Shell transformation model for simulating cell surface structure
Shell transformation model for simulating cell surface structure
... three main types: shell, shell with a liquid core, and solid model Shell Model The shell model adopts a thin shell theory to describe the deformation of the surface structure This model was applied ... the cell surface structures when the cell carries out the biological processes The changes are represented by transformation strains, forces, and dipoles in the sh...
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx
... ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA CACGGCATATTATGATGATGAGAACATGATGGATCTCG ... ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT GCCCCGGGATCATTGAGAACAATTTCC GCGGATCCGTATGACCACATTCTATACTGA GAGCCAATATCAAATCTGGTGGT...
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt
... anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE and silver stain of proteins isolated from AP sepharose (lane 1) and FN3d–AP sepharose (lane 2) A protein band of approximately 95 kDa is ... nucleolin, mean that calculations of binding affinity are unrealistic at this stage Nucleolin localization in muscle is analogous to PTPr ligand localization To determine wh...
Báo cáo khoa học: N-Glycosylation is important for the correct intracellular localization of HFE and its ability to decrease cell surface transferrin binding pptx
... effect of HFE binding to TfR1 is to lower the affinity of the receptor for transferrin [15] This most likely reflects the existence of overlapping HFE and transferrin- binding sites on the receptor ... understanding suggests that the majority of cell types regulate cellular iron levels by binding of transferrin to the type transferrin recepto...
Báo cáo khoa học: Crystal structure of a staphylokinase variant A model for reduced antigenicity pptx
... (1993) Interaction between staphylokinase, plasmin(ogen), and alpha2-antiplasmin Recycling of staphylokinase after neutralization of the plasmin -staphylokinase complex by alpha2-antiplasmin J Biol ... 26 Navaza, J (1994) AMORE: an automated package for molecular replacement Acta Crystallogr A5 0, 157±163 27 Brunger, A (1993) X-PLOR, Version 3.1 A System for X-Ray Crystallogr...
Báo cáo khoa học: "Structural Topic Model for Latent Topical Structure Analysis" pot
... In this paper, we propose a new topic model, named Structural Topic Model (strTM) to model and analyze both latent topics and topical structures in text documents To so, strTM assumes: ... compared with the baseline methods that don’t explicitly model the topical structure The results confirm the necessity of modeling the latent topical structures inside documents, and a...
Báo cáo hóa học: " Research Article A Robust Structural PGN Model for Control of Cell-Cycle Progression Stabilized by Negative Feedbacks" pdf
... noise and parameters’ random variation The natural follow up of this research is to infer the PGN model from available dynamical data of cell-cycle progression, analogously to what we have done for ... regulatory system of the malaria parasite [5, 6] We anticipate that, very likely, analysis of these dynamical data will uncover unknown negative feedback loops in cell-cyc...
Báo cáo hóa học: "A Probabilistic Model for Face Transformation with Application to Person Identification" pot
... using a face transformation model In the case where we have multiple template images for person P, we should combine them into a single face model ᏹ p (this would require a new formula for the face ... significantly outperform two popular face recognition algorithms, namely eigenfaces and fisherfaces Finally, we outline future work MODELING FACE TRANSFORMATION In this s...
Báo cáo khoa học: "Developing an Agrobacterium-mediated transformation system for Lilium x formolongo using thin cell layer of bulb scales" ppsx
... expression, implying a successful transformation of Lilium x formolongo by Agrobacterium using thin cell layers of bulb scales Fig Results of transformation via Agrobacterium using thin cell layers ... Nguyen Thi Thuy, Nguyen Quang Thach experiments, we investigated the potential of using thin cell layers of bulb scales for production of trangenic...
Báo cáo y học: "Identification of subpopulations with characteristics of mesenchymal progenitor cells from human osteoarthritic cartilage using triple staining for cell surface markers" docx
... by trypsin treatment (0.05% trypsin, 0.02% EDTA; Biochrom) at 75% confluence Flow cytometry analysis of cells Either isolated cells from OC were directly used for flow cytometric analysis or cells ... functionality of cell surface molecules on human mesenchymal stem cells J Biomed Sci 2003, 10:228-241 Reyes M, Verfaillie CM: Characterization of multipotent adult pro...
báo cáo khoa học: " Surface structure, model and mechanism of an insect integument adapted to be damaged easily" pot
... cuticle surface of other arthropods than sawflies, such as in nymphs of bugs and ticks [13] and in adults of flies and dragonflies [14,15] Their function is to allow by stretching an increase of body ... for defense Insect Defenses: adaptive mechanisms and strategies of prey and predators Edited by: Evans DL, Schmidt JO Albany: State Univ of New York Press; 1990:...
Báo cáo khoa học: " A rapid and efficient method for studies of virus interaction at the host cell surface using enteroviruses and real-time PCR" potx
... suspension for h at 4°C and virus attachment was subsequently measured using RT-PCR B) MOI TCID50 /cell of CVB2O was incubated as described in A) at 4°C or at room temperature and attached virus was measured ... demonstrating that incubation at a higher temperature reduced unspecific attachment of this virus to CHO cells, while attachment to CHO-CAR, CHO-DAF and...
Báo cáo y học: " Six host range variants of the xenotropic/polytropic gammaretroviruses define determinants for entry in the XPR1 cell surface receptor" ppt
... infectivity on mouse cells carrying the variants of Xpr1 (Table 2) Both viruses infected NIH 3T3 (Xpr1n) and cells carrying Xpr1sxv, but did not infect cells of M pahari (Xpr1p) or cells carrying Xpr1c ... carrying Xpr1sxv with high efficiency, shows very poor infectivity on cells carrying Xpr1c and on Rat2 cells, and is restricted by hamster cells and cells carrying the mouse Xpr...
Báo cáo sinh học: "Data transformation for rank reduction in multi-trait MACE model for international bull comparison" doc
... Table V Ranking correlations for Holstein bulls of the multiple lactation MACE (ML -MACE) and the reduced rank random regression MACE models with the random regression MACE model Rank reductions ... deviations, Interbull Bull 32 (2004) 46–52 Rank reduction in MT -MACE models 307 [10] Madsen P., Jensen J., Mark T., Reduced rank estimation of (co)variance components fo...
Development of human stem cell based model for developmental toxicity testing
... toxicity 15 2.2.2 In vivo animal studies for developmental toxicity testing 17 2.3 In vitro animal -based models for developmental toxicity testing 18 2.3.1 The MM assay 19 2.3.2 ... However, current animal -based models for developmental toxicity testing is limited by time, cost and high inter-species variability, while human pluripotent stem cell (hPSC) mod...
Từ khóa:
- a model for stem cell therapy in regenerative medicine
- a land transformation model for the saginaw bay watershed
- a structured model for joint learning
- a model for the micro structured reactor plant concept
- assessment of a parametric hurricane surface wind model for tropical cyclones in the gulf of mex
- model systems for studying cell wall lignification
- computational model for trabecular bone structure
- quot atom like quot shell model for quantum dots
- cellisa reporter cell based immunization and screening of hybridomas specific for cell surface antigens
- use of colloidal silica beads for the isolation of cell surface proteins for ms
- use of colloidal silica beads for the isolation of cell surface proteins for mass spectrometry based proteomics
- cell surface capturing technologies for the surfaceome discovery of hepatocytes
- a model for cochlear stem cell biology in humans
- nobilis a model for understanding molluscan shell formation
- development and evaluation of qsars for ecotoxic endpoints the benzene response surface model for toxicity
- Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018
- Báo cáo quy trình mua hàng CT CP Công Nghệ NPV
- Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam
- Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại
- đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN
- ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN
- NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE
- Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh
- Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Phát hiện xâm nhập dựa trên thuật toán k means
- Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000
- Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin
- Thơ nôm tứ tuyệt trào phúng hồ xuân hương
- Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX
- Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật