Báo cáo y học: " Effects of tender point acupuncture on delayed onset muscle soreness (DOMS) – a pragmatic trial " potx
Báo cáo y học: " Effects of tender point acupuncture on delayed onset muscle soreness (DOMS) – a pragmatic trial." potx
... acupuncture stimulation of tender points may activate sensitized polymodal-type receptorsthereby relieving pain. In clinical practice, acupuncture treatment may be effective on myofascial pain ... CentralPage 1 of 5(page number not for citation purposes)Chinese MedicineOpen AccessResearch Effects of tender point acupuncture on delayed onset muscle soreness (DOMS) – a pragmatic trial Kazunori ... transcuta-neous electrical nerve stimulation; Non-TeP: non -tender point; TeP: tender point; VAS: visual analog scale;ANOVA: analysis of varianceCompeting interestsThe authors declare that they have...
- 5
- 339
- 0
Báo cáo y học: " Effects of CYP2B6 G516T polymorphisms on plasma efavirenz and nevirapine levels when co-administered with rifampicin in HIV/TB co-infected Thai adults" ppt
... Gatanaga H, Hayashida T, Tsuchiya K, Yoshino M, Kuwahara T, Tsukada H,Fujimoto K, Sato I, Ueda M, Horiba M, Hamaguchi M, Yamamoto M,Takata N, Kimura A, Koike T, Gejyo F, Matsushita S, Shirasaka ... Anekthananon T, Burapat C, Akksilp S, Mankhatitham W, Srinak C,Nateniyom S, Sattayawuthipong W, Tasaneeyapan T, Varma JK: Causes of death in HIV-infected persons who have tuberculosis, Thailand. ... plate was read by the allelic discriminat ion settings.The SNP assay was set up using SDS, version 1.3.0 asan absolute quantification assay. Post-assay analysis wasdone by using SDS software.Determination...
- 10
- 457
- 0
Báo cáo y học: "Effects of evening light conditions on salivary melatonin of Japanese junior high school students" ppsx
... rhythm and sleep-wake cycle. Effects of light condition on salivary melatonin concentrationFigure 1 Effects of light condition on salivary melatonin concentration. Values shown are means (n = ... conditions on salivary melatonin of Japanese junior high school studentsTetsuo Harada*Address: Laboratory of Environmental Physiology, Faculty of Education, Kochi University, Kochi 780-8520, JapanEmail: ... collection tubesat 21:45, 22:30, and 23:40, and these salivary samplingswere preserved in a refrigerator at less than -20°C. Mela-tonin concentration in the samples was analyzed by a pro-fessional...
- 5
- 404
- 0
Báo cáo y học: " Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts" pdf
... Reduction of endogenous kynurenic acid formationenhances extracellular glutamate, hippocampal plasticity, and cognitivebehavior. Neuropsychopharmacology 35(8):1734-1742.17. Laugeray A, Launay JM, ... this article as: Asp et al.: Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermalfibroblasts. Journal of Inflammation 2011 8:25.Submit your next manuscript ... 8:25http://www.journal-inflammation.com/content/8/1/25Page 7 of 7RESEARCH Open Access Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes inhuman dermal fibroblastsLinn a Asp1,...
- 7
- 457
- 0
Báo cáo y học: "Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts" pot
... GGACGTTCTGTTTGAGAAGTGGTTAnti-sense AGCTGAAGAACTCCTGGATGATGKAT1 CCBL1 Sense CCTGCTAAGGCTCAGGTATAACCTAnti-sense GGACTCAAGCCTAAAGGCAACTCKAT2 AADAT Sense CACATCTGGCAGCCAACAAGAnti-sense CACTGGCAACATTAATAATGTTGCAKAT3 CCBL2 ... Sense GAACATCTTTTTATCATAACTCATCAAGCTAnti-sense ACAACCTTAAGCATGTTCCTTTCATKMO KMO Sense TGTAATCCTCCAAGCTTCAATCTGAnti-sense CTAGTAGATGCCCACTGAATATTTGTGHAAO HAAO Sense GGACGTTCTGTTTGAGAAGTGGTTAnti-sense ... Sense ACTATCAGCCATCCCCGTTTCAnti-sense AATGAAGCAAAAACGCACAAACTKAT4 GOT2 Sense TGTGGTGTGCAGCCTCTCATAnti-sense AAGCCTGAACCCAGCTAGCAKYNU KYNU Sense ACAGGATCTGCCTCCAGTTGAAnti-sense TGGCCCACTTATCTAGTTCTTCTTCQPRT...
- 7
- 360
- 0
Báo cáo y học: " Effects of supplemental fish oil on resting metabolic rate, body composition, and salivary cortisol in healthy adults" ppsx
... Kobayashi H, Ashakumary L, Rouyer IA, Takahashi Y, Aoyama T,Hashimoto T, Mizugaki M: Comparative effects of perilla and fish oils on the activity and gene expression of fatty acid oxidation ... andmanuscript preparation. JB contributed with data analysis, statistical analysis,and manuscript preparation. All authors have read and approved the finaldraft of this manuscript.AcknowledgementsFunding ... mucinsand analyzed for cortisol concentration using a commer-cially available enzyme immunoassay kit (Salimetrics,State College, PA, USA). Salivary cortisol is a sensitivemarker of activation...
- 7
- 472
- 0
Báo cáo y học: "Effects of lifestyle physical activity on perceived symptoms and physical function in adults with fibromyalgia: results of a randomized trial" pdf
... Fibromyalgia Impact Questionnaire; FM: fibromyalgia; FME:Fibromyalgia Education Control Group; FSS: Fatigue Severity Scale; LPA:lifestyle physical activity; SD: standard deviation; VAS: Visual Analogue ... hampers day-to-day functioning and is a primary cause of disability [5].Even with the recent Food and Drug Administrationapproval of medications to treat FM, pharmacotherapygenerally produces ... effects of LPA on ambulatory reports of physical activity, pain and fatigue, as well as measures of fitness, pain threshold and pain tolerance, we also col-lected questionnaire-based data on these...
- 9
- 381
- 0
Báo cáo y học: " Effects of cigarette smoke condensate on proliferation and wound closure of bronchial epithelial cells in vitro: role of glutathione" pdf
... presentstudy. In addition to the MAPK pathway, the Akt/PI-3kinase pathway may play an important role in CSC-induced epithelial cell proliferation. Finally, a stimulatoryeffect of aged suspended ... Cavallesco G, Papi A, Fabbri LM: Goblet cell hyperplasiaand epithelial inflammation in peripheral airways of smokerswith both symptoms of chronic bronchitis and chronic air-flow limitation. ... West KA, Brognard J, Clark AS, Linnoila IR, Yang X, Swain SM, HarrisC, Belinsky S, Dennis PA: Rapid Akt activation by nicotine and a tobacco carcinogen modulates the phenotype of normalhuman airway...
- 12
- 354
- 0
Báo cáo y học: "Effects of redox cycling compounds on DT diaphorase activity in the liver of rainbow trout (Oncorhynchus mykiss)" doc
... M-1cm-1).Protein content was determined using the BCA ProteinAssay Kit (Pierce, USA), with BSA as standard.Statistical analysisData were analyzed with one-way analysis of variance(ANOVA) and, following ... Kg-1) also caused increased DTD activity after5 days (Table 1).Among the monofunctional inducers studied MN was theonly one to cause a significant increase in DTD activityafter 2 days (Table ... investigated.Results: In rainbow trout, hepatic DTD activity is induced by the bifunctional AHR agonists β-NFand B (a) P and the monofunctional inducers naphthazarin, menadione and paraquat. Althoughexposure...
- 8
- 324
- 0
Báo cáo y học: "Effects of interventional lung assist on haemodynamics and gas exchange in cardiopulmonary resuscitation: a prospective experimental study on animals with acute respiratory distress syndrome" pdf
... effects of CPR on circulation and gas exchange with or without an ILA deviceoperating in animals with ARDS.Before initiation of resuscitation all animals had a severeARDS and a stable haemodynamic ... the analysis and interpretation of the data and revisedthe manuscript. NW conceived the study and participated inthe design of the study, analysis and interpretation of data andrevision of the ... strategy. This is achieved mainly byan extracorporeal CO2 elimination and possibly sustained by a small oxygenation effect generated by an arteriovenous shuntthrough an artificial membrane.In...
- 6
- 338
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP