Gene targeting in human pluripotent cell derived neural stem cells for the study and treatment of neurological disorders

... source of cells and the potential to derive the cell type of interest together with the possibility to enrich for genetic modifications during the dividing stem cell state 1.1.1 Human pluripotent stem ... stem cells Landmark discoveries of the young field of human stem cell science were the isolation and culture of inner cell mass from human blastocysts by Bongso in 1994 and in the derivation of the ... in human neuroepithelial-like stem cells for the generation of modified neuronal cultures 59 4.2 Generation of gene- corrected neural stem cells from MJD patient -derived iPS cells...

Human embryonic stem cell derived neural stem cells derivation, differentiation and MicroRNA regulation

... HUMAN EMBRYONIC STEM CELL- DERIVED NEURAL STEM CELLS: DERIVATION, DIFFERENTIATION AND MICRORNA REGULATION KWANG WEI XIN TIMOTHY (B.Sc (Hons), NUS) ... mechanisms of regulation of NSC differentiation 1.1.5.2 Pluripotent stem cell- derived NSCs Human embryonic stem cells (hESCs), which are pluripotent cells derived from the inner cell mass of blastocyst-stage ... of Human Embryonic Stem Cells in mTeSRTM1” (STEMCELL Technologies Inc.) In brief, H1 hESCs were maintained on BD matrigel hESC-qualified matrix (BD Biosciences) with mTeSRTM1 medium (STEMCELL...

Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy

... status of gene therapy for glioma and breast cancer 22 1.4 Stem cells 1.4.1 Adult stem cells 1.4.1.1 Neural stem cells 1.4.2 Induced pluripotent stem cells 1.5 Stem cell as a vehicle for cancer ... primers as follows: was performed using the forward and reverse CodA, GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA -3’ (reverse), size:1.2kb; Fcy 5’-AGGAATTCATGGTGACAGGGGGAATG ... potential benefit As these cancers have a high risk of relapse, irrespective of grade and stage, they account for a large proportion of metastatic breast cancers (Irvin WJ and Carey 2008) 4T1 mammary...

cáo khoa học: " The European Society of Human Reproduction and Embryology guideline for the diagnosis and treatment of endometriosis: an electronic guideline implementability appraisal" ppsx

... Sweden, the Netherlands, and New Zealand Appraisal of the guideline We asked the panel members to read the ESHRE guideline for the diagnosis and treatment of endometriosis and to assess it with the ... and CM appraised the guideline with eGLIA and participated in the telephone conference and the revision of the manuscript RH participated in the design of the study and the revision of the manuscript ... Discussion The aim of this study was to investigate the implementability of the ESHRE guideline for the diagnosis and treatment of endometriosis with the aid of the eGLIA tool In general, the appraisers...

Tài liệu Báo cáo khoa học: Modulation of cyclin D1 and early growth response factor-1 gene expression in interleukin-1b-treated rat smooth muscle cells by n-6 and n-3 polyunsaturated fatty acids pdf

... cyclin D1 gene promoter We studied the mechanism(s) underlying the inhibition of cyclin D1 gene expression by EPA and DHA by examining the effects of n-3 and n-6 PUFAs incorporation on cyclin D1 promoter ... control of SMC proliferation 4466 S Bousserouel et al (Eur J Biochem 271) Modulation of cyclin D1 synthesis and hyperphosphorylation of Rb by n-3 and n-6 PUFAs Induction of cyclin D1 is one of the ... concentrations of cyclin D1, Rb and Egr-1, in order to determine how the incorporation of EPA and DHA modulate SMC proliferation This article describes the differing effects of n-3 and n-6 PUFAs...

Báo cáo y học: "Adipose-derived mesenchymal stem cells from the sand rat: transforming growth factor beta and 3D co-culture with human disc cells stimulate proteoglycan and collagen type I rich extracellular matrix" ppsx

... antibodies used in 3D immunohistological and CD marker studies Antibody Source Dilution Type I collagen Biodesign International (Kennebunk, ME) 20 μg/ml Type II collagen Biodesign International (Kennebunk, ... dimensional; CD, cluster of differentiation plastic adherence and lineage specific differentiation satisfy the standard criteria suggested for defining mesenchymal stem cells Mesenchymal stem cells ... of transforming in matrix formed by sand rat adipose-derived mesenchymal extracellular 3D factor in the Immunohistochemical documentation ofstem cellsgrowthculture beta sand rat adipose-derived...

Báo cáo y học: "HIV-1 and recombinant gp120 affect the survival and differentiation of human vessel wall-derived mesenchymal stem cells" pot

... HIV-1 and recombinant gp120 affect the survival and differentiation of human vessel wall-derived mesenchymal stem cells Retrovirology 2011 8:40 Submit your next manuscript to BioMed Central and ... muscle and endothelial cells To study the effects of HIV-1 on the differentiation of these cells, the interaction of HIV-1 and recombinant gp120 on MSC differentiation to adipogenic and endothelial ... damage and the promotion and development of atherosclerosis lesions due to impaired MSC repair control of endothelial and vessel structure On the other hand, HIV and gp120 induce the differentiation...

Statistical methods for the detection and analyses of structural variants in the human genome

... STATISTICAL METHODS FOR THE DETECTION AND ANALYSES OF STRUCTURAL VARIANTS IN THE HUMAN GENOME TEO SHU MEI A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY NUS GRADUATE SCHOOL FOR INTEGRATIVE ... analysis of the data could be more than the production of the data There is still a need for the development of new statistical/ bioinformatics methods and software for the systematic analysis of CNV/SV ... in the region 28 Chapter – AIMS Overall, the general aim of this thesis is to use and develop statistical and bioinformatics methods to improve detection and analyses of structural variants The...

Guidance for the Selection and Use of Personal Protective Equipment (PPE) in Healthcare Settings doc

... safety in the healthcare environment through appropriate use of PPE PPE Use in Healthcare Settings: Program Objectives • Provide information on the selection and use of PPE in healthcare settings ... safely don and remove PPE PPE Use in Healthcare Settings The objectives of this program are to provide information on the selection and use of PPE in healthcare settings and to allow time for participants ... tie the upper set at the back of your head and the lower set at the base of your neck If a mask has elastic head bands, separate the two bands, hold the mask in one hand and the bands in the other...

Thuốc chống viêm ức chế lipooxygenase và cyclooxygenase dùng dự phòng và điều trị ung th- (LOX an COX - inhibitors as adjunctive therapies in the prevention and treatment of cancer) ppt

... G1 , ức chế tyrosin - kinase, ngăn chặn hoạt tính protein - ras In vitro, quercetin ức chế tyrosin - kinase ngời ung th, ức chế phát triển khối u, làm tăng thời gian sống sót động vật mang u ... tranh với acid arachidonic vị trí hoạt hoá LOX COX, cạnh tranh hạn chế tổng hợp prostanoid tiền viêm leucotrien - Mỡ cá ức chế đặc hiệu COX2 - Mỡ cá ức chế rõ rệt tổng hợp cytokin TNF - IL - ... hiệu lực điều trị cisplatin, adriamycin, busulfan, cyclophosphamid làm tế bào ung th giảm đề kháng với gemcitabin topotecan Bromelain Là hỗn hợp protease chứa S, lấy từ thân dứa (Ananas conosus...

4
1,041
2

Clinical practice guideline for the assessment and prevention of falls in older people doc

... prepare clinical guidelines for the NHS in England and Wales for the assessment and prevention of falls, including recurrent falls in older people; with an associated clinical audit system Clinical ... s Clinical practice guideline for the assessment and prevention of falls in older people This guideline was commissioned by the National Institute for Clinical Excellence (NICE) Published by the ... declare interests at the beginning of each GDG meeting This information is recorded in the meeting minutes and kept on file at the NCC-NSC 15 THE ASSESSMENT AND PREVENTION OF FALLS IN OLDER PEOPLE...

284
2,441
0

UPDATES IN THE DIAGNOSIS AND TREATMENT OF VASCULITIS pot

... IL-1β=Interleukin-1 Beta Updates in the Diagnosis and Treatment of Vasculitis 4.3 Monocyte activation and production of pro-inflammatory cytokines Wickman et al compared monocytes and cytokine profiles ... usually detectable in the serum and affected tissues in these diseases 15 16 Updates in the Diagnosis and Treatment of Vasculitis IL-6, TNF-α, tumor necrosis factor-like weak inducer of apoptosis (TWEAK), ... extravasation and perivascular deposition of immune complexes The increased tissue staining during the resolution phase, on the other hand, suggests a possible function of VEGF in the resolution of vascular...

282
1,059
0

Updates in the Diagnosis and Treatment of Vasculitis Edited by Lazaros I. Sakkas and Christina Katsiari pptx

... Updates in the Diagnosis and Treatment of Vasculitis http://dx.doi.org/10.5772/46068 Edited by Lazaros I Sakkas and Christina Katsiari Contributors Reem Hamdy Mohammed, Lazaros Sakkas, ... IL-1β=Interleukin-1 Beta Updates in the Diagnosis and Treatment of Vasculitis 4.3 Monocyte activation and production of pro-inflammatory cytokines Wickman et al compared monocytes and cytokine profiles ... cryoglobulinemic vasculitis is caused by the deposition of cryoglobulins predominantly in the small vessels of the skin and glomeruli and is frequently associated with Hepatitis C infection Another small...

Guidelines for the Diagnosis and Management of Food Allergy in the United States docx

... GUIDELINES FOR ThE DIAGNOSIS AND MANAGEMENT OF FOOD ALLERGY IN ThE UNITED STATES Howwere the Guidelines developed? The Guidelines are the culmination of a 2-year effort in which the National Institute ... National Institute of Allergy and Infectious Diseases Guidelines for the Diagnosis and Management of Food Allergy in the United States Summary for Patients, Families, and Caregivers U.S DEPARTMENT OF ... in the Guidelines to diagnose food allergy involving IgE See the full Guidelines at http://www.niaid.nih.gov/topics/foodallergy/clinical for a list of these tests NIAID I GUIDELINES FOR ThE DIAGNOSIS...

Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs " pptx

... necessary for the training of field veterinarians This workshop information and the lectures were used to run workshops for the field veterinarians in the South and Centre of Vietnam and this information ... improve the diagnostic capability of the Veterinary laboratories in Vietnam and the training of DAH veterinarians in disease investigation and control This will strengthen the profile of DAH which ... commence the project, begin the training of the field veterinarians in the South, Centre and North of Vietnam and also the training of laboratory staff All laboratory equipment was purchased and supplied...

Xem thêm

Từ khóa: gene targeting in human pluripotent stem cells physician who specializes in the study and treatment of the disorders of the stomach and intestines mutated human embryonic stem cells for the study of human genetic disorders methods for the purification and characterization of human adipose derived stem cells preservation protocols for human adipose tissue derived adult stem cells methods for the derivation and use of cardiomyocytes from human pluripotent stem cells the isolation and culture of human cord blood derived mesenchymal stem cells under low oxygen conditions digital image processing techniques for the detection and removal of cracks in digitized paintings pdf digital image processing techniques for the detection and removal of cracks in digitized paintings ppt digital image processing techniques for the detection and removal of cracks in digitized paintings and in particular for the recognition and measurement of components of the annual accounts contracts for the sale and purchase of non financial assets which are measured and recognised in accordance with section 5 4 of the recognition and measurement standard on financial instruments as required by that standard for the receipt and acceptance of the assets supplied with a debit to accounts in group 2 for the receipt and acceptance of the right to use the assets supplied with a debit to accounts in group 2 farmers marketing capacity and strengthening the local seed system action research for the conservation and use of agrobiodiversity in bara district nepal chuyên đề điện xoay chiều theo dạng Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ