Báo cáo y học: "A Melanesian -thalassemia mutation suggests a novel mechanism for regulating gene expression" potx
Báo cáo y học: "A Melanesian -thalassemia mutation suggests a novel mechanism for regulating gene expression" potx
... Biology 2006, 7:238commentreviewsreports deposited researchinteractionsinformationrefereed researchMinireview A Melanesian ␣␣ -thalassemia mutation suggests a novel mechanism for regulating ... SNPs areimportant not only in medicine but also in basic molecularbiology as they represent a natural library of variationsthat can be used to elucidate and validate mechanisms of gene expression ... Viprakasit V, Hughes JR, Fisher C, Buckle VJ, Ayyub H,Gibbons RJ, Vernimmen D, Yoshinaga Y, de Jong P, et al. A regula-tory SNP causes a human genetic disease by creating a newtranscriptional...
- 3
- 137
- 0
Báo cáo y học: "Insights in to the pathogenesis of axial spondyloarthropathy based on gene expression profiles" ppt
... the manufacturer's recommendation. Microarrayassays were performed in the Affymetrix Microarray Core, a unit of the OHSU Gene Microarray Shared Resource. TotalRNA was amplified and labeled ... statistical package (Affymetrix, Inc, SantaClara, CA, USA). The GC Robust Multiarray Analysis (GC-RMA) was used to adjust perfect match (PM) probe data for background noise [6]. Normalization ... differentiallyTable 3Individual control subject characteristicsSubject Data-set Gender Race Medications19 1 F Caucasian Alphagan OP, Xalatan OP20 1 F Caucasian _21 1 F Caucasian Atorvastatin,...
- 9
- 333
- 0
Báo cáo y học: "JNK pathway is involved in the inhibition of inflammatory target gene expression and NF-kappaB activation by melittin" ppsx
... Leica Microsystems AG, Wetzlar, Germany)equipped with a 630×oil immersion objective.Statistical analysisData were analyzed using one-way analysis of variancefollowed by Tukey's test as a ... activatesNF-kappaB transcriptional activity independently of IkappaBkinase gamma through a p38 MAPK-dependent RelA phos-phorylation pathway. Cell Signal 2004, 16(9):1023-1032.41. de Haij S, Bakker AC, ... inflammatory diseases such as rheuma-toid arthritis (RA) [15-18].Mitogen activated protein (MAP) kinases are a group ofsignaling molecules that also appear to play importantroles in inflammatory...
- 13
- 388
- 0
Báo cáo y học: " Infection with hepatitis B virus carrying novel pre-S/S gene mutations in female siblings vaccinated at birth: two case reports" pot
... was the oppo-site. HBsAg and anti-HBs were evaluated by commercialradioimmunoassays (AusriaII and Ausab; Abbott Labora-tories, North Chicago, IL). HBeAg and anti-HBe werealso evaluated by ... that they were both positive for HBsAg and nega-tive for anti-HBs. The elder daughter was positive for HBeAg and negative for antibody against hepatitis B eantigen (anti-HBe), while the younger ... hours. After phenol-chloroform extraction,DNA was subjected to polymerase chain reaction (PCR).The primers were P1, TTGGGAACAAGAGCTACAGCATGG (nt. 2837-2860 sense) and P2, GCCTGTTAA-CAGGAAGT...
- 5
- 218
- 0
Báo cáo y học: "Characterization of heterotypic interaction effects in vitro to deconvolute global gene expression profiles in cancer" ppt
... forwardGGAATACCTGAAGCCCTACGAA, reverse CCTGCAGACGT-CACAGATGGT; IFNα, forward CCTCGCCCTTTGCTT-TACTG, reverse GCCCAGAGAGCAGCTTGACT; IFNβ,forward ACCTCCGAAACTGAAGATCTCCTA, reverse TGCT-GGTTGAAGAATGCTTGA). ... concentration of 1× SYBR ®Green PCR Master Mix(ABI, Foster City, CA, USA) and 200 nM of each primer(sequences: GAPDH, forward GAAGGTGAAGGTCGGAGTC,reverse GAAGATGGTGATGGGATTTC; OAS2, forwardGGAATACCTGAAGCCCTACGAA, ... primary can-cers could be a source for distant metastases. An ipsilateralsupra-clavicular recurrence was soon followed by a distantmetastasis in all but one patient. An ipsilateral supra-clavicu-lar...
- 17
- 231
- 0
Báo cáo y học: " The contributions of normal variation and genetic background to mammalian gene expression" ppsx
... 5'-TCCAG-GGAAAACTGCTGACC-3'; Dnase 2a reverse, 5'-AGGAAAAGGCTGTCGGTGG-3'; Apoa4 forward, 5'-AGACAGGTGGTGGGGCAGGAC-3'; Apoa4 reverse, 5'-GCCCTCAGCCCATCACAGCAG-3'; Akr1e1 forward, 5'-CAAGGAGGGCGTGGTGAAGAG-3'; ... 5'-CAAGGAGGGCGTGGTGAAGAG-3'; Akr1e1 reverse, 5'-GCT-GGTGTGACTGGGTATGAC-3'; Cish forward, 5'-GGT-GGGGCACAACATAGAGA-3'; Cish reverse, 5'-GGTGGCCAGACAGACAGGAG-3'; ... 5'-GTCAGCATTCCGGTGGTGTA-3'; Cth forward, 5'-TCTTGCTGCCACCATTACGA-3'; Cth reverse, 5'-GCCTCCAT-ACACTTCATCCAT-3'; Dnase 2a forward, 5'-TCCAG-GGAAAACTGCTGACC-3';...
- 11
- 290
- 0
Báo cáo y học: " Full genome re-sequencing reveals a novel circadian clock mutation in Arabidopsis" doc
... PRR7),Hordeum vulgare subsp. vulgare (AAY17586, PRR), Arabidopsis thaliana(AAY62604, PRR3), Triticum aestivum (ABL09464, PRR), Oryza sativa Indica(BAD38858, PRR 37), Oryza sativa Indica (BAD38859, PRR73), ... was obtainedfrom NASC and plants homozygous for the T-DNAwere confirmed by PCR using primers 5’-ttgccgcagta a- caaaggtac -3’ ,5’-agtttatccggaagcaaatgg-3’ (WT band inCol-0, no band in homozygous ... ebi-1 mutantwas isolated as a plant with a 1.5- to 2-h early peakphase of CAB2 expression in constant dark (Figure 1a) .To clarify whether the early phase was the result ofaltered circadian clock...
- 12
- 264
- 0
Báo cáo y học: " Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in miceg" pdf
... M, Yuan X, Mizuarai S,Kotami H, Yamaoka S, Miyake K, Aoe S, Kamei Y, Ogawa Y: Role of the toll-like receptor 4/NF- kappa B pathway in saturated free fatty acids-induced inflammatory changes ... Healthand Human Sciences, Georgia State University, Atlanta. Presented in part atthe Experimental Biology Annual Meeting, April 2009, New Orleans, LA.Author details1Pathology and Laboratory ... MyD88 and phosphotidylinositol 3-kinase/AKT by saturatedand polyunsaturated fatty acids. J Biol Chem 2003, 278:37041-37051.19. Weatherill AR, Lee JY, Zhao L, Lemay DG, Youn HS, Hwang DH: Saturatedand...
- 7
- 272
- 0
Báo cáo y học: "Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in mice" docx
... M, Yuan X, Mizuarai S,Kotami H, Yamaoka S, Miyake K, Aoe S, Kamei Y, Ogawa Y: Role of the toll-like receptor 4/NF- kappa B pathway in saturated free fatty acids-induced inflammatory changes ... Healthand Human Sciences, Georgia State University, Atlanta. Presented in part atthe Experimental Biology Annual Meeting, April 2009, New Orleans, LA.Author details1Pathology and Laboratory ... proinflammatory markers in macrophages,adipocytes, and liver leading to insulin resistance. Insu-lin resistance is a main pathological abnormality asso-ciated with metabolic syndrome, obesity, and...
- 7
- 238
- 0
Báo cáo y học: "Cytomegalovirus-associated splenic infarcts in a female patient with Factor V Leiden mutation: a case report" docx
... lymphocytes. Atypicallymphocytes were observed on a blood smear. Alaninetransaminase and aspartate transaminase levels weremildly elevated (59 and 64 U per Litre, respectively). Anabdominal ... Weitzman Street, Tel-Aviv 64239, IsraelEmail: Lihi Atzmony - lihi _a@ hotmail.com; Nili Saar - nili.saar@gmail.com; Tamar Chundadze - tamar0102@gmail.com; Yaron Arbel - yaronarbel@gmail.com; Dan ... V Leiden mutation: a case reportLihi Atzmony, Nili Saar, Tamar Chundadze, Yaron Arbel, Dan Justo* and Noa MashavAddress: Department of Internal Medicine D, Tel-Aviv Sourasky Medical Center,...
- 3
- 400
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ