Báo cáo khoa học: "opeptin, a novel prognostic biomarker in ventilator-associated pneumonia" ppsx
Báo cáo khoa học: "opeptin, a novel prognostic biomarker in ventilator-associated pneumonia" ppsx
... pneumonia patients on day 4: univariable and multivariable logistic regression analysisParameter Univariable analysis Multivariable analysisOdds ratio (95% confidence interval)P value Odds ratio ... prediction in ventilator-associated pneumonia patientsReceiver operating characteristic analysis of copeptin with respect to mortality prediction in ventilator-associated pneumonia patients. Data on ... creatinine, total bilirubin, and albumin were obtained bythe time VAP was suspected (D0) and were repeated on thefourth day of treatment (D4). Quantitative endotracheal aspi-rate (QEA) was obtained...
- 9
- 252
- 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... antisense AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts ... Journal compilation ª 2009 FEBSTransLISA, a novel quantitative, nonradioactive assayfor transcription factor DNA-binding analysesKristiina A. Vuori1, Johanna K. Ahlskog2, Lea Sistonen2and ... simultaneous binding of allDNA-binding domains in a trimer to three adjacentnGAAn repeats. Therefore, a functional HSE containsat least three nGAAn repeats. The promoters of mostHsp genes contain...
- 9
- 457
- 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf
... 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,andPDE1(Lys321–Thr620) was amplified with primers 5¢-GGGAATTCCATATGAAGAATGATCAATCTGGCTGCGGCGCAC-3¢ ... causes the fatalhuman sleeping sickness, as well as Nagana, a devastatingdisease of domestic animals in large parts of sub-SaharanAfrica. While many aspects of trypanosome cell biologyhave been ... original Kozaksequence 5¢-CTAAAC-3¢ and a start codon. The completeTbPDE1 ORF was expressed either containing a His6tagat its N terminus, or a His6tagfollowedbyahaemag-glutinin tag to facilitate...
- 11
- 566
- 0
Báo cáo khoa học: Phaiodotoxin, a novel structural class of insect-toxin isolated from the venom of the Mexican scorpion Anuroctonus phaiodactylus pdf
... andmammalian Na+channels. Accordingly, they are dividedinto classical a- toxins that are highly active in mammalianbrain, a- toxins that are very active in insects and a- liketoxins that are active ... phaiodotoxinThe amino acid sequence o f the N-terminal portion ofphaiodotoxin was obtained by Edman degradation carriedout with an automatic apparatus Beckman LF 3000 Pro-tein Sequencer (Palo Alto, ... from poly (A) + mRNA u sing M-MLV reverse tran-scriptase. The cDNA was joined with the a daptor providedby the kit (5 ¢-gcugauggcgaugaaugaacacugcguuugCUGGCUUUGAUGAAA-3¢) using T4 DNA ligase. The...
- 9
- 533
- 0
Báo cáo khoa học: Brox, a novel farnesylated Bro1 domain-containing protein that associates with charged multivesicular body protein 4 (CHMP4) potx
... Bro1domain-containing protein with a thioester-linkage siteof isoprenoid lipid (CAAX motif, C standing for cys-teine, A for generally aliphatic amino acid, and X forany amino acid)] in this article, ... University, JapanAlix (also named AIP1) is an interacting partner of thepenta-EF-hand Ca2+-binding protein, ALG-2 [1–5],and acts as a multifunctional adaptor protein in vari-ous cellular functions ... lipid(CAAX motif) (C standing for cysteine, A for generally aliphatic aminoacid, and X for any amino acid). Mammalian Alix and its yeast ortholog,Bro1, are known to associate with charged multivesicular...
- 11
- 412
- 0
Báo cáo khoa học: Plasmoredoxin, a novel redox-active protein unique for malarial parasites doc
... Kawazu, S., Tsuji, N., Hatabu, T., Kawai, S., Matsumoto, Y. &Kano, S. (2000) Molecular cloning and characterization of a peroxiredoxin from the human malaria parasite Plasmodium fal-ciparum. ... tertianmalaria in man.Interestingly, two similar sequence annotations (Gen-Bank accesson numbers, NP_473166 and CAB38989) wereavailable that proposed a large protein of 2417 and 2396amino acids, ... superfamily andshare structural and functional characteristics. In the mal-arial parasite, Plasmodium falciparum, a functional thio-redoxin and glutathione system have been demonstratedand are considered...
- 8
- 412
- 0
Báo cáo khóa học: Characterization of novel structural features in the lipopolysaccharide of nondisease associated nontypeable Haemophilus influenzae pptx
... structural data has been available on LPSglycoform patterns from H. in uenzae strains that were notassociated with disease. Structural studies have revealed thatevery NTHi strain investigated ... HepIII.Additionally, both strains express glycine, and strain 11 alsoexpresses detectable amounts of N-acetylneuraminic acid.Keywords: carriage; ESI-MS; Haemophilus in uenzae;lipopolysaccharide; NMR.Acapsular ... lipopolysaccharide (LPS) is an essential andcharacteristic surface component of H. in uenzae and isimplicated as a major virulence factor. H. in uenzae elab-orates short-chain LPS which lacks...
- 13
- 411
- 0
Báo cáo khoa học: "Coexistence of carcinoma and tuberculosis in one breast" ppsx
... within the paratracheal, internalmammary, or axillary nodal basin [9]. Histologically, TMcan be classified into nodular which mimics carcinoma;disseminated which causes caseation and sinus ... ultrasound with some cortical thickening at its distal pole suggesting focal metastasis.Infiltrating ductal carcinoma in the lower half of the field with two epithelioid granulomata containing ... Alzaraa* - ahmedwahabf@gmail.com; Neha Dalal - neha.dalal@tgh.nhs.uk* Corresponding author AbstractBackground: The coexistence of breast cancer and tuberculosis is very rare. This can create...
- 4
- 266
- 0
Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf
... ATTCCCGGGTAATTTTTCCAAGTTAAATTACTTG SmaIrFnBPB163–308F GGGGGATCCGGTACAGATGTAACAAATAAAG BamHIrFnBPB163–308R CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA SmaIrFnBPB309–480F CCCGGATCCTATTTAGGTGGAGTTAGAGATAAT ... (5¢–3¢) a, b5¢ restriction siterFnBPB37–480F CGGGGATCCGCATCGGAACAAAACAATAC BamHIrFnBPB37–480R AATCCCGGGTTACTTTAGTTTATCTTTGCCG SmaIrFnBPB163–463F GGGGGATCCGGTACAGATGTAACAAATAAAG BamHIrFnBPB163–463R ... CCCGGATCCTATTTAGGTGGAGTTAGAGATAAT BamHIrFnBPB309–480R AATCCCGGGTTACTTTAGTTTATCTTTGCCG SmaIrFnBPB163–480NF F GAATTATCTTTAGCTCTAGCTATTGATCCrFnBPB163–480NF F GGATCAATAGCTAGAGCTAAAGATAATTCFnBPB(–142–480)F...
- 13
- 514
- 0
Từ khóa: Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015