research human capital investments and interregional wage differences in a southeast asian country
human capital, discrimination and trade unions
... investment and the thriftiness of consumers 14.17 The markets for capital and land The derived demand curve for capital (and for land) services closely parallels the earlier analysis of labour demand ... employment, the more inelastic is industry labour demand 13.6 Discrimination? Women and non-whites on average receive lower incomes than white males women and non-whites are concentrated in relatively ... these effects can we show discrimination in the labour market 13.8 13.9 Chapter 14 Capital and land: completing the analysis of factor markets David Begg, Stanley Fischer and Rudiger Dornbusch,...
- 21
- 225
- 0
International Capital Flows and Boom-Bust Cycles in the Asia Pacific Region +
... by providing detailed stylized facts on capital flows and business cycles in the Asia Pacific region and by empirically analyzing the relationship between capital flows and business cycles For ... dynamics of the Asia Pacific countries, for example, whether capital flows generate boom-bust cycles, and whether capital flows help explain the synchronization of the business cycles in the Asian countries ... business cycles in each country has changed over time and whether we can find any evidence of business cycle synchronization in the region We examine the following twelve countries in the Asia Pacific...
- 32
- 579
- 0
Báo cáo hóa học: " Research Article Stability Analysis and Intermittent Control Synthesis of a Class of Uncertain Nonlinear Systems" doc
... intermittent control, and some exponential stability criteria are established Finally, some conclusions and remarks are drawn in Section Problem Formulation and Preliminaries Consider a class of nonlinear ... ≥ to denote a positive negative, seminegative, and semipositive definite matrix P Journal of Inequalities and Applications Exponential Stabilization of a Class of Uncertain Nonlinear System This ... paper, we deal with the exponential stabilization problem of a class of uncertain nonlinear systems by means of periodically intermittent control Based on Lyapunov function approach, several stability...
- 13
- 444
- 0
Báo cáo hóa học: " Research Article Secure Clustering and Symmetric Key Establishment in Heterogeneous Wireless Sensor Networks Reza Azarderskhsh and Arash Reyhani-Masoleh" pdf
... on Wireless Communications and Networking nodes in the heterogeneous WSNs has been considered in [12, 13] In this paper, we investigate secure clustering of wireless sensor nodes with evaluating ... information exchange prior to and after deploying sensor nodes and gateways: (a) embedding keys into gateways and sensor nodes, (b) information exchange between sensor nodes and gateways during ... n (Knii ) 6.4.1 Cost of Secure Clustering and Pairwise Key Establishment In Table 3, the number of encryptions and decryptions during the secure clustering and pairwise key establish- [31] Low...
- 12
- 338
- 0
báo cáo hóa học:" Research Article Hardy-Littlewood and Caccioppoli-Type Inequalities for A-Harmonic Tensors" pdf
... Journal of Inequalities and Applications References R P Agarwal, S Ding, and C Nolder, Inequalities for Differential Forms, Springer, New York, NY, USA, 2009 S Ding, “Lipschitz and BMO norm inequalities ... -weighted imbedding inequalities for A-harmonic tensors,” Journal of Mathematical r Analysis and Applications, vol 273, no 2, pp 667–676, 2002 C A Nolder, Hardy-Littlewood theorems for A-harmonic tensors,” ... u is a differential form satisfying the A-harmonic equation 1.4 and c is any closed form These kinds of estimates are called the Caccioppoli-type estimates or the Caccioppoli inequalities From...
- 14
- 209
- 0
Báo cáo hóa học: " Research Article Properties WORTH and WORTHH∗ , 1 δ Embeddings in Banach Spaces with 1-Unconditional Basis and wFPP" doc
... δ 3.9 By 3.8 and 3.9 , and 3.5 we obtain Sw Sxβ Sxγ ≤ δ P Q Sw δ u 3 .10 ≤ δ xβ xδ δ Hence w ≤ δ 2 Finally, from 3.7 and 3 .11 we have w − 1/ 2 ≤ w ≤ Therefore, if δ < AMC property √ δ2 3δ δ δ ... Sxβ , QSxγ QSxβ 0, P Sxγ δ and Sxβ − Sxγ ≤ , Sxγ , 0, for all y ∈ Y , P y Qy Therefore, since en is 1- unconditional Sxβ Sxγ QSxβ P Sxγ QSxβ − P Sxγ Sxβ − Sxγ ≤ δ 3 .1 Fixed Point Theory and Applications ... Theorem 3 .1 Let X, · X be a Banach space and suppose that there exists a Banach space Y, · Y with a 1- unconditional basis en and a subspace Xδ of Y such that d X, Xδ < δ √ where δ < 13 − /2 Then...
- 7
- 251
- 0
Báo cáo hóa học: " Research Article On Coincidence and Fixed-Point Theorems in Symmetric Spaces" ppt
... Fixed Point Theory and Applications We give another axiom for symmetric spaces and study their relationships in Section We give common fixed-point theorems of four mappings in symmetric spaces and ... necessity of axioms in Section Axioms on symmetric spaces A symmetric on a set X is a function d : X × X → 0, ∞ satisfying the following conditions: y for x, y ∈ X, i d x, y 0, if and only if x ii d ... Point Theory and Applications Remark 3.7 In the case of A B g and S T f in Theorem 3.4 resp., Theorem 3.5 , we can show that f and g have a coincidence point resp., f and g have a unique common...
- 9
- 256
- 0
Báo cáo hóa học: "Research Article QoS Differentiated and Fair Packet Scheduling in Broadband Wireless Access Networks" ppt
... and A Ganz, Packet scheduling for QoS support in IEEE 802.16 broadband wireless access systems,” 12 [17] [18] [19] [20] [21] [22] [23] EURASIP Journal on Wireless Communications and Networking ... Bharghavan, and R Srikant, Fair scheduling in wireless packet networks,” IEEE/ACM Transactions on Networking, vol 7, no 4, pp 473–489, 1999 [9] T S Eugen Ng, I Stoica, and H Zhang, Packet fair queueing ... temporal differences,” Machine Learning, vol 3, no 1, pp 9–44, 1988 [3] L Wischhof and J W Lockwood, Packet scheduling for linksharing and quality of service support in wireless local area,” Tech...
- 12
- 242
- 0
Báo cáo y học: "he combined effect of gender and age on post traumatic stress disorder: do men and women show differences in the lifespan distribution of the disorder" potx
... number of participants 55 or older and examining the differences in lifespan distribution among men and women, respectively, along with the possible combined effect of gender and age on PTSD ... precedent for the combined effect of gender and age on PTSD or for the lifespan distribution of PTSD Future research To conclude on the matter of gender differences in the lifespan distribution of PTSD ... entire lifespan of PTSD distribution The inclusion of participants beyond the age of 80 would touch on something new and concurrently bring diversity into the range of the population examined Future...
- 12
- 507
- 0
Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx
... CGGTTTGTTTGGGTTTGG GTTTGGGTTTGGGTTTGGGTT (forward) and GGC TTGCCTTACCCTTACCCTTACCCTTACCCTTACC CT (reverse), were used to amplify telomeric DNA in the CD4+ and CD8+ T cell subset Six serial dilutions ... doi:10.1186/1423-0127-18-41 Cite this article as: Ngom et al.: Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden Journal of Biomedical Science ... illness and risk of TB[13,14] Thymic atrophy characterises diet induced malnutrition in mice;[15] and the administration of the satiety hormone, leptin which acts via the nutritional- status-sensitive[16]...
- 11
- 527
- 0
Báo cáo y học: "Early Effects of anti-inflammatory [1, 2, 4]triazolo[4, 3-a] [1, 8]naphthyridine derivatives on human stimulated PMN and endothelial cells: an in vitro study" doc
... than the inhibition of cyclooxigenase activity, typical of nonsteroidal anti-inflammatory drugs (NSAIDs), and thus devoid of irritant effects on the gastric mucosa and suitable for use in chronic ... stimulus minus basal adhesion, and b is adhesion elicited by stimulus minus basal adhesion Prostacyclin and Prostaglandin E2 enzyme immunoassay The effect of IL-1α on the release of PGE2 and the ... non-linear regression model using the software Origin version 6.0 (Microcal Software, Northampton, USA) IC50 data in Figures and were analyzed using one-way analysis of variance, followed by...
- 11
- 453
- 0
báo cáo khoa học: "Real-time imaging and analysis of differences in cadmium dynamics in rice cultivars (Oryza sativa) using positron-emitting 107Cd tracer" ppsx
... Real-time imaging and analysis of differences in cadmium dynamics in rice cultivars (Oryza sativa) using positron-emitting 107Cd tracer Satoru Ishikawa1*§, Nobuo ... to grains in typical rice cultivars that differed in grain Cd concentrations We used positron-emitting 107Cd tracer and an innovative imaging technique, the positron-emitting tracer imaging system ... complaints of spinal and leg bone pain, was recognized as a type of chronic toxicity induced by excess Cd contamination of drinking water and cereals (mainly rice) Since then, the contamination of...
- 38
- 282
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật