Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor
Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor
... 3.2 Characterization of flavonoids on PPAR and PPAR activity 103 3.3 Characterization of flavonoids and PPAR ligands on a natural PPAR V22 7A variant 124 3.4 Mechanism(s) elucidation of attenuated ... their clinical application especially in patients with heart failure (Arakawa et al 2004; Rangwala and Lazar 2004; Staels 2005) 1.3.2 Dual PPAR /PPAR ligands In general, diabetic patients suffer ... Comparisons of activity ratios between natural and synthetic dual PPAR /PPAR dual agonists 180 Table 4.3 Summary of coregulator interaction of PPAR 195 Table 4.4 Summary of corepressor interaction...
- 263
- 267
- 0
Tài liệu Báo cáo khoa học: 3T3-L1 adipocyte apoptosis induced by thiazolidinediones is peroxisome proliferator-activated receptor-c-dependent and mediated by the caspase-3-dependent apoptotic pathway doc
... PPARc agonist -induced apoptosis [26,27] In the present study, we investigated PPARc agonist -induced adipocyte apoptosis by using 3T3-L1 adipocytes and rat primary adipocytes Adipocyte apoptosis could ... troglitazone -induced adipocyte apoptosis is probably mediated by PPARc, GW9662 should have an inhibitory effect on adipocyte apoptosis As shown in Fig 2B,C, troglitazone -induced adipocyte apoptosis was, ... Pioglitazoneinduced 3T3-L1 adipocyte apoptosis measured by Hoechst 33258 staining (hoechst) (F) PGJ2 -induced 3T3-L1 adipocyte apoptosis 3T3-L1 adipocytes were treated with 10 or 25 lM PGJ2 for 96 h in the...
- 10
- 594
- 0
Báo cáo y học: " Peroxisome Proliferator-Activated Receptor α (PPARα) down-regulation in cystic fibrosis lymphocytes" ppsx
... Summarizing picture: PPARα in lymphocytes Summarizing picture: PPARα in lymphocytes PPARα inhibits the actions of the pro-inflammatory transcription factors AP-1 and NFκB through protein-protein interactions ... analysis of inflammatory cells infiltrating the cystic fibrosis airway mucosa Clin Exp Immunol 2001, 124:69-76 Moss RB: Lymphocytes in cystic fibrosis lung disease: a tale of two immunities Clin ... granulocyte colonystimulating factor in bronchial epithelium: implications for airway inflammation in cystic fibrosis J Immunol 2005, 175:404-412 Moss RB, Hsu YP, Olds L: Cytokine dysregulation in...
- 15
- 218
- 0
Tổng quan về peroxisome prolitferator activated receptor ( PPAR) và một số thuốc có đích tác dụng là receptor PPAR
... (PPAR) thuốc có đích tác dụng receptor PPAR ^ với mục tiêu chính: - Tổng quan receptor PPAR - Tổng quan số thuốc có đích tác dụng receptor PPAR PH ẦN RECEPTOR NHÂN TẾ BÀO 1.1 ĐỊNH NGHĨA VÀ PHÂN ... Adiponectin có tác dụng kháng viêm ức chế tạo thành TNF a yếu tố tiền viêm [64], 33 PH ẦN MỘT SỐ THUỐC CÓ ĐÍCH TÁC DỤNG LÀ PPAR Chất chủ vận PPAR phát triển ứng dụng lâm sàng Hai nhóm chất quan trọng có ... PHÀN3 MỘT SỐ THUỐC CÓ ĐÍCH TÁC DỤNG LÀ PPAR 33 3.1 cAC FIBRAT 33 3.1.1 Co' chế tác dụng 33 3.1.2 Tác dụng fibrat 34 3.2 CAC THIAZOLIDINEDION 38 3.2.1 Cơ chê tác dụng 38 3.2.2 Tác dụng TZD 39 3.3...
- 77
- 980
- 0
Báo cáo khoa học: Discovery of a eugenol oxidase from Rhodococcus sp. strain RHA1 ppt
... sp strain RHA1 The bacterial oxidase was found to be most active with eugenol, and hence has been named eugenol oxidase (EUGO) Results Properties and spectral characterization of EUGO EUGO can ... bound Covalent flavinylation was accompanied by an increase in oxidase activity and formation of hydrogen peroxide This confirms a mechanism of autocatalytic covalent flavinylation in which a reduced ... The Authors Journal compilation ª 2007 FEBS J Jin et al Discovery of a eugenol oxidase Table Steady-state kinetic parameters for recombinant EUGO and VAO The kinetic parameters of EUGO, as isolated,...
- 11
- 520
- 0
Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt
... AGGTCA TGCCCT t TCCCCC CAACCT t TACCCT GACCTA tt GAACTA t TACCTA AGACCT t TGAACC TCACCT t TCACCC – [54] [54] [58] [68] [69] [70] [71] FEBS Journal 272 (2005) 4754–47 73 ª 2005 FEBS 4765 Effect of ... (5¢-dACCGGAGAGGATATTTAGGCTGGGGCA TTGAAGGTTG -3 ; sense primer) vs Kin251 (5¢-dCAA CCTTCAATGCCCCAGCCTAAATATCCTCTCCGGT -3 ; antisense primer) to generate pGL3b:Prm3abPPARc(a)* Mutation of the consensus retinoic acid X responsive ... AGGTACCGCTGCAGTGAGCCTTGATTG -3 , nucleotides )276 to )257) Prm3abb; pGL3b:Prm3abb (Primer Kin212, 5¢-dGAG AGGTACCGAGCAAGACTCTGTCTCAAA -3 , nucleotides )229 to )209) Prm3abc; pGL3b:Prm3abc (Primer Kin 236 , 5¢-dGAG AGGTACCCCGGAGAGGATATTTGAGCTG -3 ,...
- 20
- 432
- 0
Báo cáo khoa học: Heme oxygenase-1 ⁄p21WAF1 mediates peroxisome proliferator-activated receptor-c signaling inhibition of proliferation of rat pulmonary artery smooth muscle cells pot
... PASMC proliferation Proliferation of PASMCs is a hallmark of pathogenesis of pulmonary hypertension [1,4] However, the mechanisms responsible for inhibition of PASMC proliferation by activation of ... Role of p21WAF1 in HO-1-mediated suppression of proliferation of PASMCs Recent studies have revealed that an antiproliferative effect of HO-1 on non-PASMC pulmonary vascular smooth muscle cells ... stimulates HO-1 expression in pulmonary artery smooth muscle cells (PASMCs) (vascular smooth muscle cells showing some differences from systemic vascular smooth muscle cells) If so, whether and how...
- 8
- 333
- 0
Báo cáo khoa học: Expression level and agonist-binding affect the turnover, ubiquitination and complex formation of peroxisome proliferator activated receptor b pptx
... Regulation of < /b> PPARb turnover specific antibody because none of < /b> the < /b> available PPARb-specific antibodies are suitable for a quantifiable detection of < /b> PPARb at low expression < /b> levels In these experiments, ... protein level < /b> influence the < /b> degree of < /b> high Mr complex < /b> formation < /b> To investigate the < /b> nature of < /b> the < /b> high Mr PPARb complexes, we analyzed the < /b> effects of < /b> PPARb protein concentration and < /b> binding of < /b> GW501516 ... detectable effect on protein levels in spite of < /b> a clear stabilization by MG132 (visible as strongly increased protein levels and < /b> the < /b> presence of < /b> presumably polyubiquitinated 3xFLAGPPARb) Formation < /b> of...
- 9
- 350
- 0
Báo cáo khoa học: "Transactivation of peroxisome proliferator-activated receptor alpha by green tea extracts" docx
... proliferation by green tea extract is considered to be mediated through the activation of PPARα Generally, black tea is derived as a result of full fermentation of the leaves of green tea The concentration ... concentration of EGCG in oolong tea falls between that of green tea and black tea [19] However, the transactivation expressed by oolong tea was less than the transactivation expressed by black tea This ... the overall beneficial effect of green tea by far outweighs its possible negative effect Eventually, the activation of PPARα and peroxisome proliferation by green tea could be suggested to have...
- 6
- 267
- 0
Báo cáo y học: "THR0921, a novel peroxisome proliferator-activated receptor gamma agonist, reduces the severity of collagen-induced arthritis" pps
... TNF-α, forward 5'-GCCTCTTCTCATTCCTGCTT-3', reverse 5'-CACTTGGTGGTTTGCTACGA-3'; for IL-1β, forward 5'CCCAAGCAATACCCAAAGAA-3', reverse 5'-CATCAGAGGCAAGGAGGAAA-3'; for monocyte chemoattractant protein-1 ... (MCP-1), forward 5'-AGCCAGATGCAGTTAACGC-3', reverse 5'-CTGATCTCATTTGGTTCGGA-3'; for RANKL, forward 5'-GCTCCGAGCTGGTGAAGAAAT-3', reverse 5'CCCAAAGTACGTCGCATCTTG-3' Osteoclast differentiation assay To ... Pisano B, Dugo L, Ianaro A, Maffia P, Patel NS, Di Paola R, Ialenti A, Genovese T, Chatterjee PK, et al.: Rosiglitazone, a ligand of the peroxisome proliferator-activated receptor- gamma, reduces...
- 8
- 339
- 0
báo cáo khoa học: " Increased hepatic oxidative metabolism distinguishes the action of Peroxisome proliferator-activated receptor d from Peroxisome proliferatoractivated receptor g in the ob/ob mouse" ppt
... studies, and drafted the manuscript DGH and DWA coordinated the animal study and sample collection JNH participated in intellectual discussion of the data AWN participated in the design of the ... (black) and skeletal muscle tissue from mice treated with a PPARd agonist (gray) containing the serine peak (d) Bar graph demonstrating the difference in the average integrated area of the serine peak ... [25] The glucogenic amino acids (those that are precursors of glucose in gluconeogenesis), glycine, glutamate, glutamine, alanine, proline and valine, and the amino acids that are glucogenic and...
- 12
- 266
- 0
Báo cáo y học: "The pathophysiological function of peroxisome proliferator-activated receptor-γ in lung-related diseases" pptx
... mediated by the antagonism of the NF-κB pathway [31] Interleukin-5 (IL-5) is the principal regulatory cytokine mediating eosinophil airway inflammation and extending the cell's survival Eosinophils ... are phagocytes involved in the ingestion and degradation of inhaled particles This activates a variety of inflammatory processes involving enhancement of their cytotoxic capabilities LPS-induced ... PPAR-γ may act by exerting its influence as a negative immunomodulator regulating inflammatory respiratory responses (Figure 2) Pro-inflammatory cytokines seem to be the first point of call For...
- 9
- 262
- 0
Báo cáo y học: "Discovery of a new human T-cell lymphotropic virus (HTLV-3) in Central Africa" potx
... 85:507-519 Mahieux R, Pecon-Slattery J, Gessain A: Molecular characterization and phylogenetic analyses of a new, highly divergent simian T-cell lymphotropic virus type (STLV-1marc1) in Macaca arctoides ... B, Vandamme AM, Heneine W, Switzer WM: Identification in gelada baboons (Theropithecus gelada) of a distinct simian T-cell lymphotropic virus type with a broad range of Western blot reactivity ... survey was approved by both the national (Cameroon Ministry of Health and their National Ethics committee) and local authorities (village chief) with information to each participant An oral informed...
- 4
- 295
- 0
EXPLORATION OF PEROXISOME PROLIFERATOR ACTIVATED RECEPTOR GAMMA AGONIST IN ALZHEIMERS DISEASETHERAPY a THERAPEUTIC ENIGMA
... Laboratory Animal Research (Singapore) National Institute of Standards and Technology Nuclear magnetic resonance Orthogonal partial least squares discriminant analysis Principal component analysis ... tomography PPARγ coactivator 1α P-glycoprotein Pioglitazone Partial least squares discriminant analysis Peroxisome proliferator- activated receptor Peroxisome proliferator- activated receptor alpha ... of this increased PIO’s brain penetrance could support the usage of (+)-PIO in treating AD or other brain diseases Chapter 5: GC-TOF-MS-based metabolic profiling of caffeinated and decaffeinated...
- 215
- 183
- 0
Từ khóa: example of a natural language interfacedual boot mac os x snow leopard and windows 7 on a pcare stimulated by extracellular matrix proteins such as type i collagen previous studies have demonstrated the involvement of a dggryy sequence located within the a1 chain cterminal telopeptide in type i collageninduced pmn activationexporting the results of a query as a stringthe discovery of mexicoautomatic discovery of intentions in textefficient unsupervised discovery of word categoriesdiscovery of topically coherent sentencesefficient unsupervised discovery of word categoriesdiscovery of topically coherent sentences for extractive summarizationthe discovery of cold fusionunsupervised discovery of domainspecific knowledge from texthydrodynamics of a dual fluidized bed gasifierwork on your own initiative and as part of a team534 logic symbol for one half of a 74x139 dual 2 to 4 decoder a conventional symbolNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Chuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM