thermal limits and induction of thermal tolerance. Biol Bull 205, 160–169. 8 Quayle OB (1969) Pacific oyster culture in British Columbia. Fish Res Board Can Bull 167, 169–192. 9 Chavez-Villalba J, Barret J, Mingant C, Claude Co- chard J & Le Pennec M (2002) Autumn conditioning of the oyster Crassostrea gigas: a new approach. Aquacul- ture 210, 171–186. 10 Chavez-Villalba J, Cochard JC, Pennec M, Barret J, Enriquez-Diaz M & Caceres-Martinez C (2003) Effects of temperature and feeding regimes on gametogenesis and larval production in the oyster Crassostrea gigas. J Shellfish Res 22, 721–731. 11 Berthelin C, Kellner K & Mathieu M (2000) Storage metabolism in the Pacific oyster (Crassostrea gigas)in relation to summer mortalities and reproductive cycle (west coast of France). Comp Biochem Physiol B 125, 359–369. Thermal stress-induced gene expression in C. gigas A L. Meistertzheim et al. 6400 FEBS Journal 274 (2007) 6392–6402 Journal compilation ª 2007 FEBS. No claim to original French government works 12 Mann R (1979) Some biochemical and physiological aspects of growth and gametogenesis in Crassostrea gigas and Ostrea edulis grown at sustained elevated temperatures. J Mar Biol Assoc UK 59, 95–110. 13 Ruiz C, Abad M, Sedano F, Garcia-Martin LO & Sanchez Lopez JL (1992) Influence of seasonal environ- mental changes on the gamete production and biochem- ical composition of Crassostrea gigas (Thunberg) in suspended culture in El Grove, Galicia, Spain. J Exp Mar Biol Ecol 155, 249–262. 14 Klose A, Zigrino P, Dennhofer R, Mauch C & Hunzel- mann N (2006) Identification and discrimination of extracellularly active cathepsins B and L in high-inva- sive melanoma cells. Anal Biochem 353, 57–62. 15 Levicar N, Kos J, Blejec A, Golouh R, Vrhovec I, Frkovic-Grazio S & Lah TT (2002) Comparison of potential biological markers cathepsin B, cathepsin L, stefin A and stefin B with urokinase and plasminogen activator inhibitor-1 and clinicopathological data of breast carcinoma patients. Cancer Detect Prev 26, 42–49. 16 Stanbridge E, Farmer A, Mills A, Loftus T, Kon- gkasuriyachai D, Dowdy S & Weissman B (1994) Molecular characterization of QM, a novel gene with properties consistent with tumor suppressor function. Cold Spring Harbor Symp Quant Biol 59, 573–576. 17 Altinok G, Powell IJ, Che M, Hormont K, Sarkar FH, Sakr WA, Grignon D & Liao DJ (2006) Reduction of QM protein expression correlates with tumor grade in prostatic adenocarcinoma. Prostate Cancer Prostatic Dis 9, 77–82. 18 Tanguy A, Boutet I, Laroche J & Moraga D (2005) Molecular identification and expression study of differ- entially regulated genes in the Pacific oyster Crassostrea gigas in response to pesticide exposure. FEBS J 272, 390–403. 19 Boutet I, Tanguy A & Moraga D (2004) Response of the Pacific oyster Crassostrea gigas to hydrocarbon con- tamination under experimental conditions. Gene 329, 147–157. 20 David E, Tanguy A, Pichavant K & Moraga D (2005) Response of the Pacific oyster Crassostrea gigas to hypoxia exposure under experimental conditions. FEBS J 272, 5635–5652. 21 Kohn KW, Riss J, Aprelikova O, Weinstein JN, Pom- mier Y & Barrett JC (2004) Properties of switch-like bioregulatory networks studied by simulation of the hypoxia response control system. Mol Biol Cell 15, 3042–3052. 22 Tomanek L & Somero GN (1999) Evolutionary and acclimation-induced variation in the heat-shock responses of congeneric marine snails (genus Tegula) from different thermal habitats: implications for limits of thermotolerance and biogeography. J Exp Biol 202, 2925–2936. 23 Lindquist S (1986) The heat-shock response. Annu Rev Biochem 55, 1151–1191. 24 Parsell DA & Lindquist S (1993) The function of heat-shock proteins in stress tolerance: degradation and reactivation of damaged proteins. Annu Rev Genet 27, 437–496. 25 Feder ME & Hofmann GE (1999) Heat-shock proteins, molecular chaperones, and the stress response: evolu- tionary and ecological physiology. Annu Rev Physiol 61, 243–282. 26 Clegg JS (1998) Induced thermotolerance and the heat shock protein-70 family in the Pacific oyster Crassostrea gigas. Mol Mar Biol Biotech 7, 21–30. 27 Haslbeck M (2002) sHsps and their role in the chaper- one network. Cell Mol Life Sci 59, 1649–1657. 28 Bando Y, Ogawa S, Yamauchi A, Kuwabara K, Ozawa K, Hori O, Yanagi H, Tamatani M & Tohyama M (2000) 150-kDa oxygen-regulated protein (ORP150) functions as a novel molecular chaperone in MDCK cells. Am J Physiol Cell Physiol 278, C1172–C1182. 29 Kubota H, Yokota S, Yanagi H & Yura T (1999) Struc- tures and co-regulated expression of the genes encoding mouse cytosolic chaperonin CCT subunits. Eur J Biochem 262, 492–500. 30 Yokota SI, Yanagi H, Yura T & Kubota H (2000) Upregulation of cytosolic chaperonin CCT subunits during recovery from chemical stress that causes accu- mulation of unfolded proteins. Eur J Biochem 267, 1658–1664. 31 Gasch AP, Spellman PT, Kao CM, Carmel-Harel O, Eisen MB, Storz G, Botstein D & Brown PO (2000) Genomic expression programs in the response of yeast cells to environmental changes. Mol Biol Cell 11, 4241– 4257. 32 Monteclaro FS & Vogt PK (1993) A Jun-binding pro- tein related to a putative tumor suppressor. Proc Natl Acad Sci USA 90, 6726–6730. 33 Wiens M, Koziol C, Hassanein HM, Muller IM & Muller WE (1999) A homolog of the putative tumor suppressor QM in the sponge Suberites domuncula: downregulation during the transition from immortal to mortal (apoptotic) cells. Tissue Cell 31, 163–169. 34 Raychaudhuri S, Sinha M, Mukhopadhyay D & Bhat- tacharyya NP (2007) HYPK, a Huntingtin interacting protein, reduces aggregates and apoptosis induced by N-terminal Huntingtin with 40 glutamines in Neuro2A cells and exhibits chaperone like activity. Hum Mol Genet, doi:10.1093/hmg/ddm301. 35 Tanguy A, Guo X & Ford SE (2004) Discovery of genes expressed in response to Perkinsus marinus challenge in Eastern (Crassostrea virginica) and Pacific (C. gigas) oysters. Gene 338, 121–131. 36 Long GL (1976) The stereospecific distribution and evo- lutionary significance of invertebrate lactate dehydro- genases. Comp Biochem Physiol B 55, 77–83. A L. Meistertzheim et al. Thermal stress-induced gene expression in C. gigas FEBS Journal 274 (2007) 6392–6402 Journal compilation ª 2007 FEBS. No claim to original French government works 6401 [...]... Guderley H (2007) Changes in mitochondrial oxidative capacities during thermal acclimation of rainbow trout Oncorhynchus mykiss: roles of membrane proteins, phospholipids and their fatty acid compositions J Exp Biol 210, 149–165 43 Abele D, Heise K, Portner HO & Puntarulo S (2002) Temperature-dependence of mitochondrial function and production of reactive oxygen species in the intertidal mud clam Mya... at 25 °C Table S4 Genes identified after 24 days at 13 °C This material is available as part of the online article from http://www.blackwell-synergy.com Please note: Blackwell Publishing is not responsible for the content or functionality of any supplementary materials supplied by the authors Any queries (other than missing material) should be directed to the corresponding author for the article FEBS... K, Puntarulo S, Portner HO & Abele D (2003) Production of reactive oxygen species by isolated mitochondria of the Antarctic bivalve Laternula elliptica (King and Broderip) under heat stress Comp Biochem Physiol C 134, 79–90 Heise K, Puntarulo S, Nikinmaa M, Abele D & Portner HO (2006) Oxidative stress during stressful heat exposure and recovery in the North Sea eelpout Zoarces viviparus L J Exp Biol... seawater, increases the glutamine content and the glutamine synthetase activity in the marsh clam Polymesoda expansa J Exp Biol 207, 4605–4614 40 Tocher DR, Leaver MJ & Hodgson PA (1998) Recent advances in the biochemistry and molecular biology of fatty acyl desaturases Prog Lipid Res 37, 73–117 41 Nakamura MT & Nara TY (2004) Structure, function, and dietary regulation of delta6, delta5, and delta9 desaturases.. .Thermal stress- induced gene expression in C gigas 37 Walsh PJ & Mommsen TP (2001) Evolutionary considerations of nitrogen metabolism and excretion Fish Physiol 20, 1–30 38 Bishop SH, Ellis LL & Burcham JM (1983) Amino acid metabolism in molluscs Mollusca 1, 243–327 39 Hiong KC, Peh WYX, Loong AM, Wong WP, Chew SF & Ip YK (2004) Exposure to air, but not seawater, increases the glutamine... Statistical analysis of real-time PCR data BMC Bioinformatics 7, 85–97 Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR Nucleic Acids Res 29, 2003–2007 Supplementary material The following supplementary material is available online: Table S1 Genes identified after 7–10 days at 25 °C Table S2 Genes identified after 7–10 days at 13 °C Table S3 Genes identified after... Raisuddin S (2005) Heat stress- induced alterations of antioxidants in the freshwater fish Channa punctata Bloch J Fish Biol 67, 1653–1665 45 Fisher AB, Dodia C, Manevich Y, Chen JW & Feinstein SI (1999) Phospholipid hydroperoxides are substrates for non-selenium glutathione peroxidase J Biol Chem 274, 21326–21334 46 Abele D & Puntarulo S (2004) Formation of reactive species and induction of antioxidant defence... supplied by the authors Any queries (other than missing material) should be directed to the corresponding author for the article FEBS Journal 274 (2007) 6392–6402 Journal compilation ª 2007 FEBS No claim to original French government works . Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress Anne-Leila. response to heat stress throughout the year [7]. The aim of this study was to improve our knowledge of differentially expressed genes in C. gigas exposed to a