0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: " A Process monitoring in intensive care with the use of cumulative expected minus observed mortality and risk-adjusted p charts" ppt

Báo cáo khoa học:

Báo cáo khoa học: " A Process monitoring in intensive care with the use of cumulative expected minus observed mortality and risk-adjusted p charts" ppt

... hospitalsbecause of the complexity of analysis, unfamiliarity among cli-nicians and managers and difficulty in translating to clinicalpractice. The E-O chart offers a rapid and qualitative plot. ... 1Research Process monitoring in intensive care with the use of cumulative expected minus observed mortality and risk-adjusted p chartsJerome GL Cockings1, David A Cook2 and Rehana K Iqbal31Department ... changes with an acceptable false alarm rate, and they canbe difficult to explain to managers, clinicians and non-statisti-cians. The purpose of this paper is to evaluate a simple method of local...
  • 9
  • 305
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Intracranial pressure monitoring in intensive care: clinical advantages of a computerized system over manual recording" potx

... to the acquisition, analysis, and interpretation of data and helped to draft the manuscript. LG and SL made substantialcontributions to the acquisition, analysis, and interpretation of data. AC ... properlycapture ICP increases and to adequately rank the severity of ICP, comparisons with the digital tracing were made and the digital tracing was analyzed in five ways: (a) The end-hourminute ICP was identified. ... intracranial hypertension (HICP) (> 20 mm Hg) for each patient and (c) the difference of digital and manual percentages of time of HICPBar graphs depicting the (a) digital and (b) manual percentages...
  • 6
  • 311
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Key advances in critical care in the out-of-hospital setting: the evolving role of laypersons and technology" docx

... http://ccforum.com/content/10/1/119AbstractDuring the past decade, critical care in the out -of- hospital setting hastranscended the original emphasis on on-scene advanced lifesupport interventions by doctors, paramedics, and ... espoused the conceptthat a gram of good prehospital care can save a kilogram of in- hospital ICU care . In the case of automated externaldefibrillators (AEDs), it seems that the 1,500 gramsconstituting ... forcritical care situations have now begun to focus increasinglyon how the average person can save lives, and perhaps evenspare precious ICU resources.Many prehospital care providers have espoused...
  • 3
  • 280
  • 0
Báo cáo khoa học: A Kazal prolyl endopeptidase inhibitor isolated from the skin of Phyllomedusa sauvagii pdf

Báo cáo khoa học: A Kazal prolyl endopeptidase inhibitor isolated from the skin of Phyllomedusa sauvagii pdf

... serine proteaseinhibitor – a variant of PSKP-1 was prepared with Leu, Pro and Gly at P 6 ,P 5 and P 4, respectively, and with Lys at P 1(Fig. 2). The new variant, PSKP-1Khas a similar expressionlevel ... sauvagii Kazal protein 1 (PSKP-1). After an initial search with BLAST[54], alignmentto PSKP-1 was optimized manually. 1HPT and 2OVO are two examples of Kazal domains included in the Protein ... PSKP-1Kwas inhibited byEDTA and heparin.Certain basic proteins have ancillary antibacterial activ-ity. Some examples are aprotinin, SLPI, and CAP18 [39,40].All seem to interact with bacterial...
  • 10
  • 456
  • 0
báo cáo khoa học:

báo cáo khoa học: " Implementing quality indicators in intensive care units: exploring barriers to and facilitators of behaviour change" pot

... clinical practice.Competing interests The authors declare that they have no competing interests.Authors' contributionsAll authors participated in manuscript preparation, and read and approved ... healthcare professionals and managers are familiar with using quality indicators to improve care, and that they have positive attitudes towards the implementation of quality indicators. Despite these ... promote the use of quality indicators, an exploration of the barriers to and facilitating factors for their implementation among healthcare professionals and managers of intensive care units...
  • 8
  • 273
  • 0
Báo cáo khoa học: Examining multiprotein signaling complexes from all angles The use of complementary techniques to characterize complex formation at the adapter protein, linker for activation of T cells pdf

Báo cáo khoa học: Examining multiprotein signaling complexes from all angles The use of complementary techniques to characterize complex formation at the adapter protein, linker for activation of T cells pdf

... signaling complexes form at the cytoplasmicdomain of transmembrane receptors, and at modularenzymes and nonenzymatic adapter proteins. Suchcomplexes are vital for the activation and propagation of ... 2005)doi:10.1111/j.1742-4658.2005.04972.xDynamic protein–protein interactions are involved in most physiologicalprocesses and, in particular, for the formation of multiprotein signalingcomplexes at transmembrane receptors, adapter proteins ... studiesInitial analysis of the intracellular region of LAT, along with the early characterization of pp36 ⁄ 38, suggestedthat LAT functions as a classic adapter protein by faci-litating the inducible...
  • 10
  • 457
  • 0
báo cáo khoa học:

báo cáo khoa học: " Evidence-informed health policy 3 – Interviews with the directors of organizations that support the use of research evidence" pps

... publication.Authors' contributionsJL participated in the design of the study, participated in analyzing the qualitative data, and drafted the article and the report in which it is based. AO conceived ... the datacollection and the analysis of the qualitative data, and contributed to drafting the article. EP contributed to datacollection. All authors read and approved the final manu-script.Additional ... five in North America, four in Asia,three in Latin America, two each in Africa, Eastern Europe, and the Middle East, and one in Australia. The organiza-tions varied in size from a few people...
  • 10
  • 267
  • 0
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx

Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx

... view of (A) ,showing only the data obtained in the absence of Du.(C)Theratioof the best-fitting functions and of the data points of wild-type overmutant are plotted for data in the presence (d)andabsence(m)ofDu.1988 ... substitution with a kanamycinresistance cassette. Therefore, the resulting strain carried the deletion of the chromosomal atp2 operon and severalcopies of a plasmid carrying the mutated atp2 operon. As ... DpH and Du in driving the ATP synthesis reactionPaola Turina and B. Andrea MelandriDepartment of Biology, Laboratory of Biochemistry and Biophysics, University of Bologna, Italy The interface...
  • 9
  • 580
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A POOAFR MODIFICATIONS IN TEFRAIMOGSRP SLOHOML SFPG" potx

... recognition of the need for explicit characterizations of the properties that relate and distinguish similar grammar formalisms. The paper proposes a series of changes in the for- malism of Generalized ... genuine gain in expressiveness for the formalism. Other devices, such as Feature Instantiation Principles and Linear Precedence Statements can be regarded as special cases of CCRs. The proposals ... restrictions gov- erning the combination of features and values in feature specifications; the definition of the value range of a feature can thus be regarded as another special case of cooccurrence...
  • 4
  • 294
  • 0
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢GTL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢GCL ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢GTE 61 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢GCE 61 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢CLS ... as the pellet. In the set con-taining ATPcS, the entire protein sample was recov-ered in the supernatant (Fig. 5A) and no protein wasdetected in the pellet fractions (data not shown). In the...
  • 16
  • 397
  • 0

Xem thêm

Từ khóa: tuyên tập cac bao cao khoa học hội nghị khoa học địa i apos abáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họcNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ