Báo cáo y học: "The incidence of hip, forearm, humeral, ankle, and vertebral fragility fractures in Italy: results from a 3-year multicenter stud" pptx
Báo cáo y học: "The incidence of hip, forearm, humeral, ankle, and vertebral fragility fractures in Italy: results from a 3-year multicenter stud" pptx
... 12:R226http://arthritis-research.com/content/12/6/R226Page 9 of 9RESEARCH ARTICLE Open AccessThe incidence of hip, forearm, humeral, ankle, and vertebral fragility fractures in Italy: results from a 3-year multicenter ... on data obtained from Scandinavian and NorthAmerican populations) [36].Table 13 Overall estimation of fragility fractures and F/M ratio in Italy (2006)Total F/M Ratio in patients older than ... only to car-diovascular diseases as a critical health problem [3], and previous analyses have shown that the incidence and costs of hip fractures in Italy are already comparable tothose of acute...
- 9
- 311
- 0
Báo cáo y học: " The relationship between hip abductor muscle strength and iliotibial band tightness in individuals with low back pain" potx
... conception and design,acquisition of data, analysis and interpretation of data and have beeninvolved in preparing the manuscript. Both authors read and approved thefinal manuscript.Competing interestsThe ... AbbreviationsITB: Iliotibial Band; LBP: Low Back Pain; TFL: Tensor Fascia LataAuthor details1Department of Physical Therapy, Universi ty of Social Welfare and Rehabilitation Sciences, Evin, ... play a significant role in control of rotational alignment of thelimb and maintaining pelvic lateral stability in single legstance [1,6,7]. Gottschalk et al [8] believe that the pri-mary function...
- 5
- 375
- 0
Báo cáo y học: " The incidence of relative adrenal insufficiency in patients with septic shock after the administration of etomidate" pot
... shock after etomidate administration. We hypothesisedthat the administration of etomidate increases the incidence of relative adrenal insufficiency in patients with septic shock.Materials and ... cosyntropin stimulationtest, or if they had an adrenal or pituitary disorder. The MayoFoundation Institutional Review Board approved the study, and a waiver of informed consent was granted. Patients ... Afessa2 and Javier D Finkielman31Department of Cardiothoracic Anesthesiology, The Cleveland Clinic, 9500 Euclid Ave., Cleveland, OH 44195, USA2Division of Pulmonary and Critical Care Medicine,...
- 3
- 266
- 1
Báo cáo y học: "The incidence of multidrug and full class resistance in HIV-1 infected patients is decreasing over time (2001–2006) in Portugal" potx
... Dinis, Ana Mineiro, Isabel Batista, José Vera, Ana Galiano, Luís Tavares, Sofia Pinheiro, Maria João Águas, Júlio Botas, José Poças, Ana Paula Brito, Carlos Santos, Domitília Faria, Ana Paula ... interpretation of the genotypic resistance information. In particular, thedecline in resistance can be partially explained by the factthat in the early years of 2000, treatment initiation in patients was ... presuma-bly decrease even further the incidence of resistance.Competing interestsAll authors received travel grants from the pharmaceuticalindustry. Kamal Mansinho, Anne-Mieke Vandamme and Ricardo...
- 8
- 292
- 1
Báo cáo y học: "The incidence of sub-optimal sedation in the ICU: a systematic review" ppsx
... retrospective assessment of impact on sedative and analgesic requirements, levels of sedation and analgesia, and ventilatory and hemodynamicparameters. Pharmacotherapy 2007, 27:351-359.43. Payen JF, Chanques ... TS, Ramsay P, Lapinlampi TP, Sarkela MO, Viertio-Oja HE,Merilainen PT: An assessment of the validity of spectral entropyas a measure of sedation state in mechanically ventilated crit-ically ill ... Ram-say scale values. These were 4 during the day and 5 at night, in contrast to the study's stated aim of Ramsay levels of 2 to 3during the day and 3 to 4 at night; this study again noted a possible...
- 14
- 435
- 0
Báo cáo y học: "The impact of HLA-DRB1 genes on extra-articular disease manifestations in rheumatoid arthritis" doc
... 149 extra-articular rheumatoid arthritis (ExRA) and 163 non-ExRA patients.bInformation available from 120 ExRA and 151 non-ExRA patients. ANA, antinuclear antibody; RA, rheumatoid arthritis; ... duration of RA ± 5 years. DNA samples were available from 86 ExRA cases and 85 controls for HLA typing.Another cohort of patients was recruited from a prospectivestudy of extra-articular disease manifestations ... community-basedregister of RA patients in the city of Malmö [28] or from a com-munity-based early RA inception cohort from the same area.Samples from 28 patients with ExRA (cases) and 28 matchedpatients with RA...
- 8
- 351
- 0
Báo cáo y học: "The effect of tight glycaemic control, during and after cardiac surgery, on patient mortality and morbidity: A systematic review and meta-analysis" pptx
... resulting in increased gluconeogenesis and glycogenolysis [3].Uncontrolled hyperglycaemia can lead to: hypokalaemia,hyponatraemia, arrhythmias and an increased risk of ischemic brain injury [4]. ... cardiopulmonary bypass with insulin may initiatepostoperative hypoglycaemia. Anesth Anal 1999, 89:1091-1095.13. Ghandi GY, Nuttall GA, Abel MD, et al: Intensive intraoperative insulintherapy versus ... during and after cardiac surgery, on patient mortality and morbidity: A systematic review and meta-analysisKristin K Haga1*, Katie L McClymont1, Scott Clarke1, Rebecca S Grounds1, Ka Ying...
- 10
- 850
- 0
Báo cáo y học: " The use of partial exchange blood transfusion and anaesthesia in the management of sickle cell disease in a perioperative setting: two case reports" pot
... Para-cetamol and Piritramid intravenously as needed.After the surgery, the boy complained of a relapsingupper abdominal pain. Laboratory parameters showedincreased markers for cholestasis. After an ... and t hey hadmuscle hypotrophy, signs of chronic hypoxia and chronic hepatitis B. The 10-year-old had malaria quar-tana, and his older brother had terminal renal insuffi-ciency. Episodes of ... anaesthesia and the perioperative period [5,6].The clinical symptoms of SCD, which start in earlychildhood, are splenomegaly, haemolytic anaemia and relapsing pain. A diagnosis of S CD can be confirmedusing...
- 6
- 438
- 0
Báo cáo y học: " The effect of interleukin-13 (IL-13) and interferon-g (IFN-g) on expression of surfactant proteins in adult human alveolar type II cells in vitro" docx
... GCCTCATTTTCCTCTGGATTCCSP-B TGGGAGCCGATGACCTATG CAAGAGTGTGAGGACATCGTCCACATCC GCCTCCTTGGCCATCTTGTSP-C CGGGCAAGAAGCTGCTTCT CCACACCGCAGGGACAAACCCT CCACACCGCAGGGACAAACCCTSP-D ACACAGGCTGGTGGACAGTTG CCTCTCCACGCTCTGCCGCGT ... contributionsYI carried out all human and rat ATII cells studies. YI and RJM participated in the design of the study and data analysis. All authors have read and approved of the final manuscript.Competing ... Kosmider, Emily Travanty, MrinaliniNikrad and Jayashree Subramanian for assistance with human ATII cellisolations. Finally, we thank Teneke M. Warren and Catheryne Queen forassistance with manuscript...
- 13
- 256
- 0
Báo cáo y học: " The role of secretory leukocyte proteinase inhibitor and elafin (elastase-specific inhibitor/skin-derived antileukoprotease) as alarm antiproteinases in inflammatory lung disease" ppt
... recently beentermed the trappin family [2•]. Elafin can be divided intotwo domains, the carboxy-terminal domain containing theantiproteinase active site and the amino-terminal domaincontaining ... molecules of the collectin family [such asthe surfactant proteins A (SP -A) ] and defensins (indicated by 1). In addition, SLPI and elafin have a role in modulating inflammation byinhibiting the ... Bycomparison, ‘systemic inhibitors’ such as A1 -Pi and antichymotrypsin are upregulated mainly by a later wave of cytokines such as those of the IL-6 family (IL-6 and onco-statin M), suggesting...
- 6
- 188
- 0
Từ khóa: chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP