Báo cáo y học: "Human cyclin T1 expression ameliorates a T-cell-specific transcriptional limitation for HIV in transgenic rats, but is not sufficient for a spreading infection of prototypic R5 " ppt
Báo cáo y học: "Human cyclin T1 expression ameliorates a T-cell-specific transcriptional limitation for HIV in transgenic rats, but is not sufficient for a spreading infection of prototypic R5 " ppt
... T-cell-specific transcriptional limitation for HIV in transgenic rats, but is not sufficient for a spreading infection of prototypic R5 HIV- 1 strains ex vivoNico Michel1,5, Christine Goffinet1, ... was only 10% of that of human references [10], indicating that the transcriptional deficit also in this rodent had only partially been over-come by hCycT1 transgenesis. Of note, this analysisrequired ... gene expression in this primary cell type, and already macro-phages from n-tg rats are at a level comparable to humanMDM. This may, in part, relate to the ability of HIV- 1 toexploit a distinct...
- 19
- 263
- 0
Báo cáo y học: "Human meniscus cells express hypoxia inducible factor-1α and increased SOX9 in response to low oxygen tension in cell aggregate culture" ppsx
... CTTGTTTACAGTCTGCTCA-AAATATCTTP4Hα(I) Forward 5'-3' GCAGGGTGGTAATATTGGCATTReverse 5'-3' AAATCAATTCCCTCATCACTGAAAG,P4Hα(II) Forward 5'-3'TTAGCTGTCTAGCGCCTAGCAAReverse ... AGCTTCTGTGGAACCATGGAACOL 2A1 Forward 5'-3' CTGCAAAATAAAATCTCGGTGTTCTReverse 5'-3' GGGCATTTGACTCACACCAGTHIF-1α Forward 5-3' GTAGTTGTGGAAGT-TTATGCTAATATTGTGTReverse 5'-3' ... 5'-3'TGTTTTACAGCTGGTTAATGTG-TTGASOX9 Forward 5'-3'CTTTGGTTTGTGTTCGTGTTTTGReverse 5'-3'AGAGAAAGAAAAAGGGAAAGGTAAGTTTCOL 1A2 , collagen type I alpha 2; COL 2A1 , collagen...
- 9
- 356
- 0
Báo cáo y học: "Human articular chondrocytes express 15-lipoxygenase-1 and -2: potential role in osteoarthritis" pdf
... Shankaranarayanan P, Chaitidis P, Kuhn H, Nigam S: Acetylationby histone acetyltransferase CREB-binding protein/p300 of STAT6 is required for transcriptional activation of the 15-lipox-ygenase-1 ... CAA AC-3' and antisense 5'-GCC CATCAA ATG GGT AGA AG-3'; and glyceraldehyde-3-phosphatedehydrogenase (GAPDH), sense 5'-CAGAACATCATCCCT-GCCTCT-3' and antisense 5'-GCTTGACAAAGTGGTCGTT-GAG-3'.Quantitative ... (Sigma) for 20 minutes,the samples were centrifuged and the supernatants assayed for type II collagen degradation using a C2C ELISA kit (IBEX,Montreal, Quebec, Canada).Statistical analysisData...
- 12
- 771
- 0
Báo cáo y học: "Human metapneumovirus induces more severe disease and stronger innate immune response in BALB/c mice as compared with respiratory syncytial virus" pps
... Plethysmograph readings were recorded again todetermine AHR. Groups of infected and control mice werealways evaluated in parallel.Analysis of cellular lung infiltratesPulmonary inflammatory ... Human metapneumovirus (HMPV) and respiratory syncytial virus (RSV) are members of thePneumovirinae subfamily of Paramyxoviridae and can cause severe respiratory disease, especially in infants and ... http://respiratory-research.com/content/8/1/6Page 8 of 10(page number not for citation purposes)Characterization and functional analysis of BAL cells after HMPV or RSV infectionFigure 4Characterization and functional analysis of BAL...
- 10
- 271
- 0
Báo cáo y học: "Human immunodeficiency virus integrase inhibitors efficiently suppress feline immunodeficiency virus replication in vitro and provide a rationale to redesign antiretroviral treatment for feline AIDS" pdf
... feline AIDSAndrea Savarino*1, Mauro Pistello2, Daniela D'Ostilio1, Elisa Zabogli2, Fabiana Taglia1, Fabiola Mancini1, Stefania Ferro3, Donatella Matteucci2, Laura De Luca3, ... Viale Annunziata, 98168 Messina, ItalyEmail: Andrea Savarino* - andrea.savarino@iss.it; Mauro Pistello - pistello@biomed.unipi.it; Daniela D'Ostilio - danieladostilio@hotmail.it; Elisa Zabogli ... Zabogli - elisazabogli@biomed.unipi.it; Fabiana Taglia - fabiana.taglia@gmail.com; Fabiola Mancini - fabiola.mancini@iss.it; Stefania Ferro - sferro@pharma.unime.it; Donatella Matteucci - domatt@biomed.unipi.it;...
- 13
- 309
- 0
Báo cáo y học: "Barriers to access prevention of mother-to-child transmission for HIV positive women in a well-resourced setting in Vietnam" pptx
... prophylaxis atall and 14 were only given the treatment at the time of labour (Table 2).One reason for this disappointing record was that in manyhealth care facilities, the ARV was not consistently ... YPNcarried out the data collection and the data analysis. PWconceived of the study and participated in its design andcoordination. AH participated in the study design, thedata analysis, and ... testing Counselling Abortion ARV prophylaxis for mother Safe delivery and post-delivery care ARV prophylaxis for child Formula feeding Stigma and discrimination - Not available...
- 12
- 368
- 0
Báo cáo y học: " “The non-ischemic repair” as a safe alternative method for repair of anterior post-infarction VSD" pptx
... Renzulli A, Cotrufo M: Determinants and prognosis of myocardial damage aftercoronary artery bypass grafting. Ann Thorac Surg 2005, 79:837-45.9. Weisel R: Myocardial protection during for mechanical ... perform the necessary distal coronaryanastomoses and subsequently the proximal by partialclamping of the aorta (for the cases with more than onegraft). After completion of the proximal anastomosesthe ... defects.Semin Thorac Cardiovasc Surgery 1998, 10:117-27.6. Gummert J, Borger M, Rastan A, Mohr F: Beating heart coronary arterybypass in patients with acute myocardial infarction: a new strategy toprotect...
- 4
- 369
- 0
Báo cáo y học: "Serum cystatin C concentration as a marker of acute renal dysfunction in critically ill patients" doc
... (CCr)Relationships of (a) serum creatinine and (b) serum cystatin C to creatinine clearance (CCr).Figure 2The (a) inverse of serum creatinine (1/creatinine) and the (b) inverse of cystatin C (1/cystatin ... increase as GFRdecreases. All of these factors explain why serum creatinineconcentration may not be a good parameter for accuratedetermination of GFR, especially at lower rates [1].Cystatin ... cystatin C is a good marker for application in real time, andsuggests that serum cystatin C is a better marker of GFR than is serum creatinine in unstable, critically ill patients (20% of patients...
- 5
- 224
- 0
Báo cáo y học: " Coupling of receptor interference and a hostdependent post-binding entry deficiency in a gammaretroviral envelope protein" doc
... containing envelopes from SL3-2 or its mutants we find that the same amino acid mutationscan dramatically alter the interference profile of this polytropic ENV, suggesting that the same amino acid ... 1990,64:6176-83.33. Bahrami S, Jespersen T, Pedersen FS, Duch M: Mutational library analysis of selected amino acids in the receptor binding domain of envelope of Akv murine leukemia virus by conditionally replication ... murine gammaretroviral isolate that is only able to infect murine cells.We have previously shown that two mutations R212G and T213I located on the surface of the receptor bindingdomain in a region...
- 7
- 212
- 0
Báo cáo y học: "The renal metallothionein expression profile is altered in human lupus nephriti" doc
... nonenzymatic polypeptides of 6 to7 kDa that bind heavy metals with high affinity and possess a range of anti-inflammatory properties [6]. Due to a highAASV = antineutrophil cytoplasmic autoantibody-associated ... unchanged scoringweights), and a urinary sediment analysis. The urinary sedi-ment was considered indicative of active renal disease if anal-ysis showed cellular or granular casts or > 5 erythrocytes ... study. MF analyzed the immuno-histochemically stained slides, performed the data analysis,and prepared the manuscript. MP performed the immunohisto-chemistry assays and contributed to the analysis...
- 9
- 331
- 0
Từ khóa: chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015