0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Vật lý >

from the end of the rainbow to the edge of time ajourney through the wonders of physics FOR THE LOVE OF PHYSICS

Certain issues from the perspective of applying the Communicative Language Teaching to the teaching of oral English in HaUI

Certain issues from the perspective of applying the Communicative Language Teaching to the teaching of oral English in HaUI

... investigates the reality of the teaching oral skills to the first year students in HaUI when the teachers are considered to be applying CLT approach in their teaching The main goal of the research is to ... relevance of communicative approach to language teaching in view of the cultural conflicts of different educational theories arising from the introduction of a predominantly Western language teaching ... also inconsistent with their understanding of language teaching In the case of the activity Reading and reporting from website, only 14% of the teachers said they 'use it regularly' when 50% of them...
  • 44
  • 740
  • 2
Tài liệu A REVIEW OF INDOOR AIR POLLUTION AND HEALTH PROBLEMS FROM THE VIEWPOINT OF ENVIRONMENTAL HYGIENE: FOCUSING ON THE STUDIES OF INDOOR AIR ENVIRONMENT IN JAPAN COMPARED TO THOSE OF FOREIGN COUNTRIES pptx

Tài liệu A REVIEW OF INDOOR AIR POLLUTION AND HEALTH PROBLEMS FROM THE VIEWPOINT OF ENVIRONMENTAL HYGIENE: FOCUSING ON THE STUDIES OF INDOOR AIR ENVIRONMENT IN JAPAN COMPARED TO THOSE OF FOREIGN COUNTRIES pptx

... to total concentrations of multiple indoor air pollutants It is used as a complementary indicator to decrease indoor pollution level in total and achieve healthy indoor air environment. 109) The ... determination and the comparison of their value Indoor Environ., 11, 1–9 (in Japanese) Fukutomi, Y., Yasuda, H., Nakazawa, T., Taniguchi, M and Akiyama, K (2009) Indoor Mite and Insect Allergens and ... E., Ohno, H and Nakajima, T (2009) Annual transition and seasonal variation of indoor air pollution levels of 2-ethyl-1hexanol in large-scale buildings in Nagoya, Japan J Environ Monit., 11, 2068–2076...
  • 14
  • 940
  • 1
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

... GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT ... TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG...
  • 15
  • 597
  • 0
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

... was observed (not shown) The arrow indicates the absorption maximum of the a band at 557 nm absorption maxima at 420 nm (c band), 530 nm (b band) and 557 nm (a band) are characteristic of cytochrome ... of an enzyme preparation containing only minor amounts of the 16-kDa c-type cytochrome The Table Features of the subunits of the Hme complex from A fulgidus Data are either derived from the analysis ... DISCUSSION A large number of protein sequences related to the catalytic subunit of Hdr from methanogenic archaea have been deposited in the databases None of these putative proteins has been characterized...
  • 10
  • 564
  • 0
Tài liệu Báo cáo Y học: Trehalose-based oligosaccharides isolated from the cytoplasm of Mycobacterium smegmatis Relation to trehalose-based oligosaccharides attached to lipid docx

Tài liệu Báo cáo Y học: Trehalose-based oligosaccharides isolated from the cytoplasm of Mycobacterium smegmatis Relation to trehalose-based oligosaccharides attached to lipid docx

... known They could be synthesized in the cytosol by glycosyltransferases which add glucosyl or galactosyl residues to the free trehalose that arises from trehalose phosphate by the action of the specific ... and isolated from the cytoplasm of M smegmatis, will also be found as part of the cell wall components of this organism All trehalose-containing structures reported from mycobacterial glycolipids ... the 3-hydroxy group of the second glucose of trehalose, has been isolated from the cell wall lipids of Mycobacterium kansasii [1] That study strongly suggests that some of the oligosaccharides described...
  • 8
  • 403
  • 0
Báo cáo

Báo cáo "Evolution of holocene depositional environments in the coastal area from the Tien river to the Hau river mouths " pot

... low-lying plain in front of river mouth or tidal channel inside islands The late Holocene lithofacies distributed from to -20 m water depth in the area of delta front and prodelta Seaward, with increasing ... available The pH value of clays varies from 6,9 to 7,5, Eh from -20mv to +150mv and Kt from 0,7 to 1,4 These environment indicators proved a brackish transitional environment from river to the sea ... to express all composition and evolution of the depositional environments in coastal and nearshore area from 12Ky Bp to present Study on facies changing in time and space helps to determine river...
  • 17
  • 556
  • 0
Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx

Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx

... 10 of the experiment This inactivation was not due to a temperature rise during pressurization The b-glucosidase from P furiosus does not become inactivated after weeks of storage at temperatures ... compared to that of unpressurized samples The influence of pressure treatment on enzyme inactivation The inactivation of b-glucosidase was measured after pressure release as a function of the incubation ... aggregate [21] The thermal stability of b-glucosidase was assessed by plotting the temperature dependence of the peak intensity at 1618 cm)1 (Fig 4B) The melting point of the enzyme was estimated to...
  • 9
  • 340
  • 0
Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf

Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf

... resistant to cleavage with chymotrypsin, trypsin, papain, or pronase Protozoan parasites of the genus Giardia are one of the earliest lineages of eukaryotic cells, and the Giardia protease is the ... expressed at a high level (data not shown) DISCUSSION Computer analysis of b-expansins reveals significant similarity to cathepsins, which are members of the C1 family of cysteine proteinases WU-BLAST ... proteinases of G lamblia and G gallus All Cys and Trp residues are absolutely conserved in a- expansins and b-expansins as well as in the C1 cysteine proteinases Other highly conserved amino acids of cathepsin...
  • 10
  • 535
  • 0
A guide to larvae and juveniles of some common fsh species from the Mekong River Basin

A guide to larvae and juveniles of some common fsh species from the Mekong River Basin

... ventrally on tail Large triangular melanopore laterally over hypural bones, dorsal and anal fin Page 31 A guide to larvae and juveniles of some common fish species from the Mekong River Basin day ... laterally Dorsally and laterally on head and body Ventrally on tail Dorsal-fin spine, anterior, distal half of dorsal fin Page 37 A guide to larvae and juveniles of some common fish species from ... caudal fins Page 25 A guide to larvae and juveniles of some common fish species from the Mekong River Basin hours old 4.3 mm yolk-sac larva day old 5.5 mm yolk-sac larva days 6.3 mm pre-larva...
  • 248
  • 763
  • 0
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

... either: (a) dsRNA; or (b) small interference (si )RNA The longer dsRNA may generate a large population of siRNA (with 21–23 nucleotides), and the use of longer dsRNA may be advantageous over siRNA ... corresponding to the mature peptide of MeMIH-B was amplified by PCR using T7 promoter-linked primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-TAATACGACTC ACTATAGGTACTTTAAAGTCCCGGGTTGA-3¢) ... culture tanks At 24, 48 and 72 h after injection, the hepatopancreas and ovary of the shrimp were dissected for total RNA preparation, and the hemolymph samples were collected for SDS ⁄ PAGE and western...
  • 11
  • 546
  • 0

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM