0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Down-regulation of kallikrein-related peptidase 5 (KLK5) expression in breast cancer patients: a biomarker for the differential diagnosis of breast lesions" doc

Báo cáo y học:

Báo cáo y học: "Down-regulation of kallikrein-related peptidase 5 (KLK5) expression in breast cancer patients: a biomarker for the differential diagnosis of breast lesions" doc

... the data.AS participated in the conception and design of the study, the analysis and the interpretation of the data, the statistical analysis and supervised the study.All authors read and approved ... CLINICALPROTEOMICSDown-regulation of kallikrein-related peptidase 5 (KLK5) expression in breast cancer patients: a biomarker for the differential diagnosis of breast lesionsAvgeris et al.Avgeris ... contributionsMA participated in the conception and design of the study, the acquisition, the analysis and the interpretation of the data, the statistical analysis and drafted the manuscript.GP participated...
  • 12
  • 340
  • 0
Báo cáo y học:

Báo cáo y học: " Downregulation of peroxisome proliferator-activated receptors (PPARs) in nasal polyposis" pps

... NT00 759 2 forward GCACATCTACAATGCCTACCTGAAreverse CTCGATGTCGTGGATCACAAAPPARγ NM0 050 37 forward AAGTTCAATGCACTGGAATTAGATGAreverse TGTAGCAGGTTGTCTTGAATGTCTTCβ-actin NM001101 forward GCCAACCGCGAGAAGATGreverse ... butonly staining that reached a certain level of intensity.Statistical analysisAll data sets were analysed by Kolmogorov Smirnov testand since the data for PCR expression predominantly notwas ... mediators also appear to be involved in nasal polyposis [7]. In addition, there is an emergingconcept that anti-inflammatory pathways affect the out-come of inflammatory diseases, including those in...
  • 8
  • 178
  • 0
Báo cáo y học:

Báo cáo y học: " Outcome of left heart mechanical valve replacement in West African children - A 15-year retrospective study." pdf

... underlying etiology is non-rheumatic may portend a somewhat higher mortality.They showed a survival of 73% at 1 year and 65% at 5, 10, and 15 years. The youngest patient in our study was6 years ... mortality was 5. 3% (6 patients, Table4); late mortality occurred in 6 patients (Table 5) at a linearized rate of 0.67% per patient-year. The actuarialsurvival was 98.1% at 1 year, 97.0% at 5 years, ... was 3. 25 ± 3 .50 years. At presentation of PVT, the INR was less than 2 .5 in 54 % of their patients, withinadequate anticoagulation management in 26% andpoor compliance in another 26%. Two of...
  • 8
  • 538
  • 0
Báo cáo y học:

Báo cáo y học: "Development of recurrent facial palsy during plasmapheresis in Guillain-Barré syndrome: a case report" pdf

... developed ascendingmotor weakness and laboratory findings consistent with a diagnosis of Guillain-Barré syndrome. Plasmapheresis wasinitiated. Acute facial palsy developed during the plasma exchange ... recognizedas a heterogeneous syndrome, different variants existincluding demyelinating and axonal forms; the demyeli-nating variant is most common in the USA. Based onconsiderable clinical trial ... the dayafter this second round of plasmapheresis, though the remainder of his facial paralysis persisted.Because of the association of recurrent acute facialweakness during plasmapheresis, the...
  • 4
  • 348
  • 0
Báo cáo y học:

Báo cáo y học: "Role of positron emission tomography-computed tomography in bronchial mucoepidermoid carcinomas: a case series and review of the literature" pdf

... conceived the study and made a major contribution in the compilation,analysis, literature review and formatting of the manuscript, AK had a majorcontribution in the analysis and editing, RK helped in ... clin-ical parameters and other details are given in Table 1.Case 1 A 14-year-old Caucasian girl presented with a one-yearhistory of cough and gradually progressive dyspnea. Onclinical examination, ... Tumours of salivary gland type. Tumours of the lower respiratory tract. AFIP Atlas of Tumour Pathology Washington,DC: American Registry of Pathology 19 95, 13: 65- 89, 3rd series.2. Lee EY, Vargas...
  • 4
  • 210
  • 0
Báo cáo y học:

Báo cáo y học: "Effectiveness of electronic guideline-based implementation systems in ambulatory care settings - a systematic review" pot

... setting andcharacteristics may be different from everyday practice. The characteristics of the healthcare system in each coun-try (e.g., financing systems) may also be important whengeneralising ... negatively for the criterion 'blinded assessment of primary outcomes'Another source of bias may be the non-blinding of the healthcare providers. Because of the nature of the inter-vention, ... present the right information, in the right format, at the right time without requiring specialeffort. Tedious additional data entry, an overwhelmingamount of feedback [ 15, 35] , software or hardware...
  • 12
  • 361
  • 0
Báo cáo y học:

Báo cáo y học: " Development of recurrent facial palsy during plasmapheresis in Guillain-Barré syndrome: a case report" pot

... dysgeusia, and an obviousfacial droop appeared. The remainder of his neurologicalexamination, including contralateral facial strength,remained unchanged. A brain magnetic resonance ima-ging ... though the remainder of his facial paralysis persisted.Because of the association of recurrent acute facialweakness during plasmapheresis, the therapy was dis-continued and a decision was made ... tracheotomy. He was discharged onday 46 in a stable condition to an acute rehabilitationfacility. At that point he had mild facial weakness, wasable to symmetrically produce a small smile and couldfully...
  • 4
  • 329
  • 0
Báo cáo y học:

Báo cáo y học: "Universality of interpersonal psychotherapy (IPT) problem areas in Thai depressed patients" pptx

... subscale of an interpersonalproblem area indicates a problem in adjusting in thatarea. The total range of scores for each problem areawas divided into 3 intervals. The scores indicating the subjects’ ... problem areas were the scores above the sec-ondintervalthatwerecompatiblewiththeproblemareas diagnosed by the clinical interview. A statistical analysis was performed by using STATA for Windows ... tobe caused by both biological and psychosocial factors.Interpersonal psychotherapy (IPT), developed byKlerman and Weissman and based on the interperso-nal theory of Adolf Meyer and Harry Stack...
  • 7
  • 321
  • 0
Báo cáo y học:

Báo cáo y học: " Profiles of cytokine and chemokine gene expression in human pulmonary epithelial cells induced by human and avian influenza viruses" doc

... S, Fujii A, Takamatsu Y, Nakashima M, Watanabe T, Kawahara K, et al: Differential chemokine,chemokine receptor, cytokine and cytokine receptor expression in pulmonary adenocarcinoma: diffuse ... hadcaused disease outbreaks in chicken, ducks and pigs in many parts of the world including China, Germany,Hong Kong, Indonesia, Iran, Ireland, Israel, Italy, Jordan,Pakistan, Saudi Arabia, ... respiratory epithelial cells are the primary targets for HPAIV and LPAIV infections [23- 25] . In response toHPAIV and LPAIV, these cells are likely to play a criti-cal role in inflammatory response, and...
  • 9
  • 338
  • 0
Báo cáo y học:

Báo cáo y học: " Activation of tumor necrosis factor receptor 1 in airway smooth muscle: a potential pathway that modulates bronchial hyper-responsiveness in asthma?" ppsx

... findingsbecause changes in ASM phenotype induced by cytokinesmay play a role in the airway remodeling and bronchialhyper-responsiveness that is observed in asthma. A betterunderstanding of ... likely lead to new therapeu-tic approaches in the management of asthma. In ASMcells, activation of TNFR1 coupled to the TRAF2–NF-κBpathway ‘primes’ airway myocytes to augment calciumsignals in ... remain unclear. In rat myocytes and NIH3T3 fibroblasts, however, emptying internal calcium storesinhibits protein synthesis by acting at the level of translationinitiation through the inactivation...
  • 5
  • 223
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyen1994 effects of fadrozole cgs 16949a and letrozole cgs 20267 on the inhibition of aromatase activity in breast cancer patients breast cancer res treat 30 1 p95 102Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ