Engineering and characterization of human renal proximal tubular cells for applications in vitro toxicology and bioartifical kidneys

... proximal tubular cells of human origin Therefore, human primary renal proximal tubular cells (HPTC) would be most suitable for such applications However, the application of primary human cells is ... effects on renal cells and possible applications will be discussed in detail 23 1.3 Genetic Engineering of HPTC and development of a BMP-7-producing BAK BMPs are members of the transforming growth ... cell-containing cartridges and BAKs in clinical trials These issues will be discussed in more details in the following section 1.2 Development of BAKs and applications of HPTC in such devices Acute renal...

Báo cáo y học: " Derivation of normal macrophages from human embryonic stem (hES) cells for applications in HIV gene therapy" pps

... of human embryonic stem cells Stem cells 2005, 23:1228-1233 Moon SY, Park YB, Kim D-S, Oh SK, Kim D-W: Generation, culture, and differentiation of human embryonic stem cells for therapeutic applications ... Daley GQ: Therapeutic potential of embryonic stem cells Blood Rev 2005, 19:321-331 Menendez P, Wang L, Bhatia M: Genetic manipulation of human embryonic stem cells: A system to study early human ... colony-forming cells derived from humanembryonic stem cells Proc Natl Acad Sci USA 2001, 98:10716-10721 Vodyanik MA, Bork JA, Thomson JA, Slukvin II: Human embryonic stem cell-derived CD34+ cells: ...

Báo cáo y học: "Characterization of Human Erythrocytes as Potential Carrier for Pravastatin: An In Vitro Study"

... of pravastatin in human erythrocytes The current work studies effect of time, temperature as well as drug concentration on the process of pravastatin loading into human erythrocytes by endocytosis ... characterization of pravastatin loaded erythrocytes Hematological Indices To determine the effect of loading process on erythrocytes, normal erythrocytes, erythrocytes suspended in PBS, and pravastatin-loaded ... Koitabashi Y, Kumai T, Matsumoto N, Watanabe M, Sekine S, Yanagida Y, Kobayashi S Orange juice increased the bioavailability of pravastatin, 3-hydroxy-3-methylglutaryl CoA reductase inhibitor, in...

Báo cáo sinh học: "Human cytokine-induced killer cells have enhanced in vitro cytolytic activity via non-viral interleukin-2 gene transfer" docx

... secreting lymphocytes functioning as immune enhancer cells Therefore, our report is the first describing CIK cells to have enhanced in vitro cytolytic activity via non-viral interleukin-2 gene ... by stimulating immune cells including T and natural killer cells But adenoviral transfection may raise safety questions in human gene therapy Therefore, we were interested in evaluating the Page ... antitumor immunity in vitro against pancreatic carcinoma cell lines via secreting significant amounts of IL-2 Ductal pancreatic adenocarcinoma is the fourth leading cause of cancer death in the Western...

Báo cáo khoa học: Engineering and characterization of human manganese superoxide dismutase mutants with high activity and low product inhibition potx

... hMnSOD has a low level of product inhibition, similar to that of the parent mutant Q143A hMnSOD, while exhibiting higher catalytic activity and efﬁciency Although even higher catalytic activity would ... efﬁciency and similarly low product inhibition compared with the Q143A hMnSOD parent Our results demonstrate the ability of directed evolution to engineer variants of hMnSOD with high catalytic activity ... anti-tumor effects of an active site mutant of human manganese- superoxide dismutase Evolutionary conservation of product inhibition J Biol Chem 279, 12769–12776 19 Bull C, Niederhoffer EC, Yoshida...

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG ... kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT ATTCTACCAAAAGAATGGCC-3¢ and its ... milk, pancreatic juice and intestine: inadequate for role in zinc absorption Am J Clin Nutr 35, 1–9 Evans GW & Johnson PE (1980) Characterization and quantitation of a zinc binding ligand in human...

Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

... Mapping of transcription initiation sites in the human DNASE1 gene To identify the transcription initiation sites of DNASE1 in pancreas, 5¢-RACE based on RNA ligasemediated and oligo-capping ... including characterization of the promoter region of the gene and the associated transcriptional factors Therefore, delineation of the transcriptional Promoters of human deoxyribonuclease I gene regulation ... isoforms The 5¢-UTR of eukaryotic mRNA in uences the initiation step of protein synthesis and thereby in part determines the translational efﬁciency of the transcript [26] In fact, as shown in...

Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

... Mack et al Human 3-methylglutaconyl-CoA hydratase Fig The metabolic pathway of (S) -leucine (L -leucine) and isovalerate Enzymes involved are as follows: 1, EC 2.6.1.42, branched chain amino transferase ... 3-MG-CoA hydratase reaction of leucine catabolism at the protein and DNA levels and developed a novel assay for enzyme analysis in a diagnostic setting The human AUH protein was first recognized by its ... confirmation of AUH deficiency in fibroblast homogenates In summary, our data show that the main biological function of AUH in human metabolism is the hydration of (E)-3-MG-CoA to (S)-HMG-CoA in the leucine...

Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

... cross-linking efciency of Iba1 and Iba2 or in the overall morphology of the generated lament bundles Calcium afnity of Iba1 and Iba2 Homodimerization and actin binding of Iba1 and Iba2 were similar ... presented here reveals functional similarities and differences between Iba1 and Iba2 We investigated Ca2+ binding and homodimerization of Iba1 and Iba2 Furthermore, F-actin binding and cross-linking ... Human Iba proteins J O Schulze et al study has revealed expression proles for most of the human transcripts and uncovered different tissuespecic expression of Iba1 and Iba2 [5] For Iba1 ,...

Báo cáo khoa học: Puriﬁcation and functional characterization of human 11b hydroxylase expressed in Escherichia coli doc

... volume and energetic properties of the binding of CO to hemoproteins Biophys J 66, 89–98 Tuckey RC & Kamin H (1983) Kinetics of O2 and CO Binding to adrenal cytochrome P-450scc Effect of cholesterol, ... was in the range of values determined in previous studies for the interaction between bovine Adx and bCYP11B1 Biacore measurements were performed to investigate the binding behavior between bovine ... the functional and structural consequences of two point mutations (P94L and A368D) in the CYP11B1 gene causing congenital adrenal hyperplasia resulting from 11 -hydroxylase deﬁciency J Clin Endocrin...

Báo cáo sinh học: "Functional characterization of human Cd33+ And Cd11b+ myeloid-derived suppressor cell subsets induced from peripheral blood mononuclear cells co-cultured with a diverse set of human tumor cell lines" docx

... this article as: Lechner et al.: Functional characterization of human Cd33+ And Cd11b+ myeloid-derived suppressor cell subsets induced from peripheral blood mononuclear cells co-cultured with a diverse ... serum and regulated by association of a latency protein, precluded clear neutralization data Characterization of human CD33+ and CD11b+ suppressor cells induced by tumor cell lines To characterize ... on a BD FACSCalibur flow cytometer and data acquisition and analysis were performed as above Data are from three unique donors and expressed as a fraction of labeled cells within a live -cell gate...

Báo cáo y học: "Structural and functional characterization of human apolipoprotein E 72-166 peptides in both aqueous and lipid environments" pot

... concentration of DHPC Protein -lipid interactions and Protein-LDLR binding of ApoE- (72-166) Proteins To identify and compare the lipid binding ability of the three apoE- (72-166) peptides, we assessed ... Received: 17 September 2010 Accepted: 10 January 2011 Published: 10 January 2011 References Weisgraber KH, Rall SC Jr, Mahley RW: Human E apoprotein heterogeneity Cysteine-arginine interchanges ... apoE3 and apoE4, and with apoE2-, apoE3-, and apoE4- (72-166) proteins, respectively The VLDL bands were shifted with the binding of apoE proteins Detailed procedures are described in Materials and...

Báo cáo y học: "Characterization of human adenovirus 35 and derivation of complex vectors" doc

... progeny yields of Ad35 vectors on 293-ORF6 cells rAd35 vector Ad35 wt Yield (pu/cell) 125,893 Ad35E1(d8) 77,839 Ad35E1(d8)E4(AN) 58,875 Ad35E1(d8)E3(HE)E4(AN 36,000 To further expand the utility of ... Replication-deficient human adenovirus type 35 vectors for gene transfer and vaccination: efficient human cell infection and bypass of preexisting adenovirus immunity Journal of virology 2003, 77:8263-8271 ... vectors [17] In summary, the data reported here expanded the knowledge of adenovirus 35 and vector design and will guide the derivation of complex adenovirus vectors from other serotypes Methods Reverse-phase...

Báo cáo y học: "Phenotypic and genotypic characterization of Human Immunodeficiency Virus type 1 CRF07_BC strains circulating in the Xinjiang Province of China" pot

... safety [11 ] The present study aims to characterize the genotype and phenotype of HIV -1 CRF07_BC strains circulating in Xinjiang province, in comparison with those of the subtype B' predominating in ... BC V1V2 20 B’ V1V2 V1-V5 in gp120 of subtype B’ and CRF07_BC Figure gp120 of the CRF07_BC and subtype B' viruses The frequency of potential N-linked glycosylation sites in The frequency of potential ... B' The frequency of potential N-linked glycosylation sites in the The frequency of potential N-linked glycosylation sites in the V1V2 region in gp120 of the CRF07_BC and subtype B' viruses There...

Xem thêm

Từ khóa: characterization of human adipose derived stem cells using flow cytometry isolation and characterization of human fetal myoblasts release activation and the invasive ability of cells in co culture of human monocytes thp 1 cells and fibroblasts characterization of localised dry spots on creeping bentgrass turf in the united states pren on the selection of austenitic oil country tubular goods for sour gas service characterization of long term creep fatigue behavior for glass fiber reinforced polypropylene epithelial differentiation of human adipose derived stem cells adipogenic differentiation of human adipose derived stem cells on 3d silk scaffolds collection processing and banking of umbilical cord blood stem cells for transplantation and regenerative medicine develop implement and evaluate the effectiveness of initial organizational model treatment facility for inmates in provincial hospitals cloning expression and characterization of a scfv f8 human il10 fusion protein faculty of chemical engineering and environmental protection faculty of chemical engineering and environmental protection iasi faculty of chemical engineering and technology university of zagreb development of human embryo and fetus Báo cáo quy trình mua hàng CT CP Công Nghệ NPV đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát hiện xâm nhập dựa trên thuật toán k means Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP