Báo cáo khoa học: "SOFA is superior to MOD score for the determination of non-neurologic organ dysfunction in patients with severe traumatic brain injury: a cohort study" doc

... Hirashima Y, Nakamura S, Endo S, Kuwayama N, Naruse Y, Takaku A: Elevation of platelet activating factor, inflammatorycytokines, and coagulation factors in the internal jugular vein of patients ... cardiovascular failure is a poor discriminator of outcome rather than SOFA overcallingcardiovascular failure due to vasopressor use for cerebrovas-cular support. In general, an increasing SOFA respiratory ... superior to MOD score for the determination of non-neurologic organ dysfunction in patients with severe traumatic brain injury: a cohort studyDavid Zygun1,2,3, Luc Berthiaume1,4, Kevin Laupland1,3,4,...

Báo cáo y học: "The relation between the incidence of hypernatremia and mortality in patients with severe traumatic brain injury" pptx

... to isolate the effect of each variate independently of the other (Adjusted for baseline risk of death and for each other). Finally, the hazard ratio associated with hypernatremia was estimated ... confounding factors (Crude analysis), and after adjusting for baseline risk (Adjusted for baseline risk of death). They were then estimated including hypernatremia and DDAVP use in the same model in ... patient's care sus-pected CDI. Notably, the administration of DDAVP during the ICU stay was also associated with severe brain injury at admis-sion (data not shown).Mannitol was administered in...

Báo cáo y học: " Previous hospital admissions and disease severity predict the use of antipsychotic combination treatment in patients with schizophrenia" pps

... Ballerini A, Baccalon RM, Boncompagni G, Casacchia M, Margari F,Minervini L, et al: Main clinical features in patients at their firstpsychiatric admission to Italian acute hospital psychiatric ... 1478, Norway.Authors’ contributionsAB: collecting data, analysis, drafting and revising the manuscript. OAA:conception of the study, collecting data, analysis, drafting and revising the manuscript. ... data and revising the manuscript. LT:conception of the study, analysis, drafting and revising the manuscript. Allauthors have read and approved the final manuscript.Competing interestsOAA and...

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... (Paris,France): 5forGulox (forward), 5¢-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGATGACGACGACAAGATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3rev-Gulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A- 3¢. ... corresponding a- ketoacids in the pathway for branched-chain amino acids [45].These observations suggest that L-AA could act in M. tuberculosis as a modulator of gene expressionand an enzyme cofactor, ... uses d-arabinono-1,4-lac-tone [16], l-galactono-1,4-lactone and l-gulono-1,4-lac-tone [17] as substrates. d-Arabinono-1,4-lactone is a natural substrate in the pathway to d-erythroascorbicacid...

Báo cáo khoa học: "TaqMan reverse transcription polymerase chain reaction for the detection of Japanese encephalitis virus" pot

... preparation The JEV isolate KV1899, Anyang 300 (attenuatedvaccine strain) and Nakayama strain were used as standardvirus for detection of JEV by real-time RT-PCR. The KV1899 and Anyang 300 strains ... quencher at the 3' end to monitoraccumulation of PCR products [4]. In this study, a real-time RT-PCR assay with TaqManprobe was investigated and applied for laboratory detectionand quantification ... positionGenomicregionLength of ampliconJE1F AAACCGGGCCATCAATATGC 125-144*JE1R TGATAAGAGCCAGCACGAATCG 228-249 5' NTR 125 bpProbe1 6Fam-TGCCGTGGGCAACGATCCG-Tamra 220-239JE2F CCATCACGTACG AATGTCCG 620-639JE2R...

Báo cáo khoa học: " Three-dimensional Huh7 cell culture system for the study of Hepatitis C virus infection" ppsx

... apical staining of this marker wasapparent in distinct areas of 3-D Huh7 aggregates (Fig. 3).Taken together, these data demonstrate that the expres-sion and distribution of cell adhesion and TJ ... [2].RNA isolation and RTqPCRTotal cellular RNA was isolated by the guanidine thiocy-anate method using standard protocols [29]. One μg of RNA was used for cDNA synthesis using TaqMan reversetranscription ... an appropriate model for investigating HCV entry, particularly the interaction,organization, and stoichiometry of HCV receptors and TJproteins. Additional analyses to determine the extent of differentiation...

Báo cáo khoa học: "Three-dimensional Huh7 cell culture system for the study of Hepatitis C virus infection" pdf

... apical staining of this marker wasapparent in distinct areas of 3-D Huh7 aggregates (Fig. 3).Taken together, these data demonstrate that the expres-sion and distribution of cell adhesion and TJ ... 369:583-591.34. Kamiya A, Kinoshita T, Ito Y, Matsui T, Morikawa Y, Senba E,Nakashima K, Taga T, Yoshida K, Kishimoto T, Miyajima A: Fetalliver development requires a paracrine action of oncostatinM through ... 262:13907-13915.37. Nakata K, Tanaka Y, Nakano T, Adachi T, Tanaka H, Kaminuma T,Ishikawa T: Nuclear receptor-mediated transcriptional regu-lation in Phase I, II, and III xenobiotic metabolizing systems.Drug...

Báo cáo y học: " Differential temporal profile of lowered blood glucose levels (3.5 to 6.5 mmol/l versus 5 to 8 mmol/l) in patients with severe traumatic brain injury" docx

... as visualized by cluster analysis with self-organizing maps. Crit Care Med 2004, 32:2428-2436.18. Kato T, Nakayama N, Yasokawa Y, Okumura A, Shinoda J, IwamaT: Statistical image analysis of ... resulted in a total of 58,794 values in all patients and an average of 258 values perpatient.Values assessed at 4-hour intervals or once daily were used to determine changes in the individual parameters ... hospitalization, duration of ventila-tion and substantially lowered costs [7]. Patients with various types of traumatic and nontraumatic brain lesions also appear to profit from this approach...

Báo cáo y học: "Brain metabolism is significantly impaired at blood glucose below 6 mM and brain glucose below 1 mM in patients with severe traumatic brain injury" pptx

... <0.001).Administration of insulin at brain glucose less than 5 mM (the threshold determined in Figure 5) was associated with a significant increase in brain glutamate (Figure 6a) andunchanged brain ... data, performedgraphical and statistical analysis, and drafted parts of the manuscript. Allauthors have read and approved the final manuscript.Acknowledgements The help of the nursing staff ... Changes in (a) brain glutamate, (b) calculated brain lactate -to- glutamate ratio, and arterial blood glucose determined by cerebral microdialysis investigating the influence of time points with...

Báo cáo y học: " Vascular endothelial growth factor as a non-invasive marker of pulmonary vascular remodeling in patients with bronchitis-type of COPD" pot

... factor as a non-invasive marker of pulmonary vascular remodeling in patients with bronchitis-type of COPDHiroshi Kanazawa*, Kazuhisa Asai and Saeko NomuraAddress: Department of Respiratory ... KA participated in the analysis and inter-pretation of data, technical support, and critical revision of the manuscript. SN participated in the analysis andinterpretation of data, technical ... Medicine, Graduate School of Medicine, Osaka City University, 1-4-3, Asahi-machi, Abenoku, Osaka, 545-8585, JapanEmail: Hiroshi Kanazawa* - kanazawa-h@med.osaka-cu.ac.jp; Kazuhisa Asai - kazuhisa.asai@mcgill.ca;...

Xem thêm