Characterization of the novel role of parkin in gliomagenesis

... Function of Parkin 1.10.4 Mutations in Parkin Parkin and Cancer Cyclin E – A link between parkin, cancer and neurodegeneration? Other PD-linked Genes and Cancer A role for parkin in gliomagenesis ... that parkin also plays a role in the progression and development of a variety of cancer In this thesis, I investigated the potential role of parkin in gliomagenesis and showed that parkin expression ... assigned the PARK2 locus in the original report and thereafter Accordingly, much of the interest in characterizing the function of the parkin gene has been directed towards understanding its role in...

Báo cáo khoa học: Characterization of mutations in crucial residues around the Qo binding site of the cytochrome bc1 complex from Paracoccus denitriﬁcans pdf

... change in the redox state of the stigmatellin In conclusion, the redox-induced FTIR difference spectra of the site- directed mutations in the Qo binding site of the bc1 complex from P denitriﬁcans, ... within the Infrared spectroscopic characterization of mutations in the Qo site binding site This observation is not surprising in the light of previous data showing that mutations on the Y302 site ... complexes from other organisms The mutated residues are highlighted in Fig Results Site- directed mutations in the Qo binding site Mutations in conserved positions of cytochrome b at the Qo site were...

Báo cáo y học: " Characterization of variants in the promoter of BZLF1 gene of EBV in nonmalignant EBV-associated diseases in Chinese children" docx

... BZLF1- Zp variants and EBV infection in the China children population Results Definition of type or/and type EBV in patients with EBV infection The frequency of type or type EBV infection was determined ... between these EBV genotypes and clinical phenotypes of EBV- associated diseases in Chinese children In this study, EBV DNA from blood samples of 206 patients with IM, EBV- HLH, CAEBV, and healthy controls ... found in all infection categories, except a relatively rare diseaseCAEBV, indicating that it was the primary variant of EBV circulating in China The Zp-V3 variant was the dominant genotype in CAEBV...

Báo cáo khoa học: Systematic characterization of mutations in yeast acetohydroxyacid synthase doc

... case of CS Since this side chain of CE makes important interactions with the protein, it is possible that the binding mode of other sulfonylureas differs from that of CE ể FEBS 2003 AHAS mutations ... preliminary docking calculations have shown that an inverted position is possible with the S-ring, rather than the N-ring, inserted into the substrate access channel Determining the structure of ... 5B) We interpret the qualitative spectral difference to mean that changing M354 to valine alters the environment of the isoalloxazine ring of FAD Activation and inhibition The inhibition of wild-type...

Báo cáo lâm nghiệp: "Production and characterization of exocellular in ectomycorrhizal fungi proteases" pps

... nutrition of ectomycorrhizal plants I Utilization of peptides and proteins by ectomycorrhizal fungi New Phytol 103, 481-493 Abuzinadah R.,A., Finlay R.D & Read D.J (1986) The role of proteins in the ... activity was also induced in beech-Lactarius ectomycorrhizas incubated in the presence of litter proteins Gelatin was less efficient and ammonium repressed the excretion after 48 h of incubation Non-mycorrhizal ... when the fungi were between the ability of the fungi to produce such enzymes and their distribution in the soil layers References Abuzinadah R.A & Read D (1986) The role of proteins in the nitrogen...

Báo cáo y học: "Functional characterization of Trip10 in cancer cell growth and survival" ppsx

... University Results Immunostaining Trip10 is differentially methylated in human cancer cell lines and primary tumor specimens Cells were fixed in 2% formaldehyde in phosphate buffered saline (PBS) and ... Overexpression of Trip10 in IMR-32 cells caused Trip10 and huntingtin to colocalize and form perinuclear foci In contrast, while overexpression of Trip10 in CP70 cells also increased huntingtin levels, ... Trip10- overexpressing IMR-32 cells (Figure 4A) On the other hand, huntingtin increases cell death by promoting apoptosis Thus, high levels of huntingtin in Trip10overexpressing CP70 cells may lead to cell...

Báo cáo y học: "Isolation and characterization of microparticles in sputum from cystic fibrosis patients" pot

... analysis of inflammatory cells infiltrating the cystic fibrosis airway mucosa Clin Exp Immunol 2001, 124(1):69-76 35 Livraghi A, Randell SH: Cystic fibrosis and other respiratory diseases of impaired ... largely sophisticated and quantifiable, and the search for novel biomarkers of CF airways disease in this biofluid is under way [16,47] The finding of MPs in sputum raises some intriguing questions ... endothelial cells, granulocytes, monocytes, lymphocytes) following chemical (cytokines, thrombin and endotoxin), physical (shear stress and hypoxia) [17] and apoptotic [18] stimuli One of the first described...

Development of microextraction based techniques for quantification and behaviour characterization of nanoparticles in aquatic environments

... DEVELOPMENT OF MICROEXTRACTION- BASED TECHNIQUES FOR QUANTIFICATION AND BEHAVIOR CHARACTERIZATION OF NANOPARTICLES IN AQUATIC ENVIRONMENTS SEYED MOHAMMAD MAJEDI (M.Sc., AMIRKABIR UNIVERSITY OF ... applications of CuO on the basis of the number of papers published in the Institute for Scientific Information (ISI) Web of Science, as reported in Table 1-2 [8] Ag NP is the most incorporated NP in industrial ... approach applied for the detection, determination, and behavior characterization of ENMs in water, relies on the preservation of the original properties of ENMs, and resembling of the environmentally-relevant...

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identiﬁed and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains and a single KH domain similar ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1 (ANKHD1) variants,...

Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus inﬂuenzae pot

... Schweda, E.K.H (2001) A rapid and sensitive procedure for determination of 5-N-acetyl neuraminic acid in lipopolysaccharides of Haemophilus in uenzae: a survey of 24 nontypeable H in uenzae strains ... HexNAc1ÆHex5ÆHep4ÆAnKdo-ol (Tables and 4) The Table Negative ion ESI-MS data and proposed compositions for O-deacylated lipopolysaccharide (LPS-OH) of nontypeable Haemophilus in uenzae (NTHi) strain 981 Average ... abundance was estimated from the area of molecular ion peak relative to the total area (expressed as percentage) Peaks representing less than 3% of the base peak were not included in the table Observed...

Báo cáo khóa học: Characterization of novel structural features in the lipopolysaccharide of nondisease associated nontypeable Haemophilus inﬂuenzae pptx

... have been identiﬁed in those strains that are responsible for most of the steps in the biosynthesis of the oligosaccharide portions of the LPS molecules The inner core of H in uenzae LPS has been ... common structural feature on surface structures of pathogens residing in the human respiratory tract, including H in uenzae Expression of PCho has been associated with persistence of H in uenzae in ... within H in uenzae LPS remains to be elucidated Ester-linked glycine has been shown to be a prominent substituent in the core region of H in uenzae LPS All strains investigated so far express minor...

Báo cáo khoa học: Characterization of Trypanosoma brucei PEX14 and its role in the import of glycosomal matrix proteins pptx

... We interpret this observation as the retainment of newly synthesized proteins in the cytosol due to the inability to import matrix proteins by the fraction of growing and dividing glycosomes The ... lower (not shown) In order to determine the in uence of the reduction of the expression of TbPEX14 on the import of glycosomal matrix proteins, the subcellular distribution of glycolytic enzymes ... identiﬁed in yeast) PEX17 Several other peroxins are involved in the subsequent steps of the import The import of matrix proteins seems to involve a cascade of interactions between the cargo-loaded...

Báo cáo khoa học: Puriﬁcation and characterization of three isoforms of chrysophsin, a novel antimicrobial peptide in the gills of the red sea bream, Chrysophrys major doc

... lamellae and EGC-like cells of the primary lamellae of red sea bream gills We are currently trying to obtain cDNAs encoding chrysophsins from the gills of red sea bream, and we aim to investigate the ... (minimal lethal concentration) of native and synthetic chrysophsins compared with that of magainin-2 Minimal lethal concentrations of peptide are given in lM and are the concentration of substance ... Immunohistochemical localization of chrysophsins in the gills of the red sea bream Adjacent sections in the gills were immunostained with chrysophsin-1 antibody (A, C, E and F) and with hematoxylin and eosin...

Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx

... and RAD53 related (ATR) kinases at the site of DNA damage may decrease the kinase ⁄ phosphatase ratio and allow the phosphatase to dephosphorylate cH2AX In mammalian cells, PP 2A isoforms, the ... 2008 The Authors Journal compilation ª 2008 FEBS ´ C Vazquez-Martin et al Cisplatin-induced DNA damage response Cisplatin DNA damage DNA damage H2AX- P ( H2AX) Recovery H2AX H2AX- P ( H2AX) Psy4 ... MMS-induced DNA damage, cH2AX may be removed from the site of action of the ATM ⁄ ATR kinases, allowing Pph3p–Psy4p–Psy2p to dephosphorylate cH2AX In the case of the cisplatin-induced DNA damage response,...

báo cáo hóa học:" A novel role of HLA class I in the pathology of medulloblastoma" docx

... square areas containing specific bands and an identical blank area drawn in the immediate vicinity of the band, according to the following formula: Band 1/Band ratio= (Band 1-blank)/ (Band -blank) ... marginal ability to invade, the presence of β2m clearly induced significant migratory activity (Fig 6A) Evaluation of the surface area of the scratch at and 24 hours time points indicated that ... disproportionately more in specimens with high MHC class I expression Furthermore, HLA class I may be involved in signaling modification as exogenously added β2m binds to HLA class I and enhances activation...

Xem thêm