0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Development and application of novel capillary electrophoresis techniques for analysis of DNA fragments and organic pollutants

Development and application of novel capillary electrophoresis techniques for analysis of DNA fragments and organic pollutants

Development and application of novel capillary electrophoresis techniques for analysis of DNA fragments and organic pollutants

... focused on the analysis of DNA fragments; and the second part (chapter and chapter 5) focused on the analysis of organic pollutants Several novel capillary electrophoresis (CE) techniques had ... various applications, the CE applications in DNA analysis and monitoring of pollutants are of significant importance 1.3.1 CE Application in DNA Analysis DNA separation by CE has been the subject of ... for on-site analysis of various pollutants at trace level CE is found to be a versatile analytical tool for the analysis of DNA as well as pollutants Combination of DNA analysis and environmental...
  • 223
  • 752
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Editorial Novel Techniques for Analysis and Design of Cross-Layer Optimized Wireless Sensor Networks" docx

... construction of backbones for wireless sensor networks, that is, subsets of nodes that span the network, and all other nodes are within one hop from one of them Such structures can be used for a million ... push forward Note that the work applies not only to sensor networks, but to general wireless networks as well, and should be read with this in mind You have got them rolled-out—your million of sensors ... terms of the lifetime of the network The particular application they have in mind is the sensing of a binary event by sensors that are errorprone, and also communicate with each other and a central...
  • 3
  • 280
  • 0
synthesis and application of dna-templated silver nanowires

synthesis and application of dna-templated silver nanowires

... of the adsorption sites gradually on the nanowires 3.2.2 Response and recovery of the DNA-templated silver nanowires exposed to ammonia The response and recovery of the DNA-templated silver nanowires ... carried out at room temperature Results and discussions 3.1 Fabrication of the DNA-templated silver nanowires The fabrication of DNA-templated silver nanowires was based on electroless plating, ... of DNA-templated silver nanowires, (b) shows enlargement of the DNA-Ag nanowires Fig Conductivity variation of the DNA-templated nanowires exposed to different concentrations of ammonia at room...
  • 5
  • 566
  • 0
BÁO CÁO-DNA vaccine and Application of DNA vaccine in Fisheries

BÁO CÁO-DNA vaccine and Application of DNA vaccine in Fisheries

... Photo Album by Activated User DNA vaccine is DNA sequence used as a vaccine This DNA sequence code for antigenic protein of pathogen by Activated As this DNA inserted into cells it is User translated ... into DNA plasmid form Recombinant DNA Inject DNA vaccine into Fish G-gene construct shows good surface expression, which is believed to be a key feature to the effectiveness of the vaccine You ... protein that is involved in the immunetic response It is the glyco protein spike on the outside of the virus, denoted by the G protein, that is the immunetic protein of the virus Insect G-gene into...
  • 29
  • 771
  • 0
Applications of capillary electrophoresis in the analysis of natural products

Applications of capillary electrophoresis in the analysis of natural products

... effective components in natural products Hence, the major aim of this thesis is to expand the analytical applicability of CE in the analysis of natural products The range of natural products is quite ... The migration of cations results in the migration of whole buffer solution through the capillary; this migration is the EOF Since the driving force of EOF is uniformly distributed along the capillary ... on differences in the electrophoretic mobilities of the solutes, resulting in different velocities of migration of ionic species in the electrophoretic buffer contained in the capillary Separation...
  • 155
  • 525
  • 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... Biotin-TCGACTAGAAGCTTCTAGAAGCTTCTAG AGCTGATCTTCGAAGATCTTCGAAGAT Biotin-TCGACTTCAAGCTTGTACAAGCTTGTAG AGCTGAAGTTCGAACATGTTCGAACATC Biotin-AACGACGGTCGCTCCGCCTGGCT nM Unlabeled HSE DNA-binding activity ... confirm that the assay specifically measures HSF1 DNA-binding activity Analytical range and precision The analytical range of the assay was evaluated using known concentrations of recombinant human HSF1 ... antibodies for the transcription factor are available The assay is the first assay suitable for high-throughput measurements of transcription factor DNA interactions in biological samples Therefore,...
  • 9
  • 457
  • 0
The development of acidic protein aptamers using capillary electrophoresis methods and their use in surface plasmon resonance

The development of acidic protein aptamers using capillary electrophoresis methods and their use in surface plasmon resonance

... also contains the ligand The nanoparticle binds to the analyte which causes an increase in mass upon binding to the ligand on the surface of the sensor and causing a boost in signal Another mass ... globulin proteins by comparing the peak height of the DNA peaks71 24 1.5 Objectives and Scope of the dissertation The focus of this thesis will be on the development of aptamers using capillary electrophoresis ... measure of specificity using the same method as used for measuring the binding affinity of the original target For example, during the CE-SELEX of IgE protein, the specificity of the aptamer was demonstrated...
  • 205
  • 284
  • 0
Novel methods for quantitative analysis and evaluation of effects of chronic exposure to microcystins by capillary electrophoresis and metabolomic studies

Novel methods for quantitative analysis and evaluation of effects of chronic exposure to microcystins by capillary electrophoresis and metabolomic studies

... NOVEL METHODS FOR QUANTITATIVE ANALYSIS AND EVALUATION OF EFFECTS OF CHRONIC EXPOSURE TO MICROCYSTINS BY CAPILLARY ELECTROPHORESIS AND METABOLOMIC STUDIES GRACE BIRUNGI ... –DEVELOPMENT OF METHODS OF ANALYSIS 48 2.0 Development of CE Methods for the Determination of Cyanotoxins 48 2.1 CZE and MEKC Methods for Determination of Microcystins LR, RR, YR and Nodularin ... describes capillary electrophoresis (CE) methods for separation and quantification of cyanotoxins in water; and metabolomic and “metabonomic” approaches for investigation of the effect of exposure of...
  • 177
  • 292
  • 0
Development of methods to improve sensitivity and portability of capillary electrophoresis for the analysis of stabilizers and drugs 1

Development of methods to improve sensitivity and portability of capillary electrophoresis for the analysis of stabilizers and drugs 1

... Introduction……………………………………… …… 1~ 57 1. 1 Basic Theory of Capillary Electrophoresis ……………………….… 1~ 6 1. 2 Electroosmotic Flow (EOF)…………………………………………… 6 ~13 1. 3 Different Modes of CE…………………………………………….…… 13 ~20 1. 3 .1 Capillary ... Optimization………………………… …… .11 4 ~11 5 4.4.4 Linearity, Repeatability and Limits of Detection………… … 11 5 ~11 9 4.4.5 Application………………………………………………….… 11 9 ~12 0 4.5 Conclusion………………………………………………………….… .12 0 ~12 1 References ... (CIEF)……………………….… 16 ~17 1. 3.5 Capillary Electrochromatography (CGE)……………………… 17 ~18 1. 3.6 Capillary Isotachophoresis (CITP)……………………… …… 18 ~20 1. 4 Sample Introduction and Concentration………………………………… 20~ 31 1.4.1...
  • 16
  • 283
  • 0
Development of methods to improve sensitivity and portability of capillary electrophoresis for the analysis of stabilizers and drugs 2

Development of methods to improve sensitivity and portability of capillary electrophoresis for the analysis of stabilizers and drugs 2

... just ranges from to 20 nl To increase the sensitivity, two approaches, either to increase the amount of analyte added to the capillary or to improve the sensitivity of the detector, may be applied ... though they migrate opposite to the direction of the EOF, are also transported to the detector (on the cathode side) Since their migration velocities are typically lower than the velocity of the EOF, ... time; η: the viscosity of the buffer; L: the total length of the capillary In the case of all hydrodynamic sample introductions, it is necessary that the material in the capillary is free to flow...
  • 160
  • 1,228
  • 0
Development and applications of novel solvent minimized techniques in the determination of chemical warfare agents and their degradation products

Development and applications of novel solvent minimized techniques in the determination of chemical warfare agents and their degradation products

... DEVELOPMENT AND APPLICATIONS OF NOVEL SOLVENT- MINIMIZED TECHNIQUES IN THE DETERMINATION OF CHEMICAL WARFARE AGENTS AND THEIR DEGRADATION PRODUCTS LEE HOI SIM NANCY (M.Sc.), NUS A THESIS ... determination of various chemical warfare agents and their degradation products This approach allows the miniaturization of the extraction procedure in terms of reducing the amount of sample, extracting solvents ... uptake of the plastic antibody was compared against that of the NIP and the imprinting efficiency was found to be 1.3 The imprinting efficiency is defined as the ratio of the binding ratio of the MIP...
  • 189
  • 490
  • 1
Development and application of advanced proteomic techniques for high throughput identification of proteins

Development and application of advanced proteomic techniques for high throughput identification of proteins

... DEVELOPMENT AND APPLICATION OF ADVANCED PROTEOMIC TECHNIQUES FOR HIGHTHROUGHPUT IDENTIFICATION OF PROTEINS HU YI (B.Sc.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF ... analysis of proteins, i.e proteomics (Pandey and Mann, 2000; Tyers and Mann, 2003) Therefore, the advancement of proteomics relies largely on the development of state -of- the-art proteomics techniques ... study, we sought to develop and apply advanced proteomic techniques from three different aspects for high- throughput identification of enzymes and their associated proteins in yeast proteome (catalomics)...
  • 219
  • 322
  • 0
Development and applications of novel liquid phase microextraction techniques

Development and applications of novel liquid phase microextraction techniques

... fiber-protected liquid- phase microextraction Headspace -liquid- phase microextraction Local anaesthetics Liquid chromatography Liquid- liquid extraction Liquid- liquid -liquid microextraction Limits of Detection ... 1.1 Historical Development of Microextraction Techniques 1.2 Principles and Applications of SME and Membrane-Based LPME Techniques 1.3 Hyphenation and Automation 15 1.4 Comparison of SME, Membrane-Based ... Chapter Solvent Microextraction Techniques: Headspace Liquid- Phase Microextraction and Solvent-Drop Liquid- Phase Microextraction 2.1 Introduction Methods for the collection and analysis of soil sample...
  • 148
  • 328
  • 0
Development and application of liquid phase microextraction techniques in the analysis of environmental pollutants

Development and application of liquid phase microextraction techniques in the analysis of environmental pollutants

... drop -in- drop system The aqueous phase of the outer drop contained the analyte of interest and was continuously delivered and aspirated away throughout the sampling The analytical response of the instrument ... involves the use of hollow fiber combination with liquid- phase microextraction It can be categorized into two- ii phase microextraction, and three -phase microextraction or liquid- liquid -liquid microextraction ... aspiration of the ASP, following the first sampling cycle, ensures that both the OF and the ASP are periodically renewed, and thus the OF would be in contact with fresh aqueous sample having the initial...
  • 167
  • 583
  • 0
nvestigating the influences of tidal inundation and surface elevation on the establishment and early development of mangroves  for application in understanding mangrove rehabilitation techniques 1  7

nvestigating the influences of tidal inundation and surface elevation on the establishment and early development of mangroves for application in understanding mangrove rehabilitation techniques 1 7

... Journal of Botany, 14 (1) , 67 -10 4 MacNae, W (19 68) A general account of the fauna and flora of mangrove swamps and forests in the Indo-West-Pacific region Advances in marine biology, 6, 73 - 270 Mahoney, ... Editor, Handbook for Restoring Tidal Wetlands, CRC Press, Boca Raton, Florida (20 01) , pp 11 9 15 5 Tomlinson, P B (19 86) The Botany of Mangroves Cambridge, United Kingdom, pp 15 8 -16 2 Tomlinson, P ... Stevenson, N J., Lewis, R R., & Burbridge, P R (19 99) Disused shrimp ponds and mangrove rehabilitation In: An International Perspective on Wetland Rehabilitation Springer Netherlands Pp 277 -2 97 Suding,...
  • 15
  • 371
  • 0

Xem thêm

Từ khóa: application of dna methylation biomarkersapplication of microscopic techniques to the study of seeds and microalgae under olive oil wastewater stressstrategies tools and techniques for the development of written communication metasociocognitive processesan application of ftir and 13c nmr spectroscopy on examining of artificial coalification process and developmentpericytes in development and pathology of skeletal muscledigital image processing techniques for the detection and removal of cracks in digitized paintings pdfdigital image processing techniques for the detection and removal of cracks in digitized paintings pptdigital image processing techniques for the detection and removal of cracks in digitized paintingstheory and application of spread spectrum systemsinterpretation and application of international financial reporting standards free downloaddigital image processing techniques for detection and removal of crackswiley interpretation and application of international financial reporting standards 2011 free downloadthe igf axis in the development and progression of prostate cancerwiley interpretation and application of international financial reporting standards 2010 free downloadrole of energy in economic development and social transformationBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ