MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor Li-Hua Zhu 1,2, *, Tao Liu 1, *, Hua Tang 1 , Rui-Qing Tian 1 , Chang Su 1 , Min Liu 1 and Xin Li 1 1 Tianjin Life Science Research Center and Basic Medical School, Tianjin Medical University, Tianjin, China 2 Department of Pathobiology, Bioscience Faculty, North China Coal Medical College, Tangshan, China Introduction Recent findings have shown that, as regulation factors of gene expression, microRNAs (miRNAs) are often overexpressed or downregulated in a number of human malignancies, and some can also function as tumor suppressors or oncogenes [1]. miRNA genes are fre- quently located in cancer-associated genomic regions or in fragile sites [2]. Previous studies have identified cancer-specific miRNAs in many types of cancer, including B-cell chronic lymphoblastic leukemia [3], lung cancer [4], colorectal cancer [5,6], breast cancer [7], papillary thyroid cancer [8] and hepatocellular carcinoma [9]. Gastric cancer is the second most common cause of cancer deaths worldwide. Previous studies have revealed several genes related to human gastric cancer [10,11], but the common molecular mech- anisms of gastric cancer remain to be elucidated. Gastric cancer is a complex genetic disease, in which the expres- sion of many specific genes, known as oncogenes or tumor suppressors, is abnormally altered. It has been reported that microRNA-34 (miR-34) is involved in the p53-directed tumor suppressor network in gastric cancer [12]. Our previous study showed that miR-27a functions as an oncogene in gastric adenocarcinoma by targeting prohibitin [13]. In the current study, we examine the differential expression of miR-23a in gastric cancer and normal gastric tissues, and identify that miR-23a can Keywords cell growth; gastric adenocarcinoma; IL6R; miR-23a; target gene Correspondence H. Tang, Tianjin Life Science Research Center and Basic Medical School, Tianjin Medical University, Tianjin 300070, China Fax: +86 22 23542503 Tel: +86 22 23542503 E-mail: htang2002@yahoo.com *These authors contributed equally to this work (Received 11 April 2010, revised 15 June 2010, accepted 12 July 2010) doi:10.1111/j.1742-4658.2010.07773.x MicroRNAs are an evolutionarily conserved class of endogenous noncod- ing RNAs that modulate gene expression at the post-transcriptional level. Recently, microRNA-23a (miR-23a) has been found to function as a growth-promoting and antiapoptotic factor in hepatocellular carcinoma cells. Our previous study showed that miR-23a was significantly upregulat- ed in gastric adenocarcinoma tissues. In this study, we found that miR-23a promoted the proliferative potential of gastric adenocarcinoma cell line MGC803. We also identified IL6R as a direct target gene for miR-23a using a fluorescent reporter assay. The mRNA and protein levels of IL6R were both inversely correlated with the miR-23a expression level. Our results demonstrate that miR-23a can target IL6R and promote the growth activity of gastric adenocarcinoma cells in vitro. The downregulation of IL6R by miR-23a may explain why the suppression of miR-23a can inhibit gastric cancer cell proliferation. Abbreviations ASO, antisense oligonucleotide; EGFP, enhanced green fluorescence protein; GAPDH, glyceraldehyde phosphate dehydrogenase; IL6R, interleukin-6 receptor; miR-23a, microRNA-23a; miRNA, microRNA; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide; siRNA, small interfering RNA; UTR, untranslated region. 3726 FEBS Journal 277 (2010) 3726–3734 ª 2010 The Authors Journal compilation ª 2010 FEBS promote the growth of gastric adenocarcinoma cell line MGC803 by targeting directly the interleukin-6 receptor (IL6R) gene product. Results miR-23a is overexpressed in gastric adenocarcinoma An oligonucleotide microarray was applied to detect the miRNA profiles in four pairs of gastric adenocarci- noma tissue samples and matched normal gastric tissue samples. miR-23a was consistently upregulated in gas- tric adenocarcinoma tissues (Fig. 1A). This result indi- cated that miR-23a might be involved in the gene regulation of gastric cancer cells. Previous research has demonstrated that miR-23a functions as an oncogene in prostate cancer [14] and is also associated with hepatocellular carcinoma [15]. Hence, we predicted that miR-23a might have similar oncogenic activity in gastric adenocarcinoma. Alteration of miR-23a affects gastric adenocarcinoma cell growth in vitro First, we transfected miR-23a antisense oligonucleo- tides (ASOs) or pcDNA3 ⁄ pri-23a into MGC803 cells and confirmed that the expression of miR-23a was effectually altered (Fig. 1B). Then, MGC803 cells were transfected with miR-23a ASO or pcDNA3 ⁄ pri-23a. At 24, 48 and 72 h post-transfection, cell activity was evaluated by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphe- nyl-tetrazolium bromide (MTT) assay. miR-23a ASO reduced cell growth activities at both 48 and 72 h after transfection, whereas pcDNA3 ⁄ pri-23a increased cell growth activities at the same time points (Fig. 2A). To detect the effect of miR-23a on the long-term and independent growth activity of MGC803 cells, a plate colony formation assay was performed. Compared with the control group, the colony number of MGC803 cells after transfection with miR-23a ASO was lower and that for MGC803 cells after transfection with pcDNA3 ⁄ pri-23a was higher (Fig. 2B). These results indicate that miR-23a can also promote the long-term and independent growth activity of MGC803 cells. IL6R is a candidate target of miR-23a Many putative miR-23a targets are predicted by various computer-aided algorithms. However, the predicted target genes are in large quantity and most have not been validated experimentally. Therefore, we used a cDNA microarray to search for downregulated genes in gastric adenocarcinoma tissue samples. The genes that were predicted by two of the algorithm programs (pictar and targetscan release 5.1) and were also downregulated in our cDNA microarray were selected as candidate targets of miR-23a. Among these genes, the tumor suppressor gene IL6R was regarded as a pos- sible target gene for miR-23a, corresponding to the model that an oncogenic miRNA promotes tumor development by targeting and negatively regulating a tumor suppressor. The IL6R 3¢ untranslated region (UTR) carries a putative miR-23a binding site and is negatively regulated by miR-23a It is now well known that miRNAs cause mRNA cleavage or translational repression through imperfect 50 AB 2.0 1.8 1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0 Array 1 Array 2 Array 3 Array 4 miR-23a miR-27a miR-191 miR-23a ASO ASO-NC * * pcDNA3 pri-23a 20 15 10 Fold miR-23a expression level 5 0 –5 Fig. 1. miR-23a is upregulated in human gastric adenocarcinoma and is effectively altered in MGC803 cells. (A) miR-23a was among the upregulated miRNAs in human gastric adenocarcinoma as determined by microarray analysis. (B) The miR-23a expression level in MGC803 cells was effectively altered by transfection of miR-23a ASO or pri-23a vector as detected by real-time RT-PCR. U6 snRNA was used for normalization (*P < 0.05). L H. Zhu et al. miR-23a promotes gastric cancer growth FEBS Journal 277 (2010) 3726–3734 ª 2010 The Authors Journal compilation ª 2010 FEBS 3727 base pairing with the 3¢ UTR of target genes. Further- more, the 2–8 nucleotides of miRNA, known as the ‘seed region’, have been suggested to be the most important region for target recognition [16]. Therefore, we predicted that the IL6R mRNA 3¢ UTR might contain a miR-23a binding site that is complementary to the miR-23a seed region. Three binding sites of miR-23a were found in the 3¢ UTR of IL6R mRNA (Fig. 3A). To confirm that miR-23a can bind to these regions and suppress the expression of the target gene, we constructed an enhanced green fluorescence protein (EGFP) reporter vector in which the predicated target regions were inserted downstream of the EGFP coding region. MGC803 cells were transfected with the repor- ter vector together with miR-23a ASO or pcDNA3 ⁄ pri-23a. As shown in Fig. 3B, the intensity of EGFP fluorescence was higher in the miR-23a ASO group and was lower in the pri-23a group compared with the control group. Similarly, we constructed another three EGFP reporter vectors containing the mutations of the miR-23a binding site (Fig. 4A). It was shown that miR-23a ASO or pcDNA3 ⁄ pri-23a did not affect the intensity of EGFP fluorescence in the vector bearing the mutant of the first miR-23a binding region. 1.0 1.2 0.8 A570 0.4 0.6 0.2 0 0.5 1.0 1.5 90 80 70 60 40 50 30 20 10 0 A570 Number of colonies 0 0.5 1.0 1.5 2.0 A570 0 ASO-NC miR-23a ASO 24 h AB 48 h 72 h * * * * pcDNA3 pri-23a ASO-NC miR-23a ASO pcDNA3 pri-23a ASO-NC miR-23a ASO pcDNA3 pri-23a ASO-NC miR-23a ASO pcDNA3 pri-23a * * Fig. 2. miR-23a promotes growth activity of MGC803 cells. MGC803 cells were transfected with miR-23a ASO or pri-23a vector, and cell growth activity was detected through the MTT (A) and colony formation (B) assays (*P < 0.05). 2521 5′ 3′ 5′ 3′ 5′ 3′ 5′ CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA 3′ UAAAUGUGAAU ACAAUGUGAAA GCAAUGUGAUA IL6R mRNA miR-23a 2531 20 A B 18 16 14 12 * * 10 EGFP intensity 8 6 4 2 0 EGFP EGFP-IL6R 3′UTR pri-23a pcDNA3 miR-23a ASO ASO-NC + – – – – – – + – – – – – + + – – – – + – + – – – + – – + – – + – – – + 2833 2843 3123 3133 Fig. 3. IL6R is a direct target of miR-23a. (A) The IL6R 3¢ UTR carries three potential miR-23a binding sites. (B) The direct interaction of miR-23a and IL6R mRNA was confirmed by a fluorescent reporter assay. MGC803 cells were transfected with the EGFP reporter vector together with miR-23a ASO or pri-23a, and the EGFP intensity was measured (*P < 0.05). miR-23a promotes gastric cancer growth L H. Zhu et al. 3728 FEBS Journal 277 (2010) 3726–3734 ª 2010 The Authors Journal compilation ª 2010 FEBS However, for the other two potential binding sites, miR-23a ASO or pcDNA3 ⁄ pri-23a affected the inten- sity of EGFP fluorescence in the vectors bearing either the wild-type or mutated binding site (Fig. 4B, C). These observations suggest that miR-23a binds mainly to the first targeting site of the IL6R mRNA 3¢ UTR and represses gene expression. These data highlight the prediction that IL6R is a direct target of miR-23a. miR-23a negatively regulates IL6R expression at the mRNA and protein levels miRNAs can suppress the expression of target genes through translational repression or degradation of target transcripts. To assess whether miR-23a has a functional role in the downregulation of endogenous IL6R expression, MGC803 cells were transfected with miR-23a ASO or pcDNA3 ⁄ pri-23a to block or overex- press miR-23a, respectively, and the expression of IL6R mRNA was measured by quantitative RT-PCR. When miR-23a was blocked or overexpressed, IL6R mRNA was elevated or diminished, respectively, compared with that in the control group (Fig. 5A), indicating that miR-23a regulates endogenous IL6R mRNA levels through a mechanism of mRNA degradation. To con- firm the results obtained from cell lines, we also detected the expression of IL6R mRNA in nine other pairs of tissue samples. Figure 5B shows that, compared with normal tissue samples, IL6R mRNA was consistently downregulated in gastric cancer tissue samples. In addition, knockdown or overexpression of miR-23a also enhanced or decreased IL6R protein expression, respec- tively (Fig. 5C). The effects of miR-23a on the growth of MGC803 cells after IL6R knockdown Sequence-specific small interfering RNA (siRNA) can effectively suppress gene expression. Western blot anal- ysis showed that transfection of the pSilencer ⁄ sh-IL6R siRNA expression vector into MGC803 cells inhibited significantly the expression of IL6R (Fig. 6A). As shown in Fig. 6B, C, inhibition of IL6R expression promoted gastric adenocarcinoma cell growth com- pared with the control group, which was concordant with the overexpression of miR-23a. This suggests that miR-23a promotes MGC803 cell growth by negatively regulating IL6R. Discussion Gastric cancer causes nearly one million deaths world- wide per year. Although Helicobacter pylori infection has been confirmed to be the main risk factor in about 2521A BC 5′ 3′ 5′ 3′ 5′ 5′3′ 3′ UAUAAGAGUAU CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA 3′ 5′ 3′ 5′ 5′3′ CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA 3′ 5′ 3′ 5′ 5′3′ CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA ACAAUGUGAAA GCAAUGUGAUA 5′ 3′ UAAAUGUGAAU ACUAAGAGUAA GCAAUGUGAUA IL6R mRNA mut 1 5′ 3′ UAAAUGUGAAU ACAAUGUGAAA GCUAAGAGUUA IL6R mRNA mut 3 IL6R mRNA mut 2 miR-23a miR-23a miR-23a 2531 2833 2843 3123 3133 2521 8 7 6 5 4 EGFP intensity 3 2 1 0 7 6 5 4 EGFP intensity 3 2 1 0 wt UTR ASO- NC UTR mut 1 # # # # # # * * * * * * UTR mut 2 UTR mut 3 UTR mut 1 UTR mut 2 UTR mut 3 ASO- NC ASO- NC miR-23a ASO miR-23a ASO miR-23a ASO EGFP wt UTR pcDNA3 pcDNA3 pcDNA3 pri-23a pri-23a pri-23a EGFP 2531 2833 2843 3123 3133 2521 2531 2833 2843 3123 3133 Fig. 4. miR-23a especially interacts with the first potential binding site of the IL6R mRNA 3¢ UTR. (A) The three EGFP reporter vectors bear- ing mutations of the miR-23a seed region binding site are shown. The arrows indicate the mutated nucleotides. (B) Knockdown of miR-23a failed to elevate the EGFP intensity in the reporter vector containing a mutation of the first miR-23a binding region, but could still elevate the EGFP intensity in the reporter vectors containing mutations of the second or third miR-23a binding regions. (C) Similarly, overexpression of miR-23a failed to suppress the EGFP intensity in the reporter vector containing mutation of the first, opposed to the second or third, miR-23a binding region (*P < 0.05; #P > 0.05). L H. Zhu et al. miR-23a promotes gastric cancer growth FEBS Journal 277 (2010) 3726–3734 ª 2010 The Authors Journal compilation ª 2010 FEBS 3729 80% or more of gastric cancers, the molecular path- way leading to the development of gastric cancers remains unclear. Recently, accumulating evidence has suggested that miRNAs may regulate diverse biological processes and may be important in tumorigenesis. In the analysis of miRNA expression differences in four pairs of gastric adenocarcinoma tissue samples and matched normal tissue samples, several candidate miRNAs emerged that may be involved in gastric adenocarcinoma. In these differentially expressed miRNAs, we presumed that miR-23a was a signifi- cant miRNA because of its higher fold of upregula- tion in gastric adenocarcinoma tissues. Although the extent of upregulation of miR-23a in the four pairs of gastric tissues showed great variance because of the different malignancies as well as individual differ- ences, the dysregulation of miR-23a in gastric cancer was consistent. Recently, it has been reported that the miR-23a_27a_24 cluster functions as a growth- promoting and antiapoptotic factor in human hepato- cellular carcinoma cells [15]. Moreover, a recent study has suggested that miR-27a functions as an onco- genic miRNA in gastric adenocarcinoma cells by the direct regulation of prohibitin [13]. As the coding genes of miR-23a and miR-27a are located in the same cluster, we determined whether miR-23a also functions as an oncogenic miRNA in gastric adeno- carcinoma cells. IL6R GAPDH A C B pSilencer/ NC pSilencer/NC * * Relative IL6R protein level 1.2 1.0 0.8 0.6 0.4 0.2 0 A570 0.40 0.35 0.30 0.25 0.20 0.15 0.10 0.05 0 Number of colonies 90 80 70 60 50 40 30 20 10 0 A570 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 A570 0.6 0.8 1.0 0.4 0.2 0 pSilencer/ sh-IL6R pSilencer/ NC 24 h * * 48 h 72 h pSilencer/ sh-IL6R pSilencer/ NC pSilencer/ sh-IL6R pSilencer/ NC pSilencer/ sh-IL6R pSilencer/sh-IL6R pSilencer/NC pSilencer/sh-IL6R Fig. 6. Knockdown of IL6R showed concordant effects with miR-23a overexpression in MGC803 cells. (A) Western blot analysis showed that expression of IL6R was successfully suppressed by IL6R siRNA. (B, C) IL6R was knocked down in MGC803 cells, and cell growth activ- ity was detected through the MTT (B) and colony formation (C) assays (*P < 0.05). 9 A C B * * * * 8 7 6 5 4 Relative IL6R mRNA level 3 2 1 0 1.2 1.0 0.8 Relative IL6R mRNA level 0.6 0.4 0.2 0 1.2 1.4 1.6 1.8 1.0 0.8 Relative IL6R protein level 0.6 0.4 0.2 0 123 45 6 789 ASO-NC miR-23a ASO Normal IL6R GAPDH Cancer pcDNA3 pri-23a ASO-NCmiR-23a ASO pcDNA3 pri-23a ASO-NCmiR-23a ASO pcDNA3 pri-23a Fig. 5. The expression level of IL6R was inversely correlated with the level of miR-23a. (A) When miR-23a was blocked or overexpressed, the level of IL6R mRNA was subsequently elevated or diminished compared with the level in the control group. (B) Compared with normal tissue samples, IL6R mRNA was consistently downregulated in gastric cancer tissue samples. (C) When miR-23a was blocked or overexpressed, the level of IL6R protein was subsequently elevated or diminished compared with the level in the control group (*P < 0.05). miR-23a promotes gastric cancer growth L H. Zhu et al. 3730 FEBS Journal 277 (2010) 3726–3734 ª 2010 The Authors Journal compilation ª 2010 FEBS It is assumed that the overexpressed miRNAs in cancers may function as oncogenes. Hence, we inferred that miR-23a might be a growth-promoting factor in gastric adenocarcinoma. Both MTT and colony forma- tion assays confirmed the active role of miR-23a in the growth promotion of malignant cells. The fundamental function of miRNAs is to regulate their targets by direct cleavage of mRNA or by inhibi- tion of protein synthesis. On the one hand, computa- tional algorithms have been widely used to predict miRNA targets. On the other, gene expression profil- ing analysis using cDNA microarrays is a strong tool to identify miRNA targets. As expression regulation at the mRNA level may be a common mechanism for miRNA function [17], it is more convenient to monitor transcriptional changes using a high-throughput micro- array approach [18]. In order to predict exactly the functional targets for miR-23a, we combined the bioin- formatic assay with a cDNA microarray assay [19]. The genes that were both predicted in the two com- puter-based databases and were downregulated in the cDNA microarray were selected as candidate targets for miR-23a. This strategy enhanced the precision of target prediction. To confirm the postulation, we checked the regulatory effects of miR-23a on the expression of IL6R by RT-PCR and western blot, and found an inverse correlation between miR-23a and IL6R expression at both the mRNA and protein levels. To confirm the direct regulation of IL6R by miR-23a, we used an EGFP-IL6R 3¢ UTR reporter vector bearing the potential miR-23a binding site in the fluorescent reporter, and found an increase in EGFP intensity after blocking miR-23a and a decrease in EGFP intensity after overexpressing miR-23a. Furthermore, another three reporter vectors containing mutations of the miR-23a binding site were used in the fluorescent reporter assay. The reporter vector containing a muta- tion of the first binding site showed no response to altered miR-23a expression, suggesting that the first binding site in the 3¢ UTR of IL6R mRNA mainly reacted with miR-23a. Moreover, the inhibition of IL6R by specific siRNA promoted gastric adenocarci- noma cell growth, which was consistent with the results of the overexpression of miR-23a, and suggested a critical role of IL6R in miR-23a-mediated cell growth regulation. IL6R is an evolutionarily conserved antiproliferative protein and may function as a tumor suppressor through interaction with IL6. A previous study has indicated that exogenous IL6 ⁄ IL6R slows PC-3 and LNCaP cell growth, demonstrating its antiproliferative activity [20]. Another study has demonstrated the induction of antiapoptotic regulators by IL6 ⁄ IL6R in both naive and activated T-cell populations [21]. In gastric cancer, IL6 contains polymorphisms [22]. The expression of IL6 is involved in gastric cancer invasion and lymph node and ⁄ or hepatic metastasis, and can be used as a prognostic factor for survival [23]. These observations indicate an important role of the IL6 ⁄ IL6R complex in gastric cancer. In this study, we found that the inhibition of IL6R, which may be caused by redundant miR-23a, promoted gastric ade- nocarcinoma cell growth. This function may be associ- ated with the potential antiproliferative activity of IL6R. This study provides a potential mechanism of IL6R post-transcriptional regulation by miR-23a. Moreover, some miRNAs were located in a transcript cluster and could have synergistic biological functions. For example, the miR-17-92 cluster displays oncogenic activity in B-cell lymphoma [24], Burkitt’s lymphoma [25] and human lung cancer [26]. Given that miR- 23a ⁄ 24 ⁄ 27a was also in a transcript cluster and that miR-27a also showed oncogenic activity in human gas- tric cancer [13], we are led to presume that this cluster might have a synergistic function that needs to be elu- cidated in further studies. Collectively, our studies demonstrate that miR-23a potently promotes the growth of the gastric adeno- carcinoma cell line MGC803, providing the first proof- of-concept that there is a potential link between the tumor promoter miR-23a and gastric adenocarcinoma cell proliferation. More importantly, the mechanism of miR-23a-mediated promotion of gastric adenocarci- noma proliferation might be related to the direct modulation of the downstream target IL6R, a gene regulating cell proliferation. Our findings suggest a potential regulatory pathway in which the upregulated expression of miR-23a causes the downregulation of IL6R by binding to its first conserved binding site, which then leads to the development of gastric adeno- carcinoma. Materials and methods Human cancer tissue samples Fresh-frozen human gastric adenocarcinoma tissue samples and matched normal gastric tissue samples were obtained from the Tumor Bank Facility of Tianjin Medical University Cancer Institute and Hospital and the National Foundation of Cancer Research. All of the tumor types were confirmed by pathologic analysis. The experiments were undertaken with the understanding and written consent of each subject. The study methodologies conformed to the standards set by the Declaration of Helsinki, and were approved by the local ethics committee. L H. Zhu et al. miR-23a promotes gastric cancer growth FEBS Journal 277 (2010) 3726–3734 ª 2010 The Authors Journal compilation ª 2010 FEBS 3731 Cell culture and transfection Human gastric adenocarcinoma cell line MGC803 was maintained in RPMI1640 (GIBCO BRL, Grand Island, NY, USA) supplemented with 10% fetal bovine serum, 100 IUÆmL )1 of penicillin and 100 lgÆmL )1 of streptomy- cin. The cell line was incubated at 37 °C in a humidified chamber supplemented with 5% CO 2 . Transfection was performed with Lipofectamine 2000 Reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. Briefly, cells were trypsinized, counted and seeded in plates on the day before transfection to ensure suitable cell conflu- ency on the day of transfection. Oligonucleotides and plas- mids were used at final concentrations of 200 nm and 5ngÆlL )1 , respectively, both in antibiotic-free Opti-MEM medium (Invitrogen). The transfection efficiency was moni- tored by cyanine-5 oligonucleotides. Isolation of RNAs Total RNA extraction of cells or tissue samples was performed with the mirVana miRNA Isolation Kit (Ambion, Austin, TX, USA) according to the manufacturer’s instruc- tions. Large (larger than 200 nucleotides) and small (smaller than 200 nucleotides) RNAs were separated and purified in this procedure. The integrity of the large RNA was con- firmed by 1% denatured agarose gel electrophoresis. miRNA microarray and cDNA microarray analyses The miRNA microarray and cDNA microarray analyses were performed as described previously [13]. Quantitative RT-PCR For the detection of the miR-23a level in MGC803 cells transfected with miR-23a ASO or pcDNA3 ⁄ pri-23a, stem- loop quantitative RT-PCR [27] was performed. PCR primers were designed as follows: miR-23a forward, 5¢-ATCAC ATTGCCAGGGATTTCC-3¢; miR-23a reverse, 5¢-CCAG TGCAGGGTCCGAGGT-3¢; U6 forward, 5¢-TGCGG GTGCTCGCTTCGGCAGC-3¢; U6 reverse, 5¢-CCAGTGC AGGGTCCGAGGT-3¢. PCR cycles were as follows: 94 °C for 4 min, followed by 40 cycles of 94 °C for 1 min, 50 °C for 1 min and 72 °C for 1 min. The SYBR Green Mix TaqÔ Kit (TaKaRa, Otsu, Shiga, Japan) was used to trace the amplified DNA. All primers were purchased from AuGCT Inc. (Beijing, China). For the detection of IL6R gene expression levels, 5 lgof large RNA extracted from cells or tissue samples was reverse transcribed to cDNA using the M-MLV reverse transcriptase (Promega, Madison, WI, USA). The cDNA was used for the amplification of IL6R genes and an endogenous control gene glyceraldehyde phosphate dehydrogenase (GAPDH) via PCRs. PCR cycles were as follows: 94 ° C for 4 min, followed by 40 cycles of 94 °C for 1 min, 56 °C for 1 min and 72 °C for 1 min. PCR primers were as follows: IL6R sense, 5¢-CCGAGATCTGGCTTTTACTTAAACCG-3¢; IL6R antisense, 5¢-CAGGAATTCACTTGCTCTGTCACCC-3¢; GAPDH sense, 5¢-GCGAATTCCGTGTCCCCACTGCC AACGTGTC-3¢; GAPDH antisense, 5¢-GCTACTCGAGT TACTCCTTGGAGGCCATGTGG-3¢. The PCR products were resolved on a 1% agarose gel. LabWorksÔ Image Acquisition and Analysis Software (UVP, Upland, CA, USA) was used to quantify band intensities. All primers were purchased from AuGCT Inc. MTT assay MGC803 cells were seeded in 96-well plates with 3 · 10 3 cells per well in 100 lL of cell culture medium and incu- bated at 37 °C for 24 h. The cells were then transfected with miR-23a ASO (5¢-GGAAATCCCTGGCAATGTG AT-3¢), control oligonucleotides (5¢-GTGGATATTGTT GCCATCA-3¢), pcDNA3 ⁄ pri-23a or pSilencer ⁄ sh-IL6R siRNA expression vector. After incubation for 24, 48 and 72 h, the cells were incubated with 20 lL of MTT (at a final concentration of 0.5 mgÆmL )1 )at37°C for 4 h. The medium was removed and the precipitated formazan was dissolved in 100 lL of dimethylsulfoxide. After shaking for 10 min, the absorbance at 570 nm was detected using a lQuant Universal Microplate Spectrophotometer (Bio-tek Instruments, Winooski, VT, USA). Plate colony formation assay MGC803 cell growth activity was determined by colony formation analysis. Twenty-four hours after transfection, cells were harvested and seeded at 100 cells per well in 12-well plates. Plates were incubated at 37 °C and 5% CO 2 in a humidified incubator for 2 weeks. During colony growth, the culture medium was replaced every 3 days. Colonies were counted under a microscopic field at · 100 magnification. Each assay was performed in triplicate. Bioinformatic method The miRNA targets predicted by computer-aided algorithms were obtained from PicTar (the Rajewsky Lab, Berlin, Germany. http://pictar.mdc- berlin.de/ cgi-bin/new_PicTar_ vertebrate.cgi) and TargetScan Release 5.1 (Whitehead Insti- tute for Biomedical Research, Cambridge, MA, USA, http:// www.targetscan.org). EGFP reporter assay MGC803 cells were transfected in 48-well plates with 0.2 lg of IL6R EGFP reporter vector with wild-type or mutated miR-23a promotes gastric cancer growth L H. Zhu et al. 3732 FEBS Journal 277 (2010) 3726–3734 ª 2010 The Authors Journal compilation ª 2010 FEBS 3¢ UTR. Cells were also cotransfected with 20 pmol of miR-23a ASO or 0.2 lg of pcDNA3 ⁄ pri-23a per well. The assay was normalized with 0.05 lg of red fluorescence pro- tein expression vector pDsRed2-N1 (Clontech, Mountain View, CA, USA). Forty-eight hours after transfection, cells were lysed with lysis buffer (0.15 m NaCl, 0.05 m Tris ⁄ HCl pH 7.2, 1% Triton X-100, 0.1% SDS). The fluorescence intensities of EGFP and red fluorescence protein were detected with a Fluorescence Spectrophotometer F-4500 (Hitachi, Tokyo, Japan). Western blot analysis To determine the levels of protein expression, cells were trans- fected, lysed with RIPA lysis buffer and the proteins were harvested 48 h later. Proteins were resolved on a 10% SDS denatured polyacrylamide gel, transferred onto a nitrocellu- lose membrane, blocked with 5% skimmed milk, and then probed with the relevant primary antibodies to IL6R and GAPDH overnight at 4 °C. Membranes were washed and incubated with horseradish peroxidase-conjugated secondary antibody. Protein expression was assessed by enhanced chemiluminescence and exposure to chemiluminescent film. LabWorksÔ Image Acquisition and Analysis Software was used to quantify the band intensities. The antibody to IL6R was purchased from Saier Inc. (Tianjin, China), and all others were obtained from Sigma-Aldrich (St Louis, MO, USA). Statistical analysis The data were expressed as the means ± standard devia- tion (SD) and statistical analysis utilized a two-tailed Stu- dent’s t-test. Statistical significance was set at P £ 0.05. Acknowledgements We thank the Tumor Bank Facility of Tianjin Medical University Cancer Institute and Hospital and the National Foundation of Cancer Research for provid- ing human gastric tissue samples. We also thank the College of Public Health of Tianjin Medical University for technical assistance with fluorescence detection. This work was supported by the National Natural Science Foundation of China (NO: 30873017) and the Natural Science Foundation of Tianjin (NO: 08JCZDJC23300 and 09JCZDJC17500). References 1 Hatfield S & Ruohola-Baker H (2008) microRNA and stem cell function. Cell Tissue Res 331, 57–66. 2 Calin GA, Sevignani C, Dumitru CD, Hyslop T, Noch E, Yendamuri S, Shimizu M, Rattan S, Bullrich F, Negrini M et al. (2004) Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. Proc Natl Acad Sci USA 101, 2999–3004. 3 Calin GA, Liu CG, Sevignani C, Ferracin M, Felli N, Dumitru CD, Shimizu M, Cimmino A, Zupo S, Dono M et al. (2004) MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias. Proc Natl Acad Sci USA 101, 11755–11760. 4 Yanaihara N, Caplen N, Bowman E, Seike M, Kumam- oto K, Yi M, Stephens RM, Okamoto A, Yokota J, Tanaka T et al. (2006) Unique microRNA molecular profiles in lung cancer diagnosis and prognosis. Cancer Cell 9, 189–198. 5 Michael MZ, O’Connor SM, van Holst Pellekaan NG, Young GP & James RJ (2003) Reduced accumulation of specific microRNAs in colorectal neoplasia. Mol Cancer Res 1, 882–891. 6 Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E et al. (2006) The colorectal microRNA- ome. Proc Natl Acad Sci USA 103, 3687–3692. 7 Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S, Magri E, Pedriali M, Fabbri M, Campiglio M et al. (2005) MicroRNA gene expression deregulation in human breast cancer. Cancer Res 65, 7065–7070. 8 Pallante P, Visone R, Ferracin M, Ferraro A, Berlingi- eri MT, Troncone G, Chiappetta G, Liu CG, Santoro M, Negrini M et al. (2006) MicroRNA deregulation in human thyroid papillary carcinomas. Endocr Relat Cancer 13, 497–508. 9 Murakami Y, Yasuda T, Saigo K, Urashima T, Toyoda H, Okanoue T & Shimotohno K (2006) Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene 25, 2537–2545. 10 Chen X, Leung SY, Yuen ST, Chu KM, Ji J, Li R, Chan AS, Law S, Troyanskaya OG, Wong J et al. (2003) Variation in gene expression patterns in human gastric cancers. Mol Biol Cell 14, 3208–3215. 11 Kim JM, Sohn HY, Yoon SY, Oh JH, Yang JO, Kim JH, Song KS, Rho SM, Yoo HS, Kim YS et al. (2005) Identification of gastric cancer-related genes using a cDNA microarray containing novel expressed sequence tags expressed in gastric cancer cells. Clin Cancer Res 11, 473–482. 12 Ji Q, Hao X, Meng Y, Zhang M, Desano J, Fan D & Xu L (2008) Restoration of tumor suppressor miR-34 inhibits human p53-mutant gastric cancer tumorspheres. BMC Cancer 8, 266. 13 Liu T, Tang H, Lang Y, Liu M & Li X (2009) MicroRNA-27a functions as an oncogene in gastric adenocarcinoma by targeting prohibitin. Cancer Lett 273, 233–242. L H. Zhu et al. miR-23a promotes gastric cancer growth FEBS Journal 277 (2010) 3726–3734 ª 2010 The Authors Journal compilation ª 2010 FEBS 3733 14 Porkka KP, Pfeiffer MJ, Waltering KK, Vessella RL, Tammela TL & Visakorpi T (2007) MicroRNA expres- sion profiling in prostate cancer. Cancer Res 67, 6130– 6135. 15 Huang S, He X, Ding J, Liang L, Zhao Y, Zhang Z, Yao X, Pan Z, Zhang P, Li J et al. (2008) Upregulation of miR-23a27a24 decreases transforming growth fac- tor-beta-induced tumor-suppressive activities in human hepatocellular carcinoma cells. Int J Cancer 123, 972– 978. 16 Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP & Bartel DP (2007) MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell 27, 91–105. 17 Sontheimer EJ & Carthew RW (2005) Silence from within: endogenous siRNAs and miRNAs. Cell 122, 9–12. 18 Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM, Castle J, Bartel DP, Linsley PS & Johnson JM (2005) Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature 433, 769–773. 19 Wang X (2006) Systematic identification of microRNA functions by combining target prediction and expression profiling. Nucleic Acids Res 34, 1646–1652. 20 Zhang X, Zhang B, Gu Y & Hou S (2003) The effect of interleukin 6 on the growth of LNCaP and PC-3 prostatic carcinoma cells. Chin J Urol 24, 34–36. 21 Jones SA (2005) Directing transition from innate to acquired immunity: defining a role for IL-6. J Immunol 175, 3463–3468. 22 Gatti LL, Burbano RR, Zambaldi-Tunes M, de-Labio RW, de Assumpcao PP, de Arruda Cardoso-Smith M & Marques-Payao SL (2007) Interleukin-6 polymor- phisms, Helicobacter pylori infection in adult Brazilian patients with chronic gastritis and gastric adenocarci- noma. Arch Med Res 38, 551–555. 23 Ashizawa T, Okada R, Suzuki Y, Takagi M, Yamazaki T, Sumi T, Aoki T & Ohnuma S (2005) Clinical significance of interleukin-6 (IL-6) in the spread of gastric cancer: role of IL-6 as a prognostic factor. Gastric Cancer 8, 124–131. 24 He L, Thomson JM, Hemann MT, Hernando-Monge E, Mu D, Goodson S, Powers S, Cordon-Cardo C, Lowe SW, Hannon GJ et al. (2005) A microRNA polycistron as a potential human oncogene. Nature 435, 828–833. 25 Woods K, Thomson JM & Hammond SM (2007) Direct regulation of an oncogenic micro-RNA cluster by E2F transcription factors. J Biol Chem 282, 2130– 2134. 26 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y & Takahashi T (2005) A polycistronic microRNA cluster, miR-17-92, is overexpressed in human lung cancers and enhances cell proliferation. Cancer Res 65, 9628–9632. 27 Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, Barbisin M, Xu NL, Mahuvakar VR, Andersen MR et al. (2005) Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res 33, e179. miR-23a promotes gastric cancer growth L H. Zhu et al. 3734 FEBS Journal 277 (2010) 3726–3734 ª 2010 The Authors Journal compilation ª 2010 FEBS . MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor Li-Hua Zhu 1,2, *,. 2010 The Authors Journal compilation ª 2010 FEBS promote the growth of gastric adenocarcinoma cell line MGC803 by targeting directly the interleukin-6 receptor (IL6R)