Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc
... for Q RT-PCRPrimer Alias Sequence1082 ACT1F GCCTTCTACGTTTCCATCCA1083 ACT1R GGCCAAATCGATTCTCAAAA1367 PAC2F AATAACGAATTGAGCTATGACACCAA1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT1172 BUD6F CAGACCGAACTCGGTGATTT1173 ... validate the microarray data, we used quantitativeRT-PCR to examine the expression of five of the up-regulatedgenes in a set of RNA samples that had been used in the array analysis (Figure 3a) . ... GOstats analysis of genes altered in CDC13+ strains. Table D shows GOstats analysis of genes altered in cdc13-1 strains that are not cell cycle regulated. Tables E-Q show GOstats analysis of genes...
- 17
- 432
- 0
Báo cáo y học: "Metabolic network driven analysis of genome-wide transcription data from Aspergillus nidulan" docx
... (mitochondrial) Aspartate transaminase (mitochondrial) B-ketoacyl-ACP synthaseAspartate transaminase (mitochondrial) Aspartate transaminase (mitochondrial) Carbamoyl-phophate synthetaseATP:citrate oxaloacetate-lyase ... Maeda H, Sano M, Maruyama Y, Tanno T, Akao T, Totsuka Y, EndoM, Sakurada R, Yamagata Y, Machida M, et al.: Transcriptional anal-ysis of genes for energy catabolism and hydrolytic enzymes in ... 1,3-β-Glucan synthase 5'-Phosphoribosylformyl glycinamidine synthetaseAcetyl-CoA hydrolase Acetyl-CoA hydrolase 8-Amino-7-oxononanoate synthaseAconitate hydratase (mitochondrial) Acetyl-CoA synthase...
- 16
- 468
- 0
Báo cáo y học: " Diagnosis and phylogenetic analysis of Orf virus from goats in China: a case report" pot
... State Key Laboratory of Veterinary Etiological Biology, National Foot-and-Mouth Disease Reference Laboratory, Key Laboratory of Animal Virology of Ministry of Agriculture, Xujiaping No.1, Yanchangpu, ... incidence was approaching 60% and the mortality rate was 24.7% (162/655), although anti-viral and antibiotic medicines were administered in the drinking water, by intramuscular injection or orally.Two ... Authors wish to thank the journal editors and anonymous reviewers for their editing and revision the manuscript.Author DetailsLanzhou Veterinary Research Institute of Chinese Academy of Agriculture...
- 5
- 309
- 0
Báo cáo y học: "Mortality associated with administration of highdose tranexamic acid and aprotinin in primary open-heart procedures: a retrospective analysis" ppt
... treatment and hospitalstay was detectable (Table 2). Analysis of biochemical safety data is shown in Table 3. In this subgroup, an increase of creatinine in patients receiving TXA imme diately after ... discontinued the u se of aprotinin. From thattime, we prospectively collected anonymized data in a database evaluating parameters of efficiency and safety.Data of 336 patients receiving TXA were ... operatingprocedures. The diagnosis of myocardial infarction was based onthepresenceofnewQwavesin two contiguous elec-trocardiogram leads and an increase of myocardialcreatine kinase (CK-MB) above 10% of total...
- 14
- 247
- 0
Báo cáo y học: "Psychogenic or neurogenic origin of agrammatism and foreign accent syndrome in a bipolar patient: a case report" pdf
... agrammatism, initially categorized as being of psychogenic origin. The patient had an extensive neuropsychological and language evaluation aswell as brain imaging exams. In addition to FAS and ... (2 cases) or epi-sodes of psychosis (1 case). In 34% of these cases, FAS wasalso associated with agrammatism. Agrammatism is a fre-quent symptom of Broca's aphasia characterized by a def-icit ... developed the language disorder, he was on stable doses of lithium,valproate, quetiapine and perphenazine.Although they appeared approximately 3 years earlier, the functional origin of the FAS and agrammatism...
- 7
- 502
- 0
Báo cáo y học: "Enumeration and phenotypical analysis of distinct dendritic cell subsets in psoriatic arthritis and rheumatoid arthritis" pps
... DC enumeration, purification, cell culture, flowcytometry, ELISA and statistical analysis. ARF participated in the flow cytometry, and ARF and JAG carried out the Luminex analysis. RDS and IBM ... multiple proinflammatorycytokines and enzymes implicated in the pathogenesis of both of these disorders. Targeting cytokines has proven therapeuti-cally useful, exemplified particularly in tumour ... expression. Maturation is incomplete in the inflamed synovial compartment. Immature DCs in SF maycontribute to the perpetuation of inflammation via sampling of the inflamed synovial environment, and in...
- 13
- 438
- 0
Báo cáo y học: " Genetic and functional analysis of HIV-1 Rev Responsive Element (RRE) sequences from North-India" pdf
... 160CONSENSUS_C GACGGTACAG GCCAGACAAT TGTTGTCTGG TATAGTGCAA CAGCAAAGCA ATTTGCTGAG GGCTATAGAG GCGCAACAGCRRE-S1 .A A G G .A .C T RRE-S2 .A A G G .A .C T RRE-S3 .A A G G .A T RRE-S4 .A A G G .A T RRE-S5 .A A ... 240CONSENSUS_C ATATGTTGCA ACTCACGGTC TGGGGCATTA AGCAGCTCCA GACAAGAGTC CTGGCTATAG AAAGATACCT AAAGGATCAARRE-S1 C A C. .A .G A G.G. RRE-S2 C A C. .A .G A G.G. RRE-S3 C A C. .A .G A G.G. RRE-S4 C A C. .A ... related paper [10].They were monitored at Post Graduate Institute of Medi-cal Education and Research (PGIMER), Chandigarh by Dr A Wanchu (Clinician and one of the authors) after obtain-ing all...
- 8
- 406
- 0
Báo cáo y học: "Municipal policies and plans of action aiming to promote physical activity and healthy eating habits among schoolchildren in Stockholm, Sweden: a cross-sectional study" potx
... (are there any policies aiming to pro-mote physical activity and/or healthy eating habits, andare there any plans of action aiming to promote physicalactivity and/or healthy eating habits?), ... ReferencesPolitical environment Are there any policies aiming to promote physical activity and/or healthy eating? [25-27]Are there any plans of action aiming to promote physical activity and/or healthy eating?Are ... adopted AND be of present interest AND contain clear and measurable aims.61Are there any plans of action aiming to promote physical activity and/or healthy eating?Significant measures taken = Yes,...
- 11
- 378
- 0
Báo cáo y học: "Single ventricle with persistent truncus arteriosus as two rare entities in an adult patient: a case report" doc
... Type A3 : a single pulmonary artery originating from the arterial trunk, along with collaterals originating from the descending aorta.4. Type A4 : significant abnormalities of the aortic arch in association ... tachycardia, cyanosis, and progressive heartfailure. Later, secondary erythrocytosis and clubbing areusually present. The diagnosis may be defined by echocardiography, car-diac catheterization, ... changes.Chest radiograph indicated a small pleural effusion on the right and increased pulmonary vascularity. The heart wasmoderately enlarged with prominence of the aorta. Anechocardiogram was performed...
- 6
- 277
- 0
Báo cáo y học: " Sequence and phylogenetic analysis of H7N3 avian influenza viruses isolated from poultry in Pakistan 1995-2004" pot
... City, CA). GenBankaccession numbers are given in Table 1.Phylogenetic and Sequence Analysis Phylogenetic analysis included any available sequencedata from H7N3 isolates from Pakistan (therefore ... RG: Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential. Avian Dis ... with increased mortality and decreased egg production. Avian Pathol 2003, 32:285-289.7. Mase M, Imada T, Sanada Y, Etoh M, Sanada N, Tsukamoto K, Kawaoka Y, Yamaguchi S: Imported parakeets harbor...
- 10
- 254
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ