0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Investigation and characterization of splice variations of l type ca2+ channel, cav 1 3, in chick basilar papilla and rat cochlea hair cells iimplications in hearing

Investigation and characterization of splice variations of l type ca2+ channel, cav 1 3, in chick basilar papilla and rat cochlea hair cells iimplications in hearing

Investigation and characterization of splice variations of l type ca2+ channel, cav 1 3, in chick basilar papilla and rat cochlea hair cells iimplications in hearing

... whole chick basilar papilla 70 3 .11 Detection of Cav1 .3IQD splice variant in single cell RT-PCR of chick hair cells 72 3 .12 Relative abundance of Cav1 .3IQD splice variant in developing chick cochlea ... of Cav1 .3IQ splice variants identified at C-terminus of chick basilar papilla 71 Summary of Cav1 .3IQ splice variants in individual hair cells of chick basilar papilla 73 Relative abundance of I-II ... I-II loop splice variants in developmental stages of the chick basilar papilla 75 Electrophysiological recording of a single tall hair cell of chick cochlea 77 Figure 3.25 Localization of chick...
  • 132
  • 189
  • 0
Báo cáo khoa học: Characterization of L-aspartate oxidase and quinolinate synthase from Bacillus subtilis potx

Báo cáo khoa học: Characterization of L-aspartate oxidase and quinolinate synthase from Bacillus subtilis potx

... proteins from B subtilis and E coli Results and Discussion NadA cloning and protein purification and characterization In order to optimize the heterologous production and purification of B subtilis ... enzyme from E coli [9], NadB from B subtilis is a dimer of 115 kDa in the absence of NaCl and a monomer of 55 kDa in the presence of 150 mm NaCl After incubation with pure NadA in ratios of : or ... Pyrococcus horikoshii and Sulfolobus tokadaii, and characterized from a biochemical and structural point of view only from E coli and S tokadaii [8–17] It is a flavoprotein containing mol of noncovalently...
  • 18
  • 350
  • 0
Single channel and whole cell electrophysiological characterizations of l type cav1 2 calcium channel splice variants relevance to cardiac and nervous system functions

Single channel and whole cell electrophysiological characterizations of l type cav1 2 calcium channel splice variants relevance to cardiac and nervous system functions

... SINGLE- CHANNEL AND WHOLE- CELL ELECTROPHYSIOLOGICAL CHARACTERIZATIONS OF L- TYPE CaV1. 2 CALCIUM CHANNEL SPLICE VARIANTS: RELEVANCE TO CARDIAC AND NERVOUS SYSTEM FUNCTIONS PETER BARTELS -Diploma ... advantages of the cell attached mode of single- channel recordings in relation to the whole cell technique 1.5 Single- channel vs whole cell recordings in cardiovascular studies Studying the gating of ... CONTENT 1.4 .2 Alternative splicing of L- type CaV1. 2 calcium channel isoforms 18 1.4 .2. 1 Functional role in biology and disease 18 1.4 .2. 2 N-terminal hum CaV1. 2 isoforms and implication...
  • 139
  • 444
  • 0
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

... Purification of four pulchellin isoforms from A pulchellus seeds Using a combination of affinity, ion exchange and chromatofocusing chromatography, four pulchellin isoforms were isolated from A pulchellus ... II, III and IV and refers to each pulchellin Characterization of four pulchellin isoforms isoform (P I, P II, P II and P IV) The A-chain of P II was formerly cloned and named recombinant pulchellin ... III and P IV isoforms from the eluate P III ⁄ P IV (Fig 1C) Isoelectric focusing gave pI of 5.8, 5.7, 5.5 and 5 .2 for the four isoforms respectively Secondary structure of the pulchellin isoforms...
  • 12
  • 763
  • 0
Báo cáo khoa học: Structural characterization of L-glutamate oxidase from Streptomyces sp. X-119-6 pdf

Báo cáo khoa học: Structural characterization of L-glutamate oxidase from Streptomyces sp. X-119-6 pdf

... Fig Structural comparisons of the funnels of LGOX, LAAO, and PAO, and the residues composing two entrances of the funnel of LGOX (A) Stereo view of funnels of LAAO, PAO, and LGOX The surfaces of ... quantitative assay of l-glutamate is important in the fields of food production and clinical biochemistry Actually, l-glutamate oxidase (LGOX; EC 1.4.3.11) was first purified from an aqueous extract of a wheat ... culture of Streptomyces sp X-119-6 [4] Along with the production of ammonia and hydrogen peroxide via an imino acid intermediate, LGOX catalyzes the oxidative deamination of the a-amino group of l-glutamate...
  • 10
  • 507
  • 0
Báo cáo khoa học: Probing the active site of Corynebacterium callunae starch phosphorylase through the characterization of wild-type and His334fiGly mutant enzymes pot

Báo cáo khoa học: Probing the active site of Corynebacterium callunae starch phosphorylase through the characterization of wild-type and His334fiGly mutant enzymes pot

... 17-fold enhancement of GL binding to the wild-type upon the addition of the same concentration of phosphate pH profiles The pH dependences of logarithmic rates of the H334G mutant and wild-type are ... wild-type and with an optimum pH of 6.5 A shift of the pH profile of about + 0.5–1.0 pH units and an optimum pH similar to that of the wild-type was observed for the H334G mutant in the presence of 200 ... specific activities of the wild-type (33 UÆmg)1) and the H334G mutant (0.001 UÆmg)1) in the absence of imidazole P-NMR spectra for solutions of wild-type CcStP and the H334G mutant that contained...
  • 11
  • 430
  • 0
Báo cáo khoa học: Characterization of testis-specific serine–threonine kinase 3 and its activation by phosphoinositide-dependent kinase-1-dependent signalling doc

Báo cáo khoa học: Characterization of testis-specific serine–threonine kinase 3 and its activation by phosphoinositide-dependent kinase-1-dependent signalling doc

... phosphorylation of GST–TSSK3 with [32 P]ATP[cP] The phosphorylation reactions of GST–TSSK3K39R by Myc-PDK1 [32 ] immunoprecipitated from 293T cells and of HA–TSSK3K39R immunoprecipitated from 293T cells, by ... maximum activation and ⁄ or activation by PDK1 of TSSK3, as suggested for PKCf phosphorylation and activation by PDK1 [35 ] Thus we hypothesize that in order to efficiently recruit PDK1 to TSSK3, cofactors ... the regulation of TSSK3 activity and suggest a similar mechanism of activation to that of the AGC kinase family For a number of AGC kinases the 3- phosphoinositide-dependent protein kinase- 1 (PDK1)...
  • 14
  • 374
  • 0
Báo cáo Y học: Cloning and characterization of the mammalian-specific nicolin 1 gene (NICN1) encoding a nuclear 24 kDa protein doc

Báo cáo Y học: Cloning and characterization of the mammalian-specific nicolin 1 gene (NICN1) encoding a nuclear 24 kDa protein doc

... human and a murine NICN1 cDNA clone from the IMAGE collection and determined the complete sequences of these cDNAs The comparative analysis of the human, canine, and murine NICN1 cDNA revealed a ... CACCAGgtcagctgggcctca 423 418 bp (exon 3, 11 4 bp) … CCAAAGgcaagtgactttgca 4 01 bp (exon 4, 72 bp) 495 … CTTGAGgtaagctctctaaca 3 71 bp (exon 5, 10 5 bp) 600 … TTCGACgtgagtaacagtgtc 74 bp (exon 6, 14 31 bp) 20 31 … AATAAATACTTGTGGAATATG ... by the AMT gene for aminomethyltransferase, an enzyme of glycine metabolism [4 ,11 ] The promoters of the canine and murine NICN1 genes lack a TATA box-motif In both species, the sequences in the...
  • 6
  • 450
  • 0
Báo cáo Y học: Puri®cation and characterization of the human adenosine A2a receptor functionally expressed in Escherichia coli doc

Báo cáo Y học: Puri®cation and characterization of the human adenosine A2a receptor functionally expressed in Escherichia coli doc

... theophylline The arrow points to the M-A2aTr316-H10 fusion protein Note that the main contamination, seen in lane 1, runs only marginally above the hA2aR fusion protein and is the main band in ... obtained, namely LysIle-Glu-Glu-Gly-Lys-Leu-Val-Ile-Trp corresponds to the N-terminus of the mature maltose-binding protein Binding of the fusion protein to the IMAC gel in buffer containing ... solubilization and puri®cation of a hA2aR fusion protein in quantity and quality suf®cient for biophysical characterization and crystallization The following points made the puri®cation of large amounts of...
  • 11
  • 582
  • 0
Báo cáo khoa học: Characterization of a membrane-bound angiotensin-converting enzyme isoform in crayfish testis and evidence for its release into the seminal fluid ppt

Báo cáo khoa học: Characterization of a membrane-bound angiotensin-converting enzyme isoform in crayfish testis and evidence for its release into the seminal fluid ppt

... Lepidoptera, the treatment of adults with the ACE inhibitor, captopril, causes a decrease in egg-laying [9] In Haematobia irritans exigua, a blood meal initiates the strong synthesis of ACE in the ... size increase In the resting period, the vas deferens are atrophied and are barely visible At the cellular level (Fig 4A) , the testis is composed of acini that open into collector canals and finally ... catalytic domains, such as somatic mammalian ACE, whereas Asl-tACE, with less than 700 residues, is likely to display only one catalytic domain, such as mammalian gACE Interestingly, data mining...
  • 12
  • 486
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Isolation and characterization of a new simian rotavirus, YK-1" docx

... strain to those of the other simian rotavirus strains, SA11 and RRV Materials and methods Rotavirus isolation The YK-1 strain of simian rotavirus was isolated from the diarrheal stool of a 2-year-old ... was based on a Jennerianapproach prompted by studies indicating that animal and human rotaviruses share a common group antigen and that experimental animals immunized with human strains of rotavirus ... Virology Journal 2006, 3:40 C11 and Ala strains in rabbits [5], and human rotaviruses with piglets [6] Two simian rotavirus strains, SA11 and RRV, have been well characterized and are currently...
  • 8
  • 530
  • 0
Báo cáo toán học:

Báo cáo toán học: "A Characterization of Morrey Type Besov and Triebel-Lizorkin Spaces" ppt

... Morrey- type Besov and Triebel-Lizorkin spaces, which is a characterization of Morrey- type Besov and Triebel-Lizorkin spaces Before stating it, we recall some notations and the definition of Morrey- type Besov ... < p = q < ∞, and β ∞, then M Bq,q = Bq,β s,β s and M Fq,q = Fq,β , standard Besov and Triebel-Lizorkin spaces respectively; see [22] A Characterization of Morrey Type Besov and Triebel-Lizorkin ... {1/4 < |ξ| < 4} Now the Morrey type Besov and Triebel-Lizorkin spaces can be defined as follows Definition Let −∞ < s < ∞, < q above, then we define (i) The Morrey type Besov spaces as s,β M Bp,q...
  • 11
  • 311
  • 0
Báo cáo vật lý:

Báo cáo vật lý: "Synthesis and Characterization of Bismuth Tantalate Binary Materials for Potential Application in Multilayer Ceramic Capacitors (MLCC)" doc

... Pellets of single phase sample were prepared using a stainless steel die measuring mm in diameter Sufficient amount of powder was added, cold pressed uniaxially, and sintered at 1100oC in order to increase ... its volatile, reactive characteristic and relatively low firing temperature in forming binary or ternary materials with other elements, e.g bismuth vanadates, bismuth niobates or even structurally ... satisfies the trend of miniaturization and high functionality of modern electronic devices as green ceramic tapes of different materials serving different passive functions are laminated and co-fired...
  • 10
  • 243
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Isolation and characterization of Streptococcus sp.from diseased flounder (Paralichthys olivaceus )in Jeju Island" ppt

... eht fo esahp suoeuqa reppu eht no detcelloc saw AND lairetcaB nim rof 000,6 ta degufirtnec dna nim rof sllec lairetcab gniliob yb detcartxe neht saw AND lairetcab ;retaw dellitsid elbuod dezilirets ... 817( rof evitisop ,9~4 senal ;)pb 001,1( rof evitisop ,3 dna senal ;noitcefni laccocotperts rof evitagen ,1 enal ;lortnoc evitagen ,N enal ;)pb 003 ,M4040 ( lortnoc evitisop ,P senal ;reddal AND ... enilav ,esapil rof snoitcaer evitagen dah setalosi llA nispyrtomyhc -α dna esatahpsohp enilakla rof snoitcaer evitisop dah fo setalosi 81 dna esadinimasoculg-β-lyteca -N dna esaretse rof snoitcaer...
  • 6
  • 348
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Detection and molecular characterization of infectious bronchitis virus isolated from recent outbreaks in broiler flocks in Thailand" potx

... of infectious bronchitis virus isolated in the UK Vet Rec 2008, 162, 99-100 11 Gough RE, Randall CJ, Dagless M, Alexander DJ, Cox WJ, Pearson D A ‘new’ strain of infectious bronchitis virus infecting ... region of the S1 gene of infectious bronchitis virus Arch Vrol 2000, 145, 291-300 Yu L, Wang Z, Jiang Y, Low S, Kwang J Molecular epidemiology of infectious bronchitis virus isolates from China and ... FJ156080 Bird Age Organs used for type (days) virus isolation Broiler Broiler Broiler Broiler Broiler Broiler Broiler Broiler Broiler Broiler Broiler Broiler Broiler 28 30 26 28 20 20 20 26 16 22 28...
  • 5
  • 537
  • 0

Xem thêm

Từ khóa: characterization of localised dry spots on creeping bentgrass turf in the united statesconstruction of mutant l type ca2 channelsallows selecting the spinning rate of the virtual turntables default 33 1 3 turnsthermal oxide synthesis and characterization of fe3o4nanorods and fe2o3 nanowiresisolation and characterization of vascular endothelial cells from murine heart and lungisolation and characterization of embryonic and adult epicardium and epicardium derived cellssố hiệu đòa chỉ ngày mở l c no of l c place and dateelectron energy loss spectroscopy and its applications to characterization of carbon materialselectrochemical characterization of carbons and carbon alloyscharacterization of glycosaminoglycans by tandem vibrational microspectroscopy and multivariate data analysisanimal science and the representation of local breeds looking into the sources of current characterization of bororo zebustudies on growth crystal structure and characterization of novel organic nicotinium trifluoroaexperimental investigation and computational validation of thermal stratification in piping systin situ dynamic characterization of energy storage and conversion systemspreparation and characterization of nanostructured tio2 thin films by hydrothermal and anodizatiBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI