Báo cáo khoa học: "What is a pressure–volume curve" ppt

... used is markedly higher than the plateau pressure during the courseof mechanical ventilation.Among different patients, Papazian’s group found sustainedincreases in PaO2, decreases in PaO2and ... increases inPaCO2. Although it is difficult to speculate without havingmore precise data from these patients, several mechanismscan be at work explaining these effects. An increase inoxygenation ... Demory D, Arnal JM, Donati S, Gainnier M,Papazian L: Generation of a single pulmonary pressure–volume curve does not durably affect oxygenation in ARDSpatients. Crit Care 2006, 10:R85.14. Maggiore...

báo cáo khoa học: "What is the value and impact of quality and safety teams? A scoping review" potx

... quantita-tive data analyses. Instead a descriptive summary is presented [13,18].Summary of research on quality and safety teams inacute careTo assist in the description and analysis, papers ... Michael’s Hospital, Toronto, Ontario, Canada.3Faculty of Medicine, University of Calgary, Calgary, Alberta, Canada.4HealthSystems and Workforce Research Unit, Alberta Health Services, Calgary,Alberta, ... Calgary,Alberta, Canada.5Research and Applied Learning Division, WinnipegRegional Health Authority, Winnipeg, Manitoba, Canada.6Department ofMedicine, University of Ottawa, Ottawa Hospital Research...

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... 252.221.81.41.21.610.80.60.40.20 A 600 A 600 A 600Time (h)Fig. 5. His41 is essential for Paracoc-cus pantotrophus NirF, but Asp129 is dis-pensable. Growth plots and time courses ofnitrite appearance and disappearance ... in a mutant thatlacks NirF; this too is not trivial as the DnirF straindoes not accumulate readily detectable amounts of anintermediate of d1synthesis.Experimental proceduresDNA manipulationsDNA ... sequencingand mutational analysis of a gene cluster involved innitrite reduction in Paracoccus denitriﬁcans. AntonieLeeuwenhoek 66, 111–127.13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997)Gene...

Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx

... (AAC71532) and with the putative triacylglycerol lipaseAAB96044 from Mycoplasma pneumoniae (Mp). Identical aminoacids are indicated by an asterisk and similar amino acids are indi-cated by a colon and ... Woolford CA, Noble JA, Garman JD, Tam MF, InnisMA & Jones EW (1993) Phenotypic analysis of protein-ase A mutants. Implications for autoactivation and thematuration pathway of the vacuolar hydrolases ... Chemicals, Darmstadt, Germany).For construction of pPC86-LPX1 and pPC97-LPX1,YOR084w was ampliﬁed using primers 5¢-CCCGGGAATGGAACAGAACAGGTTCAAG-3¢ and 5¢-AGATCTTTACAGTTTTTGTTTAGTCGTTTT-3¢, and...

Báo cáo khoa học: NANOGP8 is a retrogene expressed in cancers pdf

... NANOGP86050403020100MockMockNANOGP8NANOGP81.8 A B1.61.41.210.80.60.40.20day 1day 2 day 3 day 4% AbsorbanceS stage percentageFig. 6. FACS analysis results. FACS analysis of cells transfectedwith NANOGP8 and the mock ones (A) and the MTT assay (B). Thepercentage ... instuctions. Total RNA was digestedwith RNAase-free DNase I (TaKaRa Carlsbad, CA, USA)at 37°C for 30 min and inactivated at 60°C for 10 min.With total RNA (2 lg) as the template and oligo(dT) asthe ... exclude the DNA contamin-ation. cDNA template (3 lL) was used in a 25 lL reactionvolume with rTaq DNA polymerase or LA TaqTMDNApolymerase with GC buffer (TaKaRa). Human NANOGP8mRNA was ampliﬁed...

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

... disRAS1fwd5¢-TTCACGATTGAACAGGTAAACAAAATTTTCCCTTTTTAGAACGACATGCAGCTGAAGCTTCGTACGC-3¢ and disRAS1rev CAAAACCATGTCATATCAAGAGAGCAGGATCATTTTCAACAAATTATGCATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 wasconstructed to contain SUT2 as ... 5¢-TGACGCTCACCAAGCTATTGGTTTGTTTGGATCAATCGTCAGATATGAAGGCATAGGCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TATTAATATTCCTATATTTTACATAGGAGGAAATTACATGCATGAAACCTACAGCTGAAGCTTCGTACGC-3¢, respectively. The plasmid pFL38-RAS2 was con-structed by ligating ... http://mips.gsf.de/proj/yeast/info/tools/hegemann/gfp.html) using the primersSUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCCCGCTGGCTTCCAAACCCTTATCGATACCGTCGACCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACAGGAAACAGCTATGACCATGATTACGCTATAGGGCGAATTGGGTA-3¢,...

Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

... asfollows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAATCACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACATCCTTGGTACCAGGTGATTTTTCTTGTGAAGAT.All experimental protocols described in this study wereapproved by ... 110, 151–164.26 Tomari S, Nagahama H, Shu Y, Hoshi S, NakayamaK, Nakayama KI & Nagata M (2002) Glomerular dif-ferentiation in p27 and p57 double-mutant metanephroi.Anat Embryol 206, 31–36.27 ... The data were deposited in GEOdatabase GSE2043 (a complete list of these genesappears in Table S1 and a partial list is shown inTable 1). Because only a single microarray was usedfor each...

Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx

... used for generating the five mutants were:C126S, 5¢-TAATTTAAAAGCCGTTGTATCCTTTGGTGAATCTT-3¢; C12 6A, 5¢-TAATTTAAAAGCCGTTGTAGCTTTTGGTGAATCTT-3¢; C126V, 5¢-TAATTTAAAAGCCGTTGTAGTTTTTGGTGAATCTT-3¢; ... 5¢-TAATTTAAAAGCCGTTGTAATGTTTGGTGAATCTT-5¢;and C126T, 5¢-TAATTTAAAAGCCGTTGTAACTTTTGG TGAATCTT-3¢.Protein expression and purificationThe TIM gene carrying the mutation was expressed inE. coli AA200 ... site-specificmutagenesis – distal effects on dimer stabilityMoumita Samanta1, Mousumi Banerjee1, Mathur R. N. Murthy1, Hemalatha Balaram2and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian...

Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt

... transvacuolar strands and maintain overallcellular architecture. As mentioned above, CRP1 mayparticipate in the formation and ⁄ or maintenance oflong actin cables [12]. Consistent with this ... pellets (P) and supernatants (S) were analyzed by SDS ⁄ PAGE and stained with Coomassie Brilliant Blue. (C)Quantitation analysis for GST–hhLIM association with F-actin at different concentrations ... interact with actin, a seriesof truncated mutants was constructed and a GST pull-down assay was used. This showed that the F4 region(amino acids 41–194), which contains the LIMdomain 2, has almost...

Báo cáo khoa học: Insulin is a kinetic but not a thermodynamic inhibitor of amylin aggregation pot

... amylin to evaluate its effect onamylin aggregation. Samples were incubated at 37 °C for72 h with shaking, and were taken for ThT assays, light scat-tering assays and HPLC analysis at selected ... formation. A detailed viewof the early stage of aggregation was obtained with theThT assay (Fig. 2), which shows similar kineticfeatures as the light scattering assay. The data showthat insulin ... was loaded into the HPLC system. Dilution buffercontained 30% acetonitrile and 0.006% triﬂuoroacetic acid.Absorbance was measured at 280 nm, and the ﬂow rate was0.3 mL ⁄ min.Statistical analysisData...

Xem thêm