ConstructionandCharacterizationofaFulllengthcDNALibraryandIdentificationof GenesInvolvedinSalinityStressinWild Eggplant(SolanumtorvumSwartz)
báo cáo khoa học: " Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome" pdf
... and PGB04 (AACAAATTTACTCATTTA CCCGTGA, CCCATCAAAATCCATGCCCAAG, TTCCAAGTTCTTGTGGGAGGAG, GACTGATTTTCTCTCCACCAAGCAAG) Sequence analysis Repetitive DNA was identified with the RepeatMasker software ... on the BAC scaffolds of PGB02 (3CAR) (ACCCATCTTCACAAAATTAC, GTAGTCCATAACGAGCAGAA) and PGB04 (CYP720B4) (TGATATTTGGTCTGCCATGGGCG, CATTTCCCTGCATGTATTCAATGCC, CCACCACATAGTTAGACCGTGATGC) Authors' ... contain a TCA-element at positions -815 and -3,291 in PGB02 and at positions 1,227, -676 and -1,162 (TCAGAAGAGG, GAGAAGAATA and CAGAAAAGGA) in PGB04, respectively This element was first characterised...
- 13
- 329
- 0
Construction of bacterial artificial chromosome library for kineosphaera limosa strain lpha5t and screening of genes involved in polyhydroxyalkanoate synthesis
... CONSTRUCTION OF BACTERIAL ARTIFICAL CHROMOSOME LIBRARY FOR Kineosphaera limosa STRAIN Lpha5T AND SCREENING OF GENES INVOLVED IN POLYHYDROXYALKANOATE SYNTHESIS JI ZHIJUAN ... (BAC) library of Kineosphaera limosa strain Lpha5T was constructed in vector pBeloBAC11 Lpha5T BAC library contains 7680 BAC clones with an average insert of 23.5 kb BAC library of Kineosphaera limosa ... isolate and further investigate the genes involved in the metabolisms of PHA in EBPR systems The bacterial isolate was Kineosphaera limosa strain Lpha5T isolated from an inefficient EBPR reactor Lpha5T...
- 116
- 492
- 0
Báo cáo y học: " Transcriptome profiling of primary murine monocytes, lung macrophages and lung dendritic cells reveals a distinct expression of genes involved in cell trafficking" pot
... investigating the relation, differentiation and/ or maturation of monocytes, macrophages and DC have been mainly conducted in vitro using both murine and human cells [33-35] A study comparing primary ... purity of sorted cells used for the microarray experiments (PBMo, lung DC and lung Mϕ) was assessed by flow cytometry and Pappenheim-stained cytospins and was always ≥ 98% As sample processing may ... Validation of chemokine and interleukin genes byqRT-PCR Validation of chemokine and interleukin genes byqRT-PCR PBMo, lung Mϕ and DC were sorted as shown in Fig 1A and 2A mRNA expression was assessed...
- 16
- 320
- 0
Báo cáo y học: "Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes"
... ethanol- regulated genes were involved using KEGG (Kyoto Encyclopedia of Genes and Genomes) [36] and GenMAPP (Gene Microarray Pathway Profiler) [37] analysis As shown in Table 2, only ITGB4 was found to be involved ... considering the reported high expression of the ankyrin-repeat oncoprotein (gankyrin) in human hepatocellular carcinoma Gankyrin binds to the cell-cycle regulator CDK4 and the S6b ATPase subunit of ... chemokines in monocytes and macrophages (including Kupffer cells) [41, 42], and ethanol- induced mucosal injury in the upper gastrointestinal tract leading to increase in the permeability of the gut...
- 8
- 702
- 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
... identification and quantification of puromycin were achieved by a Pac enzymatic assay [21] Preparation of 3¢-amino-3¢-deoxyadenosine 3¢-amino-3¢-deoxyadenosine was obtained from Helminthosporium sp ATCC20154 ... Schematic representation of the putative biosynthetic pathway of the 3¢-amino-3¢deoxyadenosine moiety of A2 0 1A and puromycin Dpur4 mutants The results indicated that this mutation was clearly complemented ... erythraea, the erythromycin-producing organism, has permitted the isolation of Streptomyces antibioticus genes implicated in oleandomycin biosynthesis [40] Gene analyses and enzymatic assays suggest...
- 9
- 728
- 0
Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt
... devoid of a given essential amino acid Our data suggest that the GCN2 pathway is directly involved in the regulation of amino acid and protein metabolism, as many of the genes involved in these processes ... their biological processes reveals that amino acid limitation regulates groups of genes that are involved in amino acid and protein metabolism, lipid and carbohydrate metabolism and various processes ... by amino acid starvation Further investigations are necessary to determine the relevance of the amino acid regulation of the genes involved in carbohydrate and lipid metabolism In particular, the...
- 12
- 560
- 0
Effects of high glucose concentrations on the expression of genes involved in proliferation and cell fate specification of mouse embryonic neural stem cells
... EFFECTS OF HIGH GLUCOSE CONCENTRATIONS ON THE EXPRESSION OF GENES INVOLVED IN PROLIFERATION AND CELL- FATE SPECIFICATION OF MOUSE EMBRYONIC NEURAL STEM CELLS FU JIANG (MD, MMed) A THESIS ... Illustration Schematic summary of the effects of high glucose on the expression of developmental control genes that are involved in proliferation, survival and differentiation of neural stem cells ... promote the differentiation of autonomic neurons and induce the expression of Ascl1 indicating that BMP2 and BMP4 control the specification of autonomic neurons through the induction of Ascl1 expression...
- 257
- 293
- 0
the regulation of genes involved in trichome development
... redundant inhibitors of trichome initiation The key to understanding the process by which a cell adopts the trichome fate lies not only in finding the components of the initiation and inhibitory ... preferentially with the bHLH dimer, preventing expression of genes involved in trichome development TTG would act in the cytoplasm most probably aiding in the association of the bHLH dimer 13 enters the nucleus ... changes One of the most interesting of these changes has to with the regulation of the cell cycle Early in their development trichomes replicate their chromosomes several times without undergoing mitosis...
- 186
- 167
- 0
the regulation of genes involved in trichome development(fileminimizer)
... redundant inhibitors of trichome initiation The key to understanding the process by which a cell adopts the trichome fate lies not only in finding the components of the initiation and inhibitory ... preferentially with the bHLH dimer, preventing expression of genes involved in trichome development TTG would act in the cytoplasm most probably aiding in the association of the bHLH dimer 13 enters the nucleus ... interactions between proteins involved in trichome patterning A combination of a MYB protein (either GL1 or MYB23) with a bHLH dimer (any combination of GL3 or EGL3) produces the trichome initiation complex...
- 186
- 210
- 0
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt
... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC2–5 and Rad9–Rad1–Hus1) ... (AtRPA7 0a and AtRPA70b, respectively) and because many T-DNA insertion mutants of A thaliana are already available [26] We were able to obtain one T-DNA insertion line each for AtRPA7 0a and AtRPA70b...
- 12
- 588
- 0
báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx
... bullets Infiltration depth of barium titanate particles in the temporary cavity The radiological examination of the infiltration depth of barium titanate particles within the ruptures of a temporary ... conceived of the work and participated in its design and coordination CS and MR made substantial contributions to data acquisation and conception of manuscript CS and MR drafted and designed the manuscript ... characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation Head & Face Medicine 2011 7:18 Competing interests The authors declare that they have...
- 5
- 573
- 0
Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx
... in the HD -caveolae and LD -caveolae; (c) the VHD -caveolae contained almost a third of the plasma membrane caveolin, and the majority of cellular caveolin is found in the plasma membrane of adipocytes; ... referring to all of them as caveolae, was demonstrated by their content of both caveolin-1 and caveolin-2 The coexistence of caveolin-1 and caveolin-2 in all three caveolae subclasses is in line ... lower in the LD -caveolae than in the closed VHD -caveolae, demonstrating that factors other than caveolin control the concentration of cholesterol in the plasma membrane and its domains Others...
- 12
- 460
- 0
Báo cáo khoa học: Theoretical study of lipid biosynthesis in wild-type Escherichia coli and in a protoplast-type L-form using elementary flux mode analysis potx
... detectable in the cell wall-free mutant These findings stand in contrast to a subsequent analysis of singlegene knockout data indicating that E coli can only survive if at least L1-P-EtAmine and a lipid ... synthesis of unsaturated and saturated fatty acids, phospholipids (including cardiolipin), and lipid A It is important to study the metabolism of the glucosamine-based lipid A, because it is a major ... substrates In contrast, side modes use products of interest as substrates An example of such a side mode is an EFM that converts lipid A into lipid A (ca) Redundancy as a main characteristic of the wild-type...
- 12
- 553
- 0
Báo cáo khoa học: Identification and characterization of important residues in the catalytic mechanism of CMP-Neu5Ac synthetase from Neisseria meningitidis potx
... as important catalytic residues, indicating a role in binding the nucleotide into the active site [15,16] The crystal structure of CNS from Neisseria meningitidis crystallized in the presence of ... stereo-view of the residues of interest (blue) in the active site of the CNS from Neisseria meningitidis containing CDP (yellow) (PDB 1EYR) [12] superimposed with their equivalent residues (green) of the ... form the binding site of the catalytic Mg2+ ion We have determined the kinetic parameters of the wild-type enzyme from N meningitidis using a continuous spectrophotometric assay measuring the...
- 12
- 463
- 0
Từ khóa: bioinformatics search of atox1 consensus sequences and response elements in the promoter of genes involved in dna damage response and antioxidant defenseservices which are capable of artificial construction and require low labour input in relation to their valueboy restrained and seat belted is involved in a motor vehicle crash he is admitted to the hospital for abdominal pain and also complains of someexpression purification and characterization of hiv 1 in proteinspostmortem dna qc considerations for sequence and dosage analysis of genes implicated in long qamp adaptive characterization of visual contents in image retrieval systemsgenes involved in the secretion and action of insulinobese and children who are involved in weight reduction behaviour 2005 06genes involved in ion transport and its regulationconstruction and management of a lying in institution and training school for midwives and midwifery nursesconstruction purification and characterization of escherichia coli rna polymerases tagged with different fluorescent protecloning expression and characterization of a scfv f8 human il10 fusion proteinisolation cdna library construction and sequencingexample of design and characterization of a specific protein protein interactionpreliminary characterization of mutants in group a and bBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThơ nôm tứ tuyệt trào phúng hồ xuân hươngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ