... human and a murine NICN1 cDNA clone from the IMAGE collection and determined the complete sequences of these cDNAs The comparative analysis of the human, canine, and murine NICN1 cDNA revealed a ... CACCAGgtcagctgggcctca 423 418 bp (exon 3, 11 4 bp) … CCAAAGgcaagtgactttgca 4 01 bp (exon 4, 72 bp) 495 … CTTGAGgtaagctctctaaca 3 71 bp (exon 5, 10 5 bp) 600 … TTCGACgtgagtaacagtgtc 74 bp (exon 6, 14 31 bp) 20 31 … AATAAATACTTGTGGAATATG ... by the AMT gene for aminomethyltransferase, an enzyme of glycine metabolism [4 ,11 ] The promoters of the canine and murine NICN1 genes lack a TATA box-motif In both species, the sequences in the...