Báo cáo y học: " Warfarin and fibrinolysis - a challenging combination: an observational cohort study" ppt

... 2-2 3%)cardiomyopathy 4 (11%, 4-2 6%)* = median (IQR). PCI = Percutaneous Coronary Intervention, CABG = CoronaryArtery Bypass Graft Surgery.Saarinen et al. Scandinavian Journal of Trauma, Resuscitation and ... complications. Guidelines of Eur-opean Society of Cardiology, American College of Cardi-ology (ACC) and American Heart Association (AHA)consider the use of oral anticoagulants as a relative con-traindication ... collected thedata and has involved in revising the manuscript. JB and TV have givenassistance to analysing the data and have revised the manuscript. HL hascontributed in collecting the data and revising...

Báo cáo y học: "Isotretinoin and psychopathology: a review" potx

... ligands. RAR bindsall-trans retinoic acid and 9-cis retinoic acid, whereas RXRbinds only 9-cis retinoic acid. The RXR receptors can actindependently of ligand, (that is, ligand activation maynot ... Isotretinoin and antidepressant pharmacotherapy: a prescription sequencesymmetry analysis. J Am Acad Dermatol 2003, 49:42 4-4 32.31. Neary MP, Klaskala W, McLane J: Epidemiological study ofadverse ... challenge, de-challenge and re-challenge with the drug and plausibility for a biologicalrole are also important for this association.According to the Diagnostic and Statistical Manual ofMental Disorders...

Báo cáo y học: "Chondroitin and glucosamine sulfate in combination decrease the pro-resorptive properties of human osteoarthritis subchondral bone osteoblasts: a basic science study" pptx

... 5'-GGGTAT-GAGAACTTGGGATT (antisense) and 5'-CACTATTAAT-GCCACCGAC (sense) (RANKL), and 5&apos ;- CAGAACATCATCCCTGCCTCT (antisense) and 5'-GCTT-GACAAAGTGGTCGTTGAG (sense) (glyceraldehyde- 3- phosphate ... data, analysis and interpretation of data, manuscript preparation, and statisticalanalysis. JV and EM participated in study design. DL partici-pated in acquisition, analysis, and interpretation ... data. HF and ML participated in acquisition of data. J-PP participated inanalysis and interpretation of data and manuscript preparation.All authors read and approved the final manuscript.AcknowledgementsThe...

Báo cáo y học: "''''Foot'''' and ''''surgeon'''': a tale of two definitions" doc

... whether - from a medical stand-point - it is reasonable to allow a practitioner treatingthe foot to consider and treat other anatomical systemsthat interact with and affect the foot”,althoughitwasspecified ... The Texan Attorney General concurred, stat-ing that the tibia and fibula are leg bones, not footbones, and as such are beyond the scope of podiatry.The TMA and TOA then filed legal action ... consultant po diatric surgeon’ and ‘podia-tric surgeon’ have bee n used within the National HealthService for over 10 years, and tha t podiatric surgeons areemployed in that capacity, and currently...

Báo cáo y học: "Dantrolene and heatstroke: a good molecule applied in an unsuitable situation" ppsx

... experimental data on animal models.CHS is often compared with other extreme hyperthermiasyndromes such as malignant hyperthermia and neurolepticmalignant syndrome, two situations where dantroleneadministration ... sign (majorhyperthermia), CHS and malignant hyperthermia/neurolepticmalignant syndrome are two distinct entities with only a fewoverlaps concerning heat production mechanisms.CommentaryDantrolene ... (major hyperthermia), classic or environmentalheatstroke and malignant hyperthermia have often been confronted from the therapeutic point ofview. As expected and according to major physiopathological...

Báo cáo y học: "Conflict and health: a paradigm shift in global health and human rights" ppt

... Conflict and Health is open-access and freely available to readers around the world. In the past,human rights workers, lawyers, health professionals and epidemiologists have chosen to work in isolation ... relationship betweenhealth and conflict and evaluate it in an evidence basedepidemiological approach. This journal is part of a grow-ing effort to develop accessible evidence for humanitarianresponses.Conflict ... from Chechnya toUganda to Geneva, and we look forward to receiving yoursubmissions.Competing interestsEJM and SS are Editors-in-Chief of Conflict and Health. JJOis an Editorial Board member...

Báo cáo Y học: Structural and biochemical characterization of calhepatin, an S100-like calcium-binding protein from the liver of lungﬁsh (Lepidosiren paradoxa) docx

... several EF-hands such asCa2+-dependent protein kinases from Arabidopsis thaliana,Zea mays, Glycine max, Dunaliella tertiolecta, Picea mari-ana, Solanum tuberosum, Plasmodium falciparum and ... CancerResearch (Uppsala, Sweden) for MALDI-TOF MS analysis. Weacknowledge S. B. Linskens and E. V. Dacci for amino-acid analysis and sequence determination by Edman degradation. We also thank ... skeletal muscle (lane 2), intestine (lane 3), lung (lane 4),brain (lane 5), adipose tissue (lane 6), heart (lane 7) and skin (lane 8)homogenates and those of rat liver (lane 9) and intestine (lane...

Báo cáo y học: "Eotaxin and FGF enhance signaling through an Extracellular signal-related kinase (ERK)-dependent pathway in the pathogenesis of Eosinophilic Esophagitis" doc

... Statistical comparisons of data among groups were per-formed using the one-way analysis of variance(ANOVA) non-parametric Kruskal-Wallis test and theDunn’s Multiple Comparison post-test. ... Fellowship Award at the StanfordSchool of Medicine and Anup Patel received a fellowship grant from theTissue and Transplant Engineering Award at Stanford School of Medicine.Kari Nadeau received a Institute ... Immunity, Transplantation, and InfectiousDiseases seed grant and a Stanford Digestive Disease Center award. We aregrateful to the nurses in the Ambulatory Procedure Unit for their hard workand...

Báo cáo y học: " Ethnomedicinal and ecological status of plants in Garhwal Himalaya, India" pptx

... 2Nyctaginaceae 1 - - 1Oxalidaceae 1 - - 1Poaceae 2 - - 2Polygonaceae 1 - - 1Ranunculaceae 1 - - 1Primulaceae 1 - - 1Rutaceae - - 1 1Apocynaceae - - 1 1Ericaceae - - 2 2Euphorbiaceae - ... 1Asteraceae 5 - - 5Boraginaceae 1 - - 1Caryophyllaceae 1 - - 1Commelinaceae 1 - - 1Euphorbiaceae 2 - - 2Rosaceae 1 2 2 5Fabaceae 1 1 3 5Gentianaceae 2 - - 2Lamiaceae 6 1 - 7Malvaceae 2 - - ... 2Euphorbiaceae - - 1 1Fagaceae - - 1 1Combretaceae - - 3 3Berberidaceae - 1 - 1Asclepiadaceae - 1 - 1Rubiaceae - 1 - 1Anacardiaceae - 1 - 1Lythraceae - 1 - 1Total 33 10 14 57Kumar et al. Journal of...

Báo cáo y học: "Distribution and correlates of plantar hyperkeratotic lesions in older peo" ppt

... conceived and designed the study. HBMconducted the statistical analysis. MJS compiled the data and drafted the manuscript and HBM contributed to thedrafting of the manuscript. All authors read and approvedthe ... two-step gaitinitiation protocol. The Foot 2004, 14:4 9-5 5.38. Garrow AP, Silman AJ, Macfarlane GJ: The Cheshire foot pain and disability survey: a population survey assessing prevalence and associations. ... area of Sydney, New SouthWales, Australia. These people were randomly drawnfrom the state electoral roll and initially contacted by let-ter and asked to participate in the study. Individuals wereinvited...

Xem thêm

Từ khóa: báo cáo y học báo cáo y học cổ truyền mẫu báo cáo y học cổ truyền bao cao y hoc colchicin phan ban luan trong bao cao y hoc co truyen báo cáo khoa học nhân giống vô tính cây saintpaulia bằng phương pháp invitro ppt báo cáo khoa học y học báo cáo y tế học đường mẫu báo cáo y tế học đường báo cáo y tế học đường cuối năm báo cáo y tế học đường năm 2012 báo cáo y tế học đường trường mầm non biểu mẫu báo cáo y tế trường học báo cáo y tế học đường trường tiểu học báo cáo y tế trường tiểu học Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015