Illustrated key for the identification of brachyuran zoeal stages (crustacea decapoda) in the plankton of peter the great bay (sea of japan)

... 1858 are found only in Possyet Bay (eastern Peter the Great Bay) Brachyuran larvae occur in Peter the Great Bay from April to November Zoea of each species represented in this key has been previously ... also for Paradorippe granulata Different zoeal stages of brachyuran crabs (age distinctions) are easily determined using the number of natatory setae on the exopods of maxillipeds, the number of ... Peter the Great Bay (Russian waters of the Sea of Japan) We found larvae of only 16 species from families and 14 genera occurring in the plankton of Peter the Great Bay (Table 1) To date, we have...

Báo cáo y học: "An optimization framework for unsupervised identification of rare copy number variation from SNP array data." doc

... other SNP arrays, including earlier versions of the Affymetrix platform, Illumina arrays, or array comparative genomic (a) 2.5 Raw copy number Raw copy number 3.0 hybridization Any platform that ... Birdsuite platform [17] QuantiSNP [26] is an analytical tool for the analysis of copy number variation using whole genome SNP genotyping data It was originally developed for Illumina arrays, but version ... segments of consistent copy number The Affymetrix SNP array was originally designed so that each SNP is interrogated by 24 to 40 unique probes Of these, half are perfectly complementary to the...

key for the phrasal verb(take, look, turn, bring)

... over the capital city and gained control of the government 38 Jim really takes after his father They look the same, they act the same - they even have the same laugh! 39 You thought I stole your ... went down to the beaches near Cape Canaveral to watch the space shuttle take off The launch was magnificent 37 There was a military coup d'etat in the tiny nation The military took over the capital ... 26 They were showing so many commercials during that movie that I finally just got up and turned off the TV 27 The witch turned the handsome prince into a frog 28 Although Sam wanted to keep the...

Báo cáo khoa học: "A Unified Statistical Model for the Identification of English BaseNP" pptx

... conclusions The statistical approach In this section, we will describe the two-pass statistical model, parameters training and Viterbi algorithm for the search of the best sequences of POS tagging ... one of the N-best POS tagging result of the sentence is: T = NN VBD RB CD NNS NN NN For this POS sequence, the 2nd pass will try to determine the baseNPs as shown in Figure The details of the ... possible brackets of "stock was down 9.1 points yesterday morning" Figure 3: the transformed form of the path with dash line for the second pass processing As required in our statistical model, we have...

Báo cáo Y học: The cytoplasmic C-terminus of the sulfonylurea receptor is important for KATP channel function but is not key for complex assembly or trafﬁcking pdf

... complex The data reported here show that the cytoplasmic C-terminus of SUR1 has a key role in channel function but is not absolutely required for complex assembly or trafficking Our data support aspects ... DISCUSSION In this study we report a comprehensive study in a mammalian cell line of the effects of deletion of the SUR1 C-terminus on assembly, trafficking and function of the KATP channel complex ... stimulation by MgADP and diazoxide and support the above hypothesis Sulfonylurea action is more subtly altered The Kd for tritiated glibenclamide binding is not significantly changed However tolbutamide,...

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

... TTTGACCTGGAGACTATGttymgngartayaa ACCTTCATCAAAAATCCCttnggnggnatgyt GACGACCGCAGCGTGTGCGTGaaygtnttyggnca TAAAAGTACAGCTCCTGCCCGaanacrttnacrca TTAGCTACTCCGTGGAGCagyttrtcraarta GAAGTGGCAGTTGGAGAGGCTGACCTCCcartcncc ... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... (151aa) CAB61754 (151aa) AAC55648 (55aa) AAD30141 (56aa) AAG23218 (158aa) AAC57974 (151aa) DFASA-GDTD1B AAF23082 (158aa) DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B...

convergence rates for the tikhonov regularization of coefficient identification problems in elliptic equations

... convergence rates for the Tikhonov regularization of the problems of identifying the coeﬃcient q in the Neumann problem for the elliptic equation −div(q∇u) = f in Ω, ∂u q = g on ∂Ω ∂n (0.5) (0.6) and the ... VIETNAM ACADEMY OF SCIENCE AND TECHNOLOGY INSTITUTE OF MATHEMATICS TRẦN NHÂN TÂM QUYỀN Convergence Rates for the Tikhonov Regularization of Coefficient Identification Problems in Elliptic Equations ... ill-posed problems (see [41, 42, 108]) 23 0.4 Summary of the Dissertation In this dissertation we investigate convergence rates for the Tikhonov regularization of the problems of identifying the coeﬃcient...

tóm tắt luận án tiến sĩ convergence rates for the tikhonov regularization of coefficient identification problems in elliptic equations

... we investigate the inverse problems of identifying the coefficient q in the Neumann problem for the elliptic equation −div(q∇u) = f in Ω, ∂u q = g on ∂Ω ∂n (0.1) (0.2) and the coefficient a in the ... methods The authors of these works used the output least-squares method with the Tikhonov regularization of the nonlinear ill-posed problems and obtained some convergence rates under certain source ... Convergence rates for L2 -regularization of the diffusion coefficient identification problem 2.1.1 L2 -regularization For solving the problem of identifying the coefficient q in (0.1)–(0.2) we solve the minimization...

Báo cáo y học: "Identification of an altered peptide ligand based on the endogenously presented, rheumatoid arthritis-associated, human cartilage glycoprotein-39(263–275) epitope: an MHC anchor variant peptide for immune modulation" pot

... substitutions may function as partial TCR agonists on the one hand and prevent unwanted immune reactivity on the other [32,33] This approach may thus provide an improved option for APL therapy The ... methods Peptides and altered peptide ligands Peptides were synthesised by solid phase peptide synthesis Purity and identity of the peptides were assessed by reverse phase high performance liquid chromatography ... not shown) In conclusion, the analysis of both the hybridoma panel and the polyclonal T cell response to the 263–275 epitope has led to the identification of MHC binding and TCR contact residues...

Báo cáo y học: "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" pptx

... of all miR loci in the Ciona genome Altogether, miRTRAP generated an apparent false negative rate of approximately 5% and a false discovery rate of approximately 19% To systematically compare ... endogenous human Argonautes and their miRNA partners in RNA silencing Proc Natl Acad Sci USA 2008, 105:7964-7969 33 Katayama S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura M, Nishida H, Yap CC, ... to other genomes will reveal additional novel miRs Materials and methods Library preparation, sequencing and Northern analysis Ciona stage-specific small RNA library preparation and Illumina sequencing...

Báo cáo y học: "Dermoscopy as a technique for the early identification of foot melanoma" pot

... skin A videomicroscopic analysis Arch Dermatol 1998, 134:563-568 Saida T, Miyazaki A, Oguchi S, Ishihara Y, Yamazaki Y, Murase S, Yoshikawa S, Tsuchida T, Kawabata Y, Tamaki K: Significance of ... clinical diagnosis Arch Dermatol 1995, 131:298-304 Saida T, Yoshida N, Ikegawa S, Ishihara K, Nakajima T: Clinical guidelines for the early detection of plantar malignant melanoma J Am Acad Dermatol ... primary care physicians In the UK, courses have been running for a number of years and include a range of health care practitioners The most recent meta analysis of dermoscopy [36] has encompassed...

báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx

... showed the accumulation of Ca/Sb precipitates in the vacuoles of the stigma cells as well as in the intracellular spaces between them The stigmatic surface is the main place for signal exchange ... precipitates The spectrum of the material reveals peaks for Ca and Sb The strong decrease of the Ca2+ pool in the pistil at the last stages of pistil development coincides with the degradation of the ... 3-fold in comparison with that found in stage A more detailed analysis of the changes in the olive pistil Ca2+ pool was performed using the separated parts of the pistil: stigma with style and ovary...

Xem thêm

Từ khóa: aquatic toxicity for hazard identification of metals and inorganic metal substances principles guiding screening for early identification of mental health and substance use problems in children and adolescents characterization of additives for source identification of refined products evidence for the u s europe and japan a unified statistical model for the identification of english basenp 2 where the customer has not been physically present for identification purposes a relevant person must take specific and adequate measures to compensate for the higher risk for example by applying one or more of the following measures—multi agent methods an example of an architecture and its application for the detection recognition and identification of targets the use of multiplex pcr and an adapted hplc method for identification of mycobacterium bovis and diagnosis of bovine tuberculosis testing for the presence of a key in a hash aureus identification for the nuc or fema gene and detection of the meca for methicillin resistance a rational strategy for the identification and testing of new agents identification of desirable and feasible changes for the system an evaluation of the evidence for linkages between mangroves and fisheries a synthesis of the literature and identification of research directions technique named mgk monitoring of gene knockouts for genome wide identification of conditionally essential genes mgk identified bacterial genes that are critical for fitness in the absence and there is an immediate need for the development of novel and more effective therapeutic modalities against this deadly disease Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ