Physicochemical properties of polluted water of river Ganga at Varanasi
Physicochemical properties of polluted water of river Ganga at Varanasi
... Environment Foundation. All rights reserved. Physicochemical properties of polluted water of river Ganga at Varanasi Singh Namrata Department of Zoology, HarishChandra post Graduate College, Varanasi, ... impact of seasonal changes on the physiochemical properties of water of river Ganga at six selected sampling sites i.e. Assi Ghat, Shiwala Ghat, Chauki Ghat, Harishchandra Ghat, Rajendra Prasad Ghat, ... Assi Ghat, Shiwala Ghat, Chauki Ghat, Harishchandra Ghat, Rajendraprasad Ghat, and Raj Ghat. During investigation waste water was collected from six different sites to evaluate physicochemicalproperties...
- 10
- 292
- 0
DIRECT TREATMENT OF POLLUTED RIVER WATER BY THE MULTI-SOIL-LAYERING METHOD
... concentration in treated water, however, fluctuated rather small to the daily fluctuation. Pattern of T-N fluctuation in river water was similar to that of BOD, but not for that in treated water. There ... both river and treated water followed the pattern of BOD in river water. NH 4 -N, NO 2 -N and NO 3 -N in river water followed the pattern of T-N, but those in treated water did not fluctuate so ... and increase its concentration in loading water. Fluctuation of T-N in treated water showed similar pattern of that in pre-treated water, and was more fluctuated than that of BOD. Nitrogen discharged...
- 8
- 689
- 2
Báo cáo " PRELIMINARY ASSESSMENT AND SIMULATION OF THE WATER QUALITY OF CAU RIVER, BAC NINH PROVINCE BY MATHEMATICAL MODEL " pptx
... self-purification ability of Cau River. 3.2 Modeling water quality of Cau River by QUAL2E The Enhanced Stream Water Quality Model (QUAL2E) is a comprehensive and versatile stream water quality ... pollution, river water quality is showing signs of pollution at some degrees. For the season, it is necessary to assessing and monitoring river water quality, then using models to simulate water ... to be supplied with clean water, reduce as much as possible the uses of river water. It is necessary to have solution to treat waste water in craft villages. More water samples should be taken...
- 5
- 433
- 0
Báo cáo "Development of cooperative research on assessment of climate change impacts on water resources of Vietnam-China transboundary river basins " doc
... development of Vietnam and China. The main upstream rivers of Hong River system, include: Ly Tien (upstream of Da River) , Nguyen River (upstream of Thao river ) and Ban Long river (upstream of Lo river) ... large daily water level fluctuation which is contrast to natural law: daily water fluctuation is around 1.5-2.0m on Da river at Muong Te, 0.5-1.0m at Nam Giang, 1.0-1.3m on Lo river at Ha Giang ... information exchange, cooperative research and development of general principles of integrated management of international river basins. Cooperative research and rational use of transboundary water...
- 6
- 420
- 0
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc
... pBottomO1O2O2clO3O2croO1O1+–––1405'CATTTTCTTACCTCCTTAAATTTACCTATAGTATAACCCAATTATTTTTGGTATTCAGTAAAAGAATGGAGGAATTTAAATGGATATCATATTGGGTTAATAAAAACCATAAGTACAAAAAAATACACGAAAAGCAAACTTTTATGTTGACTCAAGTACACGTATCGTGTATTGTTTTTTTATGTGCTTTTCGTTTGAAAATACAACTGAGTTCATGTGCATAGCACATAAGTAGGTTTTGTAAGCGGGAGGTGACAACATGTCATCCAAAACATTCGCCCTCCACTGTTGTAC ... unbound state. The maxi-mum amount of bound operator in complex 1 was estimated from curve 1. The amounts of operator in complex 2 and in the unbound state at the condition of maximum bound operator ... ver-sus the incubation temperature (Fig. 1C, inset) showsthat the melting temperature of CI is close to 41 °C. At this temperature, the concentration ratio of native12345678302520153025201510151050–5–10–15–20[θ]...
- 11
- 432
- 0
Báo cáo "A study of waste water impacts of main factories on water quality of To Lich river, Ha Noi " doc
... Lich river. 3.3. The influence of pollutants loads in factory waste water on water quality of To Lich river To assess the pollutants load in factory waste water to water quality of the river ... waste water of factories. So, factories impact the water quality of the To Lich River. From the factory waste water analysis it is found that, the main pollutants in waste water in To Lich river ... tranvanquy@hus.edu.vn affecting to water quality of the river, especially industrial waste water. These sources account for more than one-third of total volume of waste water of To Lich river (about 70.000...
- 5
- 357
- 0
Simulation of Ground-Water Flow and Evaluation of Water-Management Alternatives in the Assabet River Basin, Eastern Massachusetts pptx
... Survey Water- Resources Investigations Report 93-4121, 45 p.2 Simulation of Ground -Water Flow and Evaluation of Water- Management Alternatives in the Assabet River Basin, Eastern MASimulation-optimization ... Department of Conservation and RecreationScientific Investigations Report 2004-5114U.S. Department of the Interior U.S. Geological Survey12 Simulation of Ground -Water Flow and Evaluation of Water- Management ... water and mean water- level elevation for water year 2002 are averages of interpolated daily values.2No data for June 2002.3No data for April 2002.4Missing data for winter 2002 because of...
- 142
- 1,437
- 0
Influence of the support on the physicochemical properties of Pt electrocatalysts: Comparison of catalysts supported on different carbon materials
... supports inthe preparation of electrocatalysts. The use ofthese non-conventional carbon mate-rials as support allows studying the influence of carbon properties on the preparation of catalysts. Carbon ... support. Results proved that the support has a strong influence onthe physicochemical properties of catalysts. These properties depended on the nature of the support andare associated with the metal–support ... supports that could replace carbon black in the preparation of commercial electrocata-lysts. The use of these non-conventional carbon materials allowed the determination of the influence of the support...
- 7
- 469
- 0
Assessment of source of air, water, and land pollution
...
- 263
- 861
- 4
Từ khóa: much of the toxicity of hb has been linked to its redox activity; hb may generate reactive oxygen speciesplanning atlas of the lower mekong river basineffect of polluted environment on human healthassessment of sources of air water and land pollutiongive detailed account of the effect of water pollution on the environment and human healthBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam