Báo cáo y học: " A retrospective quality assessment of pre-hospital emergency medical documentation in motor vehicle accidents in south-eastern Norway"
Báo cáo y học: " A retrospective quality assessment of pre-hospital emergency medical documentation in motor vehicle accidents in south-eastern Norway"
... this article as: Staff and Søvik: A retrospective quality assessment ofpre-hospital emergency medical documentation in motor vehicleaccidents in south-eastern Norway. Scandinavian Journal of Trauma,Resuscitation ... ORIGINAL RESEARCH Open AccessA retrospective quality assessment of pre-hospitalemergency medical documentation in motorvehicle accidents in south-eastern NorwayTrine Staff1,2,4*and Signe Søvik3AbstractBackground: ... Norwegian Air Ambulance Foundation, Drøbak,NorwayFull list of author information is available at the end of the articleStaff and Søvik Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine...
- 11
- 705
- 1
Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"
... Gornik*1, Ana Vujaklija-Brajković1, Ivana PavlićRenar2 and Vladimir Gašparović1AbstractIntroduction: Critical illness is commonly complicated by hyperglycaemia caused by mediators of stress and inflammation. ... if insulin wasadministered for treatment of hyperglycaemia. Venousblood was analyzed on a point -of- care blood gas analyzer(IL GEM® Premier™ 3000, Instrumentation Laboratories,Lexington, MA, USA). ... according to theACC/AHA criteria [26,27]Statistical analysesMedCalc™ v. 9.6.2.0 (MedCalc Software, Mariakerke, Bel-gium). statistical software was used for all statistical anal-yses. Categorical data...
- 8
- 656
- 1
Báo cáo y học: "A three-country comparison of psychotropic medication prevalence in youth"
... School of Pharmacy, University of Maryland, Baltimore, Maryland, USA, 2Department of Psychiatry, School of Medicine, University of Maryland, Baltimore, Maryland, USA, 3Departments of Psychiatry and ... amphetamineproducts. Anticonvulsant-mood stabilizers (ATC-MS)included carbamazepine, divalproex/valproic acid, lamo-trigine, gabapentin and topiramate. Cross-national com-parisons of any psychotropic medication ... study aims to compare cross-national prevalence of psychotropic medication use in youth.Methods: A population-based analysis of psychotropic medication use based on administrative claims data forthe...
- 8
- 488
- 1
Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"
... physical activity and health literacy. Each group completed the same baseline and ending DXA bone density scans, 43-chemistry blood test panels, and 84-item Quality of Life Inventory (QOL). Changes ... The pri-mary outcome measure was changes in baseline BMD (Bone Mineral Density) among participants with above average compliance in order to examine the safety and efficacy in people ... Stryer DG, Clancy CM: Practical clinical trials: in- creasing the value of clinical research for decision making in clinical and health policy. JAMA. 2003; 290:1624– 1632. 39. Avorn...
- 12
- 663
- 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
... years). None of the NT subjects had a family history of hypertension; all had an SBP less than 130 mmHg and a DBP less than 85 mmHg. A family history of hypertension was defined as having grandparents, ... Sequencing analysis Two oligonucleotides (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’- CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a ... ventricular hypertrophy in the Japanese. Circ Res. 2000; 86: 841-5. 13. Nakayama T, Soma M, Rahmutula D, Ozawa Y, Kanmatsuse K. Isolation of the 5'-flanking region of genes by thermal asymmet-ric...
- 7
- 612
- 1
Báo cáo Y học: A functionally conserved member of the FTZ-F1 nuclear receptor family from Schistosoma mansoni doc
... DNA binding and tran-scriptional activation in transfected cell lines.MATERIALS AND METHODSParasites A Puerto-Rican strain of S. mansoni was maintained in Biomphalaria glabrata snails and golden ... specificity as mammalian SF-1.Moreover, it can transactivate transcription of a reportergene in mammalian cell lines. This demonstrates that it caninteract with mammalian coactivators of transcription ... This indicates that at least some of themammalian coactivators are capable of interacting withSmFTZ-F1, most probably through its conserved AF2domain. This in turn implies that similar cofactors...
- 12
- 541
- 0
Báo cáo Y học: A model for recognition of polychlorinated dibenzo-p-dioxins by the aryl hydrocarbon receptor docx
... ligands; in FixL, oxygen binding at the hemebinding PAS domain controls the activity of a h istidinekinase domain [12]; and in PYP, a local conformationalchange occurs once the p-hydroxycinnamoyl ... encompassing two imperfect repeats of 110 aminoacids ( PAS -A and PAS-B) separated by a sequence of 50amino acids. A minimal LBD was mapped in the mouseAhR (mAhR) between amino acids 230 and ... FanelliÕ, Universita'di Roma ÔLa SapienzaÕ, Roma, ItalyLigand binding by the aryl hydrocarbon receptor (AhR), a member of the bHLH-PAS family of transcriptional reg-ulatory proteins, has...
- 6
- 569
- 0
Báo cáo Y học: A nonphosphorylated 14-3-3 binding motif on exoenzyme S that is functional in vivo pot
... G-protein Ras – as a readout [35].Secondly, we employed a cytotoxicity assay, since the ADP-ribosylation activity of ExoS mediates a marked change in cell morphology and has a lethal activity upon ... question can be approached by using an in vitro Ras modification assay, where ADP-ribosylation of Ras by ExoS is reflected by a gel mobility shift of Ras onSDS/PAGE [35]. Incubation of Ha-Ras, 14-3-3, ... primer pair pexoSa (forward):5¢-CGGAGAAACTCGAGGAGAAGGCAACCATC-3¢,pexoSb (reverse): 5¢-GTCTTTCTGGTACCACCGGTCAGGCCAGA-3¢. pMF419 and pMF420 were obtained byreplacing the C-terminal ClaI/KpnI fragment...
- 9
- 394
- 0
Báo cáo Y học: A new conceptual framework for enzyme catalysis Hydrogen tunneling coupled to enzyme dynamics in flavoprotein and quinoprotein enzymes docx
... breakage in three different substrates byAlcaligenes faecalis AADH [39], the fast substrates dopam-ine and tryptamine, and the slow substrate benzylamine.Again,aswithMADHandTSOX,anindicationasto ... tryptophan tryptophyl-quinone (TTQ)-dependent amine oxidases methylaminedehydrogenase (MADH) and aromatic amine dehydroge-nase (AADH), and also the flavoenzymes trimethylaminedehydrogenase ... nss4@le.ac.ukAbbreviations:TST,transitionstatetheory;TTQ,tryptophantrypto-phylquinone; MADH, methylamine dehydrogenase; AADH, aroma-tic amine dehydrogenase; TMADH, trimethylamine dehydrogenase;TSOX, heterotetrameric sarcosine dehydrogenase;...
- 7
- 359
- 0
Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"
... Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International Normalized Ratio; ... prior to ablation for AVNRT-, AVRT-and EAT patients. Panel A: Quantity and duration of episodes and the associated symptoms. Panel B: Detraction in daily life generally and in parts of daily life. ... Lau CP, Tai YT, Lee PW. The effects of radiofrequency ablation versus medical therapy on the quality- of- life and exercise ca-pacity in patients with accessory pathway-mediated supraven-tricular...
- 9
- 679
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ