Báo cáo khoa học: " Bench-to-bedside review: Endotoxin tolerance as a model of leukocyte reprogramming in sepsis" pot
Báo cáo khoa học: " Bench-to-bedside review: Endotoxin tolerance as a model of leukocyte reprogramming in sepsis" pot
... Minoda Y, Takaki H, Sanada T,Kobayashi T, Aburatani H, Yamanashi Y, Yoshimura A: FLN29, a novel interferon- and LPS-inducible gene acting as a negativeregulator of toll-like receptor signaling. ... Shinohara H, Inoue A, Toyama-Sorimachi N, Nagai Y, Yasuda T,Suzuki H, Horai R, Iwakura Y, Yamamoto T, Karasuyama H, et al.:Dok-1 and Dok-2 are negative regulators of lipopolysaccha-ride-induced ... themechanism of endotoxin tolerance in a rat alveolar macro-phage cell line. Tolerance, monitored by cytokine production,was associated with an impaired activation of NF-κB and a depletion of both...
- 8
- 210
- 0
Báo cáo khoa học: "Clinical review: Moral assumptions and the process of organ donation in the intensive care unit" pptx
... Rocheleau CA: Increasing family consent for organ donation:findings and challenges. Prog Transplant 2001, 11:194-200.28. Siminoff LA, Arnold RM, Caplan AL: Health care professionalattitudes toward ... donation in braindead pediatric trauma victims. J Trauma 2001, 51:329-331.30. Linyear AS, Tartaglia A: Family communication coordination: a program to increase organ donation. J Transplant Coord ... ensuring quality and integrity of organ donation practices in the ICU. These practices include humane andcompassionate patient care, the avoidance of suffering, themaintenance of dignity and...
- 7
- 361
- 1
Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx
... this strainand the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added phenylalanine and tyrosinereports on the chorismate mutase activity ... dehydrogenase protein com-plexes were replaced by genes encoding monofunctionalversions of the dehydratase and the dehydrogenase. Thegrowth of this strain on minimal media lacking phenyl-alanine and ... without chan-ging the overall reaction [50]. A rationally designed variant of L-Ala-D/L-Glu epimerase (a third member of the enolase superfamily, Fig. 8),containing a mutation (D297G) analogous...
- 8
- 635
- 0
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot
... muscleremodelling in skeletal muscle.AbbreviationsAAV2/1, adeno-associated virus 2/1; Ankrd2, ankyrin repeat domain-containing protein 2; CARP, cardiac ankyrin repeat protein; DAPI,4¢,6-diamidino-2-phenylindole; ... TGTTGTCGTGTGCTGGGATTMLC-f Myosin light chain, fast BC055869 396mMLCfast.F: TGGAGGAGCTGCTTACCACG423mMLCfast.P: ACCGATTTTCCCAGGAGGAGATCAAGAA500mMLCfast.R: TCTTGTAGTCCACGTTGCCGMLC-2v Myosin light chain, ... allconstructs was confirmed by automated sequencing.AAV2/1 viral preparations were generated by packagingAAV2-inverted terminal repeat recombinant genomes in AAV1 capsids using a three-plasmid transfection...
- 16
- 428
- 0
Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx
... tyro-sine kinase activates several signalling pathways, includ-ing the ERK1 ⁄ 2 pathway, the PKB pathway and theJanus kinase ⁄ signal transducer and activator of tran-scription (JAK-STAT) pathway, ... signal-regu-lated kinase kinase 1 ⁄ 2 kinases: mechanism of action in vivo, pharmacokinetic ⁄ pharmacodynamic relationship,and potential for combination in preclinical models.Mol Cancer Ther 6, 2209–2219.41 ... Journal compilation ª 2009 FEBSproviding a rationale for the use of combinations of MEK1 ⁄ 2 inhibitors and PI3K–PKB pathway inhibitors.Indeed, rapamycin, an inhibitor of mammalian target of rapamycin...
- 13
- 453
- 0
báo cáo khoa học: "The transplant iron score as a predictor of stem cell transplant survival" pptx
... IronScore. Based on these groupings, a univariate relative risk of death was calculated for each iron parameter using haz-ard regression analysis.Survival time was measured from the date of transplant ... in early survival was primarilydue to an increased number of treatment related deaths (p= 0.018) (Figure 2B). Meanwhile, iron overload was notassociated with a significant increase in relapse ... than any available single iron parameter. In multivariate analysis, weobserved an independent effect of iron overload on transplant survival (p = 0.01) primarilyattributable to an increase in...
- 9
- 320
- 0
Báo cáo khoa học: "Serum neuron-specific enolase as early predictor of outcome after in-hospital cardiac arrest: a cohort study" ppsx
... consciousif awake or capable of following simple commands at leastonce.Statistical analysisContinuous data are presented as means and SD, and nonpar-ametric data as medians and interquartile range. ... purpose.Neuron-specific enolase (NSE) is a known marker of ischemicbrain damage and has already been evaluated in traumaticbrain injury [10], stroke [11] and anoxic encephalopathy aftercardiac arrest [12,13]. ... arrest are markers of ischemic brain damageand of unfavorable outcome. NSE levels measured early in thecourse of brain injury were significantly higher in patients withTable 1Baseline characteristics...
- 6
- 391
- 0
Báo cáo sinh học: "An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" pptx
... will aid in assessing the translational potential of ideas that arestill in the percolation phase.The NIH intramural program is an ideal test site forsuch new translational research approaches, ... program is often close toimpermeable. In contrast, universities and many researchinstitutions contain a semi-permeable barrier that allowsacademic investigators to work in both arenas, albeit in separate ... researcher who has participated in many laboratoryand clinical research studies, as well as several successful biotechnologycompany start-ups, both privately and in his current role as a principalinvestigator...
- 4
- 395
- 0
báo cáo hóa học:" An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" ppt
... interestsMRE-B is a translational researcher who has participated in many laboratoryand clinical research studies, as well as several successful biotechnologycompany start-ups, both privately and in his ... new thinking along these lines and couldserve as a template for commercializ ation efforts in thepercubator [12,13]. And as a practical matter, designat-ing percubator investigators and their ... role as a principalinvestigator in the NIH intramural program. The article was written in hispersonal capacity and the views do not represent those of the Department of Health and Human Services,...
- 4
- 417
- 0
Báo cáo y học: " Exhaled breath condensate pH as a biomarker of COPD severity in ex-smokers" potx
... 10 minutes) and wasmeasured using a commercially available pH meter (Model 3510, Jenway, Essex, UK).Statistical analysisData are expressed as mean ± standard deviation (SD)or as median (interquartile ... has evaluated the association of EBC pHwith functional and clinical parameters that are relevant toclinical practice in a large cohort of patients with COPD.The aim of the present study was ... EBC pH values with functional parameters,including parameters expressing static hyperinflation andair-trapping, were evaluated. Finally, those associationswere further analyzed according to...
- 7
- 449
- 0
Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ