... List of Tables Page Table 1.1 List of common and important PTMs 23 Table 1.2 IQ motifs of established and potential CaM target proteins 37 Table 2.1 Data collection and refinement statistics of ... domains that mediate protein- protein, protein- lipid, and protein- DNA interactions (Fig 1.4) The most common protein- protein interaction domains in NRTKs are the Src homology...
... digestion fragments of untreated and deglycosylated AFP 1222 J C Achenbach and K V Ewart (Eur J Biochem 269) Ó FEBS 2002 Fig Analysis of antifreeze activity Antifreeze activity was evaluated qualitatively ... chemicals were reagent grade Purification of smelt AFP Blood plasma was obtained from a population of rainbow smelt (O mordax) caught in seawater along the nor...
... STRUCTURAL AND FUNCTIONAL CHARACTERIZATION OF TRX16, A THIOREDOXIN-LIKE PROTEIN AND ALTERING SUBSTRATE SPECIFICITY OF SPI1, A PROTEASE INHIBITOR PANKAJ KUMAR GIRI A THESIS SUBMITTED ... Farré and Casado, 2001; Laroux et al., 2001), atherosclerosis and other cardiovascular disorders, inflammation and chronic inflammation (Laroux et al., 2001; Latha and...
... cross-linking efciency of Iba1 and Iba2 or in the overall morphology of the generated lament bundles Calcium afnity of Iba1 and Iba2 Homodimerization and actin binding of Iba1 and Iba2 were similar ... presented here reveals functional similarities and differences between Iba1 and Iba2 We investigated Ca2+ binding and homodimerization of Iba1 and Iba2 Fur...
... in all compared organisms We have also analyzed the presence of putative elements in the 5’ region of the gene There is a canonical TATA box at –35 bp from the transcription start site and a putative ... were used as controls 2.4 Gel retardation analysis A DNA fragment used for gel retardation analysis containing a sequence from the 5’- untranslated region...
... concentration of DHPC Protein -lipid interactions and Protein-LDLR binding of ApoE- (72-166) Proteins To identify and compare the lipid binding ability of the three apoE- (72-166) peptides, we assessed ... Received: 17 September 2010 Accepted: 10 January 2011 Published: 10 January 2011 References Weisgraber KH, Rall SC Jr, Mahley RW: Human E apoprotein heterogeneity Cysteine...
... β-cardiotoxin, an all β-sheet protein isolated from the venom of Ophiophagus hannah (king cobra) Manuscript under preparation xvi (5) Roy A, Sivaraman J, and Kini RM Structural and functional characterization ... forests and mangrove swamps in parts of Southeast Asia, South China and India Chapter One A B C Figure 1.1: Ophiophagus hannah (king cobra)...
... anionic and cationic peptides 1.1.2.5 Fragments of larger proteins 1.1.3 The family of defensins 1.1.3.1 Expression of defensins 11 1.1.3.2 Expression of Human Beta Defensins 11 1.1.4 Human beta defensin- 3 ... diagrams of Selected Defensins A comparison of structures of different types of defensins (A) Human Neutrophil Peptide (Dimer), (B) Insect defensin A, (C...
... that MCPIP regulates the amount of IL-1b mRNA Involvement of PIN domain of MCPIP in the stability of IL-1b mRNA In order to find out whether the PIN domain in MCPIP is responsible for IL-1b mRNA ... interacting with MCPIP will clarify the dynamics and features of this protein Role of MCPIP in regulation of the endogenous IL-1b transcript level...
... analysis The 105 000 g supernatant of lungfish liver (lane 1), skeletal muscle (lane 2), intestine (lane 3), lung (lane 4), brain (lane 5), adipose tissue (lane 6), heart (lane 7) and skin (lane ... showed that the protein is in a monomer–dimer equilibrium and that the dissociation constant is in the micromolar range for the apoprotein and in the submicromolar range f...
... Dr Asha, Dr Huang Canhua, Dr Wu Jinlu, Ms Tang Xuhua, Ms Sunita and, Mr Jobi and the rest of the lab mates for the valuable discussion and friendship and the present and former members of Functional ... Birnaviridae, Bunyaviridae, Herpesviridae, Piconaviridae, Parvoviridae, Reoviridae, Rhabdoviridae, Togaviridae, Iridoviridae, Nodaviridae and Nimaviridae Crustacean viral dise...
... UMPK The F133N mutation was created using UMP kinase from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT ... with ADP and UDP, and ADP showed a rate that was > 20 times that of UDP In order to determine the true Km for UMP and ATP, a two-substrate assay was performed at fou...
... mechanism of both RNA and DNA synthesis [17] In a previous study, we reported the findings of an analysis of the complete sequence of the cryptic plasmid pIT3 isolated from the crenarchaeon S solfataricus ... analyses of the predicted amino acid sequence showed that the C-terminal half of the RepA of the pIT3 plasmid is sequence-similar to the heli...