An investigation the common errorrs in paragraph writing made by the second year students at vinh universite and some suggested solutions
An investigation the common errorrs in paragraph writing made by the second year students at vinh universite and some suggested solutions
... writing made by the second year students at Vinh University and some suggested solutions . The author hopes that it may contributeto the quality of teaching and learning writing skill in general and ... Thị Quyên An investigation into the common errors in paragraph writing made by the second year students at Vinh University and some suggested solutions (một cuộc điều tra về lỗi của sinh viên ... English; students usually face errors in using it, especially in writing skill. The author chooses the topic An investigation into the common errors in paragraph writing made by the second year students...
- 22
- 1,847
- 14
The major factors affecting speaking skill of first year english major students at vinh university and some suggested solutions tions improve their communicative competence
... knowledge. These compensatory strategies include code switching, intralingua transfer, cooperative strategies and non-linguistic strategies. The subclasses of intralingua transfer contain paraphrasing ... to create meaning relevance in the text. Non contradiction is avoiding the conflict in the meaning of the text. The contents of the utterances should be in harmony so that the text can be consistent.Actually, ... should use stress and rhythmic patterns, and intonation patterns of the language clearly enough so that people can understand what is said. Rhythm, stress and intonation are important factors to...
- 96
- 3,559
- 32
A study on common grammatical and lexical errors in writing compositions made by the first year english major students at hai phong private university and some suggested solutions
... errors of the first year English major students at HPU, there involves a lot of other aspects such as using grammar and lexis effectively in paragraph writing and essay writing, grammatical and lexical ... during the study. 1.1 .The common grammatical errors in writing compositions made by the first year English major students 23 1.2. The common lexical errors in writing compositions made by the ... CHAPTER 3: THE MAJOR CAUSES OF GRAMMATICAL AND LEXICAL ERRORS IN WRITING COMPOSITIONS MADE BY THE FIRST YEAR ENGLISH MAJOR STUDENTS AND SUGGESTED SOLUTIONS 1 .The major causes of grammatical and...
- 56
- 2,610
- 13
A CASE STUDY ON COMMON PROBLEMS IN LEARNING BUSINESS ENGLISH VOCABUALRY IN THE BOOK “BUSINESS BASICS” FACED BY THE 1ST YEAR STUDENTS AT VIETNAM UNIVERSITY OF COMMERCE, AND SOME SUGGESTED SOLUTIONS
... word “eating” is freestanding in itself, and that within it has another potentially freestanding element “eat”, independently meaningful from the second element “-ing”. These two meaningful ... Saying the words clearly one by one and writing them on the board, Using synonyms and antonyms, and Translating all the words into Vietnamese are most liked by the students. This may be explained ... one by one and writing them on the board. The next choice falls into the way of using synonyms and antonyms, counting for 19.8%, then comes the interest in translating all the new words into...
- 42
- 1,338
- 3
A study of difficulties in learning english listening skill for beginners in the asemlink of intrernational languages center and some suggested solutions
... to interpret and better understand the complex reality of a given situation and the implications of quantitative data. The most common qualitative methods are participant observation, in- depth ... pronunciation, understanding his grammar, recognizing his vocabulary and being able to grasp the meaning of what he says.” (Howatt and Dakin, 1974).Listening is different from hearing. Hearing is the ... skill in the Asemlink of international languages center it is better to base on the study.3.2.3. Study of teaching and learning the English listening skill in the Asemlink center in Vinh city3.2.3.1....
- 96
- 10,572
- 53
Designing an esp reading syllabus for the second year students at the faculty of urban planning hanoi architectural university (HAU)
... the informants become the main topics in the syllabus: Urbanization City planning Regional planning Relationship between socio-economic planning and spatial planning Strategic planning ... of the learners (as social being and as individual), and the activities which will take place in the classroom. Another definition belonging to the broad view was given by Dubin and Olshtain ... Urban design Planning of rural residential areas Sustainable planning Urban planning management 3.3.1.2. Reading skills and reading exercises The suggested reading skills gathered from the...
- 65
- 566
- 1
Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc
... GCGGAATTCGGGCCGAGGATCGG (located upstream of hbpS and ending at the 5¢-end of binding site III)F IIIEcofor GCCGAATTCCGCCGGACCGGATG (located upstream of hbpS and beginning at the 3¢-end of binding ... [10,11], and the VanR–VanS systemactivates the expression of vancomycin resistance[12,13]. Phosphate control of the production of actino-rhodin and undecylprodigiosin in S. lividans and S. coelicolor ... domainof SenS (SenSc) and SenR. Using designed mutant pro-teins, the phosphorylation sites within SenSc and SenRhave been investigated. Bandshift and footprintinganalyses have allowed the...
- 14
- 428
- 0
Từ khóa: the task realization in esp teaching for the second year students at aofresearch question 1 what are sentence errors made by the second year students at diplomatic academy of vietnamresearch question 2 what are the causes of the sentence errors made by the second year students at diplomatic academy of vietnaman investigation into reading relate to speaking skills of engish major second year studenta study of difficulties in learning english listening skill for beginners in the asemlink of intrernational languages center and some suggested solutionsthe difficulties of nonmajor of student in learning speaking skill and some suggested solutionsa study on the difficulties in learning speaking english of the first year students at the faculty of information technology thai nguyen universitysuggestions to make full use of tblt to teach esp for the non major second year students at aofbackground to the study the context of english teaching learning and testing of second year students at ueb vnuhcommon errors in english writingcommon errors in written english essays of form one chinese studentsan investigation into learning and teaching english vocabulary at cua lo hihg school and some suggested activities to help students learn betterprinciples of using songs in teaching engish to first year students at hui an application and evaluationproblems facing the 10th form students at th uss in learning vocabulary in reading comprehensions lessonsa study on using visual aids to teach grammar to the 10th form students at nghi loc iii high schoolBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ